Starting /dee2/code/volunteer_pipeline.sh SRR12671701 current disk space = 3049153728512 free memory = 1547569204 SRR12671701 SRAfilesize 0faf2930178cc55072528a59cdfeada1 SRR12671701.sra SRR12671701.sra file validated SRR12671701 is paired end SRR12671701 is conventional basespace SRR12671701 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671701_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3115 37.0 37.0 37.0 37.0 37.0 2 36.04175 37.0 37.0 37.0 37.0 37.0 3 36.3555 37.0 37.0 37.0 37.0 37.0 4 36.434 37.0 37.0 37.0 37.0 37.0 5 36.4975 37.0 37.0 37.0 37.0 37.0 6 36.483 37.0 37.0 37.0 37.0 37.0 7 36.481 37.0 37.0 37.0 37.0 37.0 8 36.4575 37.0 37.0 37.0 37.0 37.0 9 36.501 37.0 37.0 37.0 37.0 37.0 10-14 36.5437 37.0 37.0 37.0 37.0 37.0 15-19 36.525299999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.4948 37.0 37.0 37.0 37.0 37.0 25-29 36.466 37.0 37.0 37.0 37.0 37.0 30-34 36.4813 37.0 37.0 37.0 37.0 37.0 35-39 36.4689 37.0 37.0 37.0 37.0 37.0 40-44 36.4581 37.0 37.0 37.0 37.0 37.0 45-49 36.36450000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.3794 37.0 37.0 37.0 37.0 37.0 55-59 36.351800000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.380900000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.3397 37.0 37.0 37.0 37.0 37.0 70-74 36.3089 37.0 37.0 37.0 37.0 37.0 75-79 36.25359999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.2924 37.0 37.0 37.0 37.0 37.0 85-89 36.245400000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.17960000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.1001 37.0 37.0 37.0 37.0 37.0 100-104 36.1338 37.0 37.0 37.0 37.0 37.0 105-109 36.0889 37.0 37.0 37.0 37.0 37.0 110-114 36.112199999999994 37.0 37.0 37.0 37.0 37.0 115-119 36.061400000000006 37.0 37.0 37.0 37.0 37.0 120-124 36.042199999999994 37.0 37.0 37.0 37.0 37.0 125-129 36.0178 37.0 37.0 37.0 37.0 37.0 130-134 35.9468 37.0 37.0 37.0 37.0 37.0 135-139 35.9364 37.0 37.0 37.0 37.0 37.0 140-144 35.8586 37.0 37.0 37.0 37.0 37.0 145-149 35.8351 37.0 37.0 37.0 37.0 37.0 150-151 35.29175 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 2.0 25 0.0 26 1.0 27 2.0 28 10.0 29 26.0 30 19.0 31 37.0 32 63.0 33 79.0 34 117.0 35 348.0 36 2974.0 37 321.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.5 16.650000000000002 9.775 37.075 2 21.183253948357986 20.00501378791677 39.959889696665826 18.851842567059414 3 17.299999999999997 27.450000000000003 27.750000000000004 27.500000000000004 4 20.549999999999997 36.05 23.599999999999998 19.8 5 20.175 38.25 22.2 19.375 6 17.025000000000002 37.75 24.975 20.25 7 14.35 20.125 45.95 19.575 8 17.925 20.75 29.15 32.175 9 19.025 22.575 31.275 27.125 10-14 20.18 28.939999999999998 26.555 24.325 15-19 19.63 28.375 27.74 24.255 20-24 19.495 28.57 27.915 24.02 25-29 19.900000000000002 28.415000000000003 27.534999999999997 24.15 30-34 19.98 28.050000000000004 28.09 23.880000000000003 35-39 19.75 28.599999999999998 27.88 23.77 40-44 20.025000000000002 28.595 27.779999999999998 23.599999999999998 45-49 19.73 29.060000000000002 27.145000000000003 24.065 50-54 19.63 28.79 27.439999999999998 24.14 55-59 19.705000000000002 29.21 27.425 23.66 60-64 20.03 28.475 27.435 24.060000000000002 65-69 20.36 27.935 27.79 23.915 70-74 19.985 28.465 27.810000000000002 23.74 75-79 19.84 28.415000000000003 28.315 23.43 80-84 20.885 28.425 27.744999999999997 22.945 85-89 20.755000000000003 28.38 27.415 23.45 90-94 20.555 28.925 27.41 23.11 95-99 20.03 28.435 27.91 23.625 100-104 20.66 28.075 27.595 23.669999999999998 105-109 20.119999999999997 27.77 28.38 23.73 110-114 20.544999999999998 28.325 27.58 23.549999999999997 115-119 20.935000000000002 28.29 27.075 23.7 120-124 20.375 28.275 27.334999999999997 24.015 125-129 20.580000000000002 27.400000000000002 28.144999999999996 23.875 130-134 21.375 27.91 27.43 23.285 135-139 20.830000000000002 27.694999999999997 27.515 23.96 140-144 21.085 28.244999999999997 26.96 23.71 145-149 21.02 28.13 27.675 23.175 150-151 21.8125 28.15 26.7125 23.325000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 2.0 22 4.0 23 3.0 24 2.5 25 3.5 26 3.0 27 6.5 28 11.5 29 16.5 30 19.0 31 18.5 32 24.0 33 38.5 34 47.5 35 67.5 36 100.5 37 113.5 38 140.5 39 186.0 40 207.0 41 214.0 42 241.5 43 264.0 44 272.5 45 266.5 46 245.5 47 235.5 48 226.0 49 206.0 50 190.0 51 164.5 52 111.5 53 84.0 54 72.0 55 51.0 56 36.5 57 26.0 58 22.5 59 18.0 60 13.0 61 8.5 62 3.5 63 2.5 64 2.0 65 0.5 66 0.5 67 0.5 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.65 #Duplication Level Percentage of deduplicated Percentage of total 1 92.90339989206691 86.075 2 6.287101996762008 11.65 3 0.7825148407987047 2.175 4 0.026983270372369132 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.48750000000000004 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.6375 0.0 0.0 0.0 0.0 116-117 0.7125 0.0 0.0 0.0 0.0 118-119 0.775 0.0 0.0 0.0 0.0 120-121 0.8375 0.0 0.0 0.0 0.0 122-123 1.0125 0.0 0.0 0.0 0.0 124-125 1.2125 0.0 0.0 0.0 0.0 126-127 1.375 0.0 0.0 0.0 0.0 128-129 1.4625 0.0 0.0 0.0 0.0 130-131 1.625 0.0 0.0 0.0 0.0 132-133 1.85 0.0 0.0 0.0 0.0 134-135 2.0 0.0 0.0 0.0 0.0 136-137 2.1500000000000004 0.0 0.0 0.0 0.0 138-139 2.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTTCCA 10 0.006830828 145.0 4 >>END_MODULE SRR12671701 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671701_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.91 37.0 37.0 37.0 37.0 37.0 2 35.7155 37.0 37.0 37.0 37.0 37.0 3 35.936 37.0 37.0 37.0 37.0 37.0 4 35.6835 37.0 37.0 37.0 37.0 37.0 5 35.886 37.0 37.0 37.0 37.0 37.0 6 35.911 37.0 37.0 37.0 37.0 37.0 7 35.9865 37.0 37.0 37.0 37.0 37.0 8 36.056 37.0 37.0 37.0 37.0 37.0 9 35.9715 37.0 37.0 37.0 37.0 37.0 10-14 36.0629 37.0 37.0 37.0 37.0 37.0 15-19 36.057100000000005 37.0 37.0 37.0 37.0 37.0 20-24 35.9591 37.0 37.0 37.0 37.0 37.0 25-29 35.894600000000004 37.0 37.0 37.0 37.0 37.0 30-34 35.8989 37.0 37.0 37.0 37.0 37.0 35-39 35.9213 37.0 37.0 37.0 37.0 37.0 40-44 35.8442 37.0 37.0 37.0 37.0 37.0 45-49 35.853300000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.8162 37.0 37.0 37.0 37.0 37.0 55-59 35.7601 37.0 37.0 37.0 37.0 37.0 60-64 35.684999999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.6394 37.0 37.0 37.0 37.0 37.0 70-74 35.64790000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.6051 37.0 37.0 37.0 37.0 37.0 80-84 35.587300000000006 37.0 37.0 37.0 37.0 37.0 85-89 35.5826 37.0 37.0 37.0 37.0 37.0 90-94 35.537499999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.5646 37.0 37.0 37.0 37.0 37.0 100-104 35.561400000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.4654 37.0 37.0 37.0 37.0 37.0 110-114 35.4446 37.0 37.0 37.0 37.0 37.0 115-119 35.3395 37.0 37.0 37.0 32.2 37.0 120-124 35.3794 37.0 37.0 37.0 37.0 37.0 125-129 35.2377 37.0 37.0 37.0 29.8 37.0 130-134 35.30460000000001 37.0 37.0 37.0 34.6 37.0 135-139 35.289100000000005 37.0 37.0 37.0 32.2 37.0 140-144 35.068200000000004 37.0 37.0 37.0 25.0 37.0 145-149 35.181 37.0 37.0 37.0 29.8 37.0 150-151 34.756249999999994 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 1.0 22 6.0 23 5.0 24 1.0 25 13.0 26 13.0 27 20.0 28 24.0 29 36.0 30 46.0 31 69.0 32 81.0 33 140.0 34 286.0 35 685.0 36 2424.0 37 146.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.0 18.7 12.675 29.625 2 26.025 22.15 35.175 16.650000000000002 3 18.025 28.425 33.1 20.45 4 23.05 36.9 21.7 18.35 5 22.95 38.125 21.575 17.349999999999998 6 18.6 37.75 23.1 20.549999999999997 7 17.4 18.475 42.55 21.575 8 20.25 23.525 27.925 28.299999999999997 9 21.3 24.125 30.275000000000002 24.3 10-14 22.1 27.93 26.735 23.235 15-19 22.43 27.075 28.244999999999997 22.25 20-24 21.615000000000002 28.365000000000002 27.750000000000004 22.27 25-29 22.095000000000002 28.194999999999997 28.035 21.675 30-34 22.235 27.27 28.46 22.035 35-39 22.39 28.37 27.575 21.665 40-44 21.645 28.095 27.915 22.345000000000002 45-49 22.535 27.85 28.24 21.375 50-54 22.39 28.185 28.199999999999996 21.224999999999998 55-59 22.509999999999998 27.67 27.76 22.06 60-64 22.555 27.82 27.860000000000003 21.765 65-69 23.035 27.675 27.560000000000002 21.73 70-74 22.915 27.139999999999997 27.339999999999996 22.605 75-79 22.79 27.560000000000002 27.884999999999998 21.765 80-84 22.515 27.27 28.38 21.834999999999997 85-89 23.044999999999998 27.560000000000002 27.935 21.46 90-94 23.380000000000003 27.529999999999998 27.755000000000003 21.335 95-99 22.955000000000002 27.36 28.349999999999998 21.335 100-104 22.95 27.650000000000002 28.055000000000003 21.345 105-109 23.544999999999998 27.575 27.205000000000002 21.675 110-114 23.119999999999997 27.91 27.889999999999997 21.08 115-119 23.064999999999998 28.375 27.400000000000002 21.16 120-124 23.765 27.58 27.98 20.674999999999997 125-129 24.125 27.650000000000002 27.755000000000003 20.47 130-134 23.935000000000002 27.61 27.565 20.89 135-139 23.315 27.575 27.88 21.23 140-144 24.075 27.02 28.065 20.84 145-149 23.89 27.529999999999998 27.6 20.979999999999997 150-151 24.712500000000002 27.5625 27.0 20.724999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 1.0 18 1.0 19 1.5 20 2.0 21 2.0 22 1.5 23 0.0 24 1.5 25 5.0 26 6.5 27 5.0 28 8.0 29 11.0 30 13.5 31 22.0 32 26.5 33 34.0 34 52.0 35 66.5 36 80.5 37 109.0 38 134.5 39 151.0 40 176.5 41 204.5 42 229.5 43 249.0 44 283.0 45 276.5 46 252.0 47 245.5 48 228.5 49 216.5 50 173.0 51 143.5 52 126.5 53 100.0 54 91.0 55 69.0 56 47.5 57 35.5 58 27.5 59 23.0 60 16.0 61 12.0 62 11.0 63 8.0 64 2.5 65 2.5 66 2.0 67 2.0 68 1.5 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.9 #Duplication Level Percentage of deduplicated Percentage of total 1 93.05705059203444 86.45 2 6.270182992465016 11.65 3 0.6458557588805167 1.7999999999999998 4 0.026910656620021525 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.48750000000000004 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.6375 0.0 0.0 0.0 0.0 116-117 0.7125 0.0 0.0 0.0 0.0 118-119 0.775 0.0 0.0 0.0 0.0 120-121 0.8375 0.0 0.0 0.0 0.0 122-123 1.0125 0.0 0.0 0.0 0.0 124-125 1.2125 0.0 0.0 0.0 0.0 126-127 1.3625 0.0 0.0 0.0 0.0 128-129 1.4375 0.0 0.0 0.0 0.0 130-131 1.6 0.0 0.0 0.0 0.0 132-133 1.8125 0.0 0.0 0.0 0.0 134-135 1.9500000000000002 0.0 0.0 0.0 0.0 136-137 2.0999999999999996 0.0 0.0 0.0 0.0 138-139 2.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCTCTC 10 0.006830828 145.0 6 >>END_MODULE Read 1158420 spots for SRR12671701.sra Written 1158420 spots for SRR12671701.sra Read 1158420 spots for SRR12671701.sra Written 1158420 spots for SRR12671701.sra Read 1158420 spots for SRR12671701.sra Written 1158420 spots for SRR12671701.sra Read 1158420 spots for SRR12671701.sra Written 1158420 spots for SRR12671701.sra Read 1158420 spots for SRR12671701.sra Written 1158420 spots for SRR12671701.sra Read 1158420 spots for SRR12671701.sra Written 1158420 spots for SRR12671701.sra Read 1158420 spots for SRR12671701.sra Written 1158420 spots for SRR12671701.sra Read 1158420 spots for SRR12671701.sra Written 1158420 spots for SRR12671701.sra Read 1158420 spots for SRR12671701.sra Written 1158420 spots for SRR12671701.sra Read 1158420 spots for SRR12671701.sra Written 1158420 spots for SRR12671701.sra Read 1158420 spots for SRR12671701.sra Written 1158420 spots for SRR12671701.sra Read 1158420 spots for SRR12671701.sra Written 1158420 spots for SRR12671701.sra Read 1158420 spots for SRR12671701.sra Written 1158420 spots for SRR12671701.sra Read 1158420 spots for SRR12671701.sra Written 1158420 spots for SRR12671701.sra Read 1158420 spots for SRR12671701.sra Written 1158420 spots for SRR12671701.sra Read 1158420 spots for SRR12671701.sra Written 1158420 spots for SRR12671701.sra Read 1158420 spots for SRR12671701.sra Written 1158420 spots for SRR12671701.sra Read 1158420 spots for SRR12671701.sra Written 1158420 spots for SRR12671701.sra Read 1158429 spots for SRR12671701.sra Written 1158429 spots for SRR12671701.sra Read 1158420 spots for SRR12671701.sra Written 1158420 spots for SRR12671701.sra SRR ids: ['SRR12671701.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_04dbqp35 SRR12671701.sra spots: 23168409 blocks: [[1, 1158420], [1158421, 2316840], [2316841, 3475260], [3475261, 4633680], [4633681, 5792100], [5792101, 6950520], [6950521, 8108940], [8108941, 9267360], [9267361, 10425780], [10425781, 11584200], [11584201, 12742620], [12742621, 13901040], [13901041, 15059460], [15059461, 16217880], [16217881, 17376300], [17376301, 18534720], [18534721, 19693140], [19693141, 20851560], [20851561, 22009980], [22009981, 23168409]] SRR12671701 file size 7851938 SRR12671701 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671701 SRR12671701_1.fastq SRR12671701_2.fastq Input file: SRR12671701_1.fastq Paired file: SRR12671701_2.fastq trimmed: SRR12671701-trimmed-pair1.fastq, SRR12671701-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:55:28 2025 >> started Wed Feb 12 04:55:52 2025 >> done (24.134s) 23168409 read pairs processed; of these: 26 ( 0.00%) short read pairs filtered out after trimming by size control 1686 ( 0.01%) empty read pairs filtered out after trimming by size control 23166697 (99.99%) read pairs available; of these: 936299 ( 4.04%) trimmed read pairs available after processing 22230398 (95.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 0 0.00% 21 2 0.00% 22 1 0.00% 23 2 0.00% 24 5 0.00% 25 4 0.00% 26 4 0.00% 27 8 0.00% 28 5 0.00% 29 8 0.00% 30 5 0.00% 31 17 0.00% 32 7 0.00% 33 14 0.00% 34 6 0.00% 35 18 0.00% 36 18 0.00% 37 16 0.00% 38 20 0.00% 39 17 0.00% 40 21 0.00% 41 27 0.00% 42 32 0.00% 43 23 0.00% 44 22 0.00% 45 40 0.00% 46 38 0.00% 47 29 0.00% 48 30 0.00% 49 44 0.00% 50 37 0.00% 51 69 0.00% 52 73 0.00% 53 56 0.00% 54 63 0.00% 55 63 0.00% 56 58 0.00% 57 67 0.00% 58 91 0.00% 59 99 0.00% 60 105 0.00% 61 117 0.00% 62 130 0.00% 63 156 0.00% 64 139 0.00% 65 149 0.00% 66 184 0.00% 67 174 0.00% 68 186 0.00% 69 211 0.00% 70 250 0.00% 71 285 0.00% 72 390 0.00% 73 381 0.00% 74 421 0.00% 75 423 0.00% 76 533 0.00% 77 499 0.00% 78 542 0.00% 79 592 0.00% 80 705 0.00% 81 785 0.00% 82 989 0.00% 83 1031 0.00% 84 1164 0.01% 85 1249 0.01% 86 1344 0.01% 87 1452 0.01% 88 1538 0.01% 89 1680 0.01% 90 1914 0.01% 91 2078 0.01% 92 2378 0.01% 93 2706 0.01% 94 3076 0.01% 95 3100 0.01% 96 3398 0.01% 97 3511 0.02% 98 3645 0.02% 99 3867 0.02% 100 4231 0.02% 101 4694 0.02% 102 5006 0.02% 103 5341 0.02% 104 5971 0.03% 105 6429 0.03% 106 6657 0.03% 107 7003 0.03% 108 7139 0.03% 109 7592 0.03% 110 7599 0.03% 111 8322 0.04% 112 9073 0.04% 113 9603 0.04% 114 10074 0.04% 115 10794 0.05% 116 11279 0.05% 117 11917 0.05% 118 12046 0.05% 119 12059 0.05% 120 12790 0.06% 121 13424 0.06% 122 13714 0.06% 123 15107 0.07% 124 15650 0.07% 125 16525 0.07% 126 17327 0.07% 127 17787 0.08% 128 17983 0.08% 129 18360 0.08% 130 18680 0.08% 131 19492 0.08% 132 19997 0.09% 133 21544 0.09% 134 22297 0.10% 135 23578 0.10% 136 24319 0.10% 137 24999 0.11% 138 25279 0.11% 139 26001 0.11% 140 25938 0.11% 141 26547 0.11% 142 27831 0.12% 143 28699 0.12% 144 30831 0.13% 145 31146 0.13% 146 32733 0.14% 147 33292 0.14% 148 33945 0.15% 149 34389 0.15% 150 34625 0.15% 151 22230398 95.96% 23166697 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=19 prefix-density=0.62 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=35.07 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=2.5 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGAT criterion=sequence-density sequence-density=1.06 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=27 prefix-density=1.06 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=28.73 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.3 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTG SRR12671701 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:56:33 Started mapping on | Feb 12 04:56:33 Finished on | Feb 12 04:58:45 Mapping speed, Million of reads per hour | 631.82 Number of input reads | 23166697 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 21702497 Uniquely mapped reads % | 93.68% Average mapped length | 298.85 Number of splices: Total | 21608334 Number of splices: Annotated (sjdb) | 21196206 Number of splices: GT/AG | 21184858 Number of splices: GC/AG | 355362 Number of splices: AT/AC | 12319 Number of splices: Non-canonical | 55795 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.99 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 556179 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 81215 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.47% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 908021 908021 908021 N_multimapping 556179 556179 556179 N_noFeature 735771 21404687 837297 N_ambiguous 347773 1337 150626 UnstrandedReadsAssigned:20618953 PositiveStrandReadsAssigned:296473 NegativeStrandReadsAssigned:20714574 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671701 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671701-trimmed-pair1.fastq SRR12671701-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,166,697 reads, 20,740,686 reads pseudoaligned [quant] estimated average fragment length: 312.759 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,069 rounds 52401 SRR12671701.ke.tsv 34699 SRR12671701.se.tsv 87100 total ==> SRR12671701.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1706.24 635 18.0431 Potri.005G024800.1.v4.1 1035 723.241 91 6.10008 Potri.004G059700.1.v4.1 961 650.048 7 0.522071 Potri.007G009000.2.v4.1 1416 1104.24 0 0 Potri.003G141000.2.v4.1 2943 2631.24 992.356 18.2845 Potri.016G087400.1.v4.1 270 70.5403 775 532.649 Potri.015G069301.1.v4.1 564 283.731 0 0 Potri.010G195200.1.v4.1 1773 1461.24 20 0.663568 Potri.012G127500.1.v4.1 977 665.723 167 12.1619 ==> SRR12671701.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 582 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 353 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671701 completed mapping pipeline successfully