Starting /dee2/code/volunteer_pipeline.sh SRR12671702 current disk space = 3049186844672 free memory = 1494856120 SRR12671702 SRAfilesize 5663551e8d91df4ff8a5613c055f567b SRR12671702.sra SRR12671702.sra file validated SRR12671702 is paired end SRR12671702 is conventional basespace SRR12671702 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671702_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3495 37.0 37.0 37.0 37.0 37.0 2 36.20875 37.0 37.0 37.0 37.0 37.0 3 36.4335 37.0 37.0 37.0 37.0 37.0 4 36.4885 37.0 37.0 37.0 37.0 37.0 5 36.499 37.0 37.0 37.0 37.0 37.0 6 36.515 37.0 37.0 37.0 37.0 37.0 7 36.405 37.0 37.0 37.0 37.0 37.0 8 36.5265 37.0 37.0 37.0 37.0 37.0 9 36.551 37.0 37.0 37.0 37.0 37.0 10-14 36.5026 37.0 37.0 37.0 37.0 37.0 15-19 36.483999999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.4636 37.0 37.0 37.0 37.0 37.0 25-29 36.4549 37.0 37.0 37.0 37.0 37.0 30-34 36.4416 37.0 37.0 37.0 37.0 37.0 35-39 36.4427 37.0 37.0 37.0 37.0 37.0 40-44 36.4394 37.0 37.0 37.0 37.0 37.0 45-49 36.3534 37.0 37.0 37.0 37.0 37.0 50-54 36.3763 37.0 37.0 37.0 37.0 37.0 55-59 36.343 37.0 37.0 37.0 37.0 37.0 60-64 36.361200000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.3891 37.0 37.0 37.0 37.0 37.0 70-74 36.275400000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.2615 37.0 37.0 37.0 37.0 37.0 80-84 36.2417 37.0 37.0 37.0 37.0 37.0 85-89 36.254200000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.1786 37.0 37.0 37.0 37.0 37.0 95-99 36.1596 37.0 37.0 37.0 37.0 37.0 100-104 36.228899999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.1212 37.0 37.0 37.0 37.0 37.0 110-114 36.119600000000005 37.0 37.0 37.0 37.0 37.0 115-119 36.0766 37.0 37.0 37.0 37.0 37.0 120-124 35.9869 37.0 37.0 37.0 37.0 37.0 125-129 36.067099999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.9219 37.0 37.0 37.0 37.0 37.0 135-139 35.9656 37.0 37.0 37.0 37.0 37.0 140-144 35.84 37.0 37.0 37.0 37.0 37.0 145-149 35.8133 37.0 37.0 37.0 37.0 37.0 150-151 35.384 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 0.0 26 4.0 27 4.0 28 14.0 29 27.0 30 27.0 31 44.0 32 47.0 33 69.0 34 128.0 35 331.0 36 2971.0 37 333.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.249999999999996 15.75 11.55 44.45 2 20.205565304587616 20.807219854600152 40.23564803208824 18.75156680872399 3 16.45 27.450000000000003 27.250000000000004 28.849999999999998 4 21.075 34.975 22.35 21.6 5 21.0 37.824999999999996 23.5 17.675 6 17.299999999999997 36.0 25.974999999999998 20.724999999999998 7 12.7 21.875 45.4 20.025000000000002 8 18.675 22.125 30.049999999999997 29.15 9 17.974999999999998 23.474999999999998 31.65 26.900000000000002 10-14 19.645000000000003 29.13 26.985 24.240000000000002 15-19 19.634999999999998 28.15 28.715000000000003 23.5 20-24 19.48 27.955000000000002 29.075 23.49 25-29 19.855 28.595 27.565 23.985 30-34 19.98 28.76 27.855 23.405 35-39 19.99 28.735 28.155 23.119999999999997 40-44 19.685 28.715000000000003 28.744999999999997 22.855 45-49 19.09 28.194999999999997 28.38 24.335 50-54 20.03 28.52 28.265 23.185 55-59 19.794999999999998 28.794999999999998 27.79 23.62 60-64 19.939999999999998 27.985 28.249999999999996 23.825 65-69 19.650000000000002 28.884999999999998 27.685 23.78 70-74 19.6 28.84 27.685 23.875 75-79 19.470000000000002 28.765 28.360000000000003 23.405 80-84 20.06 28.12 27.605 24.215 85-89 20.095 28.505000000000003 27.735 23.665 90-94 19.63 28.33 27.965 24.075 95-99 20.01 28.565 27.265 24.16 100-104 20.02 28.665000000000003 27.72 23.595 105-109 20.515 27.67 27.975 23.84 110-114 19.814999999999998 28.425 27.644999999999996 24.115000000000002 115-119 20.560000000000002 28.455000000000002 27.47 23.515 120-124 20.11 29.29 27.339999999999996 23.26 125-129 20.635 28.07 27.82 23.474999999999998 130-134 20.885 28.794999999999998 27.315 23.005 135-139 20.599999999999998 27.865000000000002 27.62 23.915 140-144 21.18 28.050000000000004 27.66 23.11 145-149 20.82 28.52 27.060000000000002 23.599999999999998 150-151 21.325 27.35 27.325 24.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 2.0 12 1.5 13 1.0 14 0.5 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 2.5 24 3.0 25 3.0 26 2.5 27 4.0 28 9.0 29 13.5 30 18.5 31 28.5 32 39.5 33 49.5 34 61.5 35 85.5 36 108.0 37 129.5 38 162.0 39 177.5 40 206.5 41 232.0 42 230.5 43 245.0 44 260.5 45 258.5 46 260.5 47 254.5 48 215.0 49 185.5 50 170.5 51 135.0 52 107.5 53 87.5 54 61.0 55 44.5 56 37.5 57 29.0 58 19.5 59 19.0 60 13.0 61 6.0 62 4.0 63 3.0 64 2.0 65 1.0 66 2.5 67 2.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.875 #Duplication Level Percentage of deduplicated Percentage of total 1 91.89115646258503 84.425 2 7.482993197278912 13.750000000000002 3 0.5714285714285714 1.575 4 0.027210884353741496 0.1 5 0.0 0.0 6 0.027210884353741496 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.6625000000000001 0.0 0.0 0.0 0.0 114-115 0.7375 0.0 0.0 0.0 0.0 116-117 0.8625 0.0 0.0 0.0 0.0 118-119 0.925 0.0 0.0 0.0 0.0 120-121 1.0 0.0 0.0 0.0 0.0 122-123 1.1375000000000002 0.0 0.0 0.0 0.0 124-125 1.2374999999999998 0.0 0.0 0.0 0.0 126-127 1.375 0.0 0.0 0.0 0.0 128-129 1.5499999999999998 0.0 0.0 0.0 0.0 130-131 1.825 0.0 0.0 0.0 0.0 132-133 2.0125 0.0 0.0 0.0 0.0 134-135 2.175 0.0 0.0 0.0 0.0 136-137 2.4 0.0 0.0 0.0 0.0 138-139 2.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGCTCA 10 0.006830828 145.0 1 CGCTCAT 10 0.006830828 145.0 2 AAAAAAA 95 5.161005E-4 12.210526 125-129 >>END_MODULE SRR12671702 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671702_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0475 37.0 37.0 37.0 37.0 37.0 2 35.8485 37.0 37.0 37.0 37.0 37.0 3 36.0375 37.0 37.0 37.0 37.0 37.0 4 36.035 37.0 37.0 37.0 37.0 37.0 5 36.1145 37.0 37.0 37.0 37.0 37.0 6 36.075 37.0 37.0 37.0 37.0 37.0 7 36.1435 37.0 37.0 37.0 37.0 37.0 8 36.2835 37.0 37.0 37.0 37.0 37.0 9 36.1365 37.0 37.0 37.0 37.0 37.0 10-14 36.1534 37.0 37.0 37.0 37.0 37.0 15-19 36.112100000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.1081 37.0 37.0 37.0 37.0 37.0 25-29 36.1089 37.0 37.0 37.0 37.0 37.0 30-34 36.0159 37.0 37.0 37.0 37.0 37.0 35-39 36.0135 37.0 37.0 37.0 37.0 37.0 40-44 35.946299999999994 37.0 37.0 37.0 37.0 37.0 45-49 35.942 37.0 37.0 37.0 37.0 37.0 50-54 35.9251 37.0 37.0 37.0 37.0 37.0 55-59 35.8605 37.0 37.0 37.0 37.0 37.0 60-64 35.834 37.0 37.0 37.0 37.0 37.0 65-69 35.7457 37.0 37.0 37.0 37.0 37.0 70-74 35.8101 37.0 37.0 37.0 37.0 37.0 75-79 35.754 37.0 37.0 37.0 37.0 37.0 80-84 35.736 37.0 37.0 37.0 37.0 37.0 85-89 35.7558 37.0 37.0 37.0 37.0 37.0 90-94 35.606500000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.723200000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.7014 37.0 37.0 37.0 37.0 37.0 105-109 35.5872 37.0 37.0 37.0 37.0 37.0 110-114 35.5306 37.0 37.0 37.0 37.0 37.0 115-119 35.4984 37.0 37.0 37.0 37.0 37.0 120-124 35.5031 37.0 37.0 37.0 37.0 37.0 125-129 35.4293 37.0 37.0 37.0 37.0 37.0 130-134 35.42470000000001 37.0 37.0 37.0 34.6 37.0 135-139 35.4048 37.0 37.0 37.0 37.0 37.0 140-144 35.14319999999999 37.0 37.0 37.0 29.8 37.0 145-149 35.2923 37.0 37.0 37.0 32.2 37.0 150-151 34.855000000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 1.0 18 1.0 19 0.0 20 2.0 21 3.0 22 4.0 23 5.0 24 8.0 25 15.0 26 10.0 27 11.0 28 24.0 29 37.0 30 29.0 31 42.0 32 80.0 33 131.0 34 227.0 35 603.0 36 2568.0 37 198.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.55 17.424999999999997 16.225 34.8 2 25.05 23.5 36.8 14.649999999999999 3 18.15 26.924999999999997 33.125 21.8 4 20.125 37.35 22.625 19.900000000000002 5 22.575 37.525 22.575 17.325 6 17.150000000000002 39.825 24.825 18.2 7 17.175 16.925 45.050000000000004 20.849999999999998 8 20.05 23.95 28.15 27.85 9 20.825 24.8 30.425 23.95 10-14 22.355 28.299999999999997 27.595 21.75 15-19 21.895 28.305000000000003 28.060000000000002 21.740000000000002 20-24 21.505 28.21 28.975 21.310000000000002 25-29 22.485 27.455000000000002 28.810000000000002 21.25 30-34 21.97 27.785 29.035 21.21 35-39 22.41 28.04 28.470000000000002 21.08 40-44 21.915000000000003 28.849999999999998 28.365000000000002 20.87 45-49 22.41 29.244999999999997 27.855 20.49 50-54 22.96 28.63 27.915 20.495 55-59 22.465 28.025 28.15 21.36 60-64 22.89 27.565 28.615000000000002 20.93 65-69 22.695 27.615000000000002 27.889999999999997 21.8 70-74 22.575 28.410000000000004 27.565 21.45 75-79 23.125 27.944999999999997 27.51 21.42 80-84 23.94 27.72 27.195000000000004 21.145 85-89 23.24 28.125 27.775 20.86 90-94 23.53 27.900000000000002 27.439999999999998 21.13 95-99 23.215 27.98 28.194999999999997 20.61 100-104 23.555 28.235 26.965 21.245 105-109 23.525 28.310000000000002 27.889999999999997 20.275000000000002 110-114 23.52 27.865000000000002 28.285 20.330000000000002 115-119 23.494999999999997 27.85 28.000000000000004 20.655 120-124 23.98 27.450000000000003 27.88 20.69 125-129 23.31 27.500000000000004 28.24 20.95 130-134 24.27 27.93 27.165 20.635 135-139 24.415 27.405 27.66 20.52 140-144 24.035 28.205000000000002 27.66 20.1 145-149 25.05 27.555000000000003 27.435 19.96 150-151 24.1375 28.199999999999996 27.474999999999998 20.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.5 20 1.5 21 1.5 22 1.5 23 1.5 24 5.0 25 9.5 26 9.5 27 8.0 28 9.0 29 16.0 30 20.5 31 23.0 32 32.5 33 46.0 34 56.0 35 70.5 36 95.0 37 119.0 38 149.0 39 166.5 40 198.0 41 224.5 42 261.0 43 276.0 44 266.0 45 262.5 46 241.0 47 247.5 48 236.0 49 187.0 50 142.5 51 116.5 52 100.5 53 88.5 54 71.0 55 57.5 56 50.5 57 33.5 58 22.0 59 22.5 60 14.0 61 7.0 62 9.0 63 8.5 64 5.0 65 2.5 66 0.5 67 0.0 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.1274856987197 84.55 2 7.164260419504222 13.15 3 0.5175701443748297 1.425 4 0.08172160174339417 0.3 5 0.08172160174339417 0.375 6 0.0 0.0 7 0.0 0.0 8 0.027240533914464723 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 8 0.2 No Hit CATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCAT 5 0.125 No Hit CATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.48750000000000004 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.65 0.0 0.0 0.0 0.0 112-113 0.7124999999999999 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 0.9375 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.0750000000000002 0.0 0.0 0.0 0.0 122-123 1.2125 0.0 0.0 0.0 0.0 124-125 1.3125 0.0 0.0 0.0 0.0 126-127 1.4500000000000002 0.0 0.0 0.0 0.0 128-129 1.6 0.0 0.0 0.0 0.0 130-131 1.85 0.0 0.0 0.0 0.0 132-133 2.075 0.0 0.0 0.0 0.0 134-135 2.25 0.0 0.0 0.0 0.0 136-137 2.4625 0.0 0.0 0.0 0.0 138-139 2.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 40 0.0076550315 18.125 90-94 >>END_MODULE Read 1023495 spots for SRR12671702.sra Written 1023495 spots for SRR12671702.sra Read 1023491 spots for SRR12671702.sra Written 1023491 spots for SRR12671702.sra Read 1023491 spots for SRR12671702.sra Written 1023491 spots for SRR12671702.sra Read 1023491 spots for SRR12671702.sra Written 1023491 spots for SRR12671702.sra Read 1023491 spots for SRR12671702.sra Written 1023491 spots for SRR12671702.sra Read 1023491 spots for SRR12671702.sra Written 1023491 spots for SRR12671702.sra Read 1023491 spots for SRR12671702.sra Written 1023491 spots for SRR12671702.sra Read 1023491 spots for SRR12671702.sra Written 1023491 spots for SRR12671702.sra Read 1023491 spots for SRR12671702.sra Written 1023491 spots for SRR12671702.sra Read 1023491 spots for SRR12671702.sra Written 1023491 spots for SRR12671702.sra Read 1023491 spots for SRR12671702.sra Written 1023491 spots for SRR12671702.sra Read 1023491 spots for SRR12671702.sra Written 1023491 spots for SRR12671702.sra Read 1023491 spots for SRR12671702.sra Written 1023491 spots for SRR12671702.sra Read 1023491 spots for SRR12671702.sra Written 1023491 spots for SRR12671702.sra Read 1023491 spots for SRR12671702.sra Written 1023491 spots for SRR12671702.sra Read 1023491 spots for SRR12671702.sra Written 1023491 spots for SRR12671702.sra Read 1023491 spots for SRR12671702.sra Written 1023491 spots for SRR12671702.sra Read 1023491 spots for SRR12671702.sra Written 1023491 spots for SRR12671702.sra Read 1023491 spots for SRR12671702.sra Written 1023491 spots for SRR12671702.sra Read 1023491 spots for SRR12671702.sra Written 1023491 spots for SRR12671702.sra SRR ids: ['SRR12671702.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gkh_gy49 SRR12671702.sra spots: 20469824 blocks: [[1, 1023491], [1023492, 2046982], [2046983, 3070473], [3070474, 4093964], [4093965, 5117455], [5117456, 6140946], [6140947, 7164437], [7164438, 8187928], [8187929, 9211419], [9211420, 10234910], [10234911, 11258401], [11258402, 12281892], [12281893, 13305383], [13305384, 14328874], [14328875, 15352365], [15352366, 16375856], [16375857, 17399347], [17399348, 18422838], [18422839, 19446329], [19446330, 20469824]] SRR12671702 file size 6934841 SRR12671702 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671702 SRR12671702_1.fastq SRR12671702_2.fastq Input file: SRR12671702_1.fastq Paired file: SRR12671702_2.fastq trimmed: SRR12671702-trimmed-pair1.fastq, SRR12671702-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:33:38 2025 >> started Wed Feb 12 04:34:07 2025 >> done (28.135s) 20469824 read pairs processed; of these: 7 ( 0.00%) short read pairs filtered out after trimming by size control 1164 ( 0.01%) empty read pairs filtered out after trimming by size control 20468653 (99.99%) read pairs available; of these: 983143 ( 4.80%) trimmed read pairs available after processing 19485510 (95.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 3 0.00% 21 2 0.00% 22 2 0.00% 23 4 0.00% 24 6 0.00% 25 2 0.00% 26 4 0.00% 27 4 0.00% 28 6 0.00% 29 5 0.00% 30 6 0.00% 31 1 0.00% 32 7 0.00% 33 7 0.00% 34 15 0.00% 35 7 0.00% 36 17 0.00% 37 25 0.00% 38 13 0.00% 39 15 0.00% 40 14 0.00% 41 19 0.00% 42 20 0.00% 43 30 0.00% 44 32 0.00% 45 34 0.00% 46 30 0.00% 47 39 0.00% 48 26 0.00% 49 39 0.00% 50 49 0.00% 51 50 0.00% 52 64 0.00% 53 72 0.00% 54 58 0.00% 55 81 0.00% 56 57 0.00% 57 77 0.00% 58 110 0.00% 59 95 0.00% 60 96 0.00% 61 130 0.00% 62 128 0.00% 63 181 0.00% 64 173 0.00% 65 184 0.00% 66 167 0.00% 67 254 0.00% 68 244 0.00% 69 230 0.00% 70 297 0.00% 71 325 0.00% 72 381 0.00% 73 395 0.00% 74 476 0.00% 75 576 0.00% 76 575 0.00% 77 661 0.00% 78 704 0.00% 79 776 0.00% 80 804 0.00% 81 953 0.00% 82 1123 0.01% 83 1194 0.01% 84 1364 0.01% 85 1413 0.01% 86 1515 0.01% 87 1688 0.01% 88 1910 0.01% 89 1986 0.01% 90 2252 0.01% 91 2438 0.01% 92 2817 0.01% 93 2942 0.01% 94 3254 0.02% 95 3599 0.02% 96 3841 0.02% 97 4065 0.02% 98 4297 0.02% 99 4638 0.02% 100 4902 0.02% 101 5264 0.03% 102 5846 0.03% 103 6175 0.03% 104 6529 0.03% 105 6843 0.03% 106 7303 0.04% 107 7780 0.04% 108 8011 0.04% 109 8377 0.04% 110 8766 0.04% 111 9425 0.05% 112 9895 0.05% 113 10392 0.05% 114 10820 0.05% 115 11433 0.06% 116 12177 0.06% 117 12291 0.06% 118 13143 0.06% 119 13585 0.07% 120 13856 0.07% 121 14738 0.07% 122 15003 0.07% 123 15948 0.08% 124 16809 0.08% 125 17328 0.08% 126 17756 0.09% 127 18366 0.09% 128 19092 0.09% 129 19334 0.09% 130 19940 0.10% 131 20438 0.10% 132 21546 0.11% 133 22685 0.11% 134 23251 0.11% 135 23832 0.12% 136 24839 0.12% 137 25320 0.12% 138 26201 0.13% 139 26780 0.13% 140 27242 0.13% 141 27999 0.14% 142 28982 0.14% 143 29023 0.14% 144 31627 0.15% 145 31549 0.15% 146 32710 0.16% 147 32983 0.16% 148 34246 0.17% 149 33882 0.17% 150 34685 0.17% 151 19485510 95.20% 20468653 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=23 prefix-density=0.43 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=26 fanout-score=34.84 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=11.2 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTCAGCGAATGCTTCGGGATCGTCAGCCAAGCCCAGTGGGTCGAAGCTTCCACCTGGGTAGATTGGGTCAGTTACCTCACCGAGTGGCCCGCCAGCAATTCTGTAACCCTCAACGGCACCCATCAAGACCACCTGTGTAGCCCAGATGGCCAAGATGCTTTGTGCGTGGATCAAGCTTGGGTTGCCCAAGTAGTCAAGTCCACCCTCGCTGAAGATCTGGGCTCCAGCCTTGAACCATACAGCCTCGCCGAACTTGACACCGTTGCGGGACAAGAGCTCGGGGAAGACGCATCCAAGAGC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=30 prefix-density=1.30 prefix-fanout=1.0 sequence=ATCGTCGAGACCGAGAAGAACTA criterion=fanout-score sequence-density=0.10 sequence-density-rank=29 fanout-score=33.56 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=11.2 sequence=AAGAAAGCTTACCCTAAC SRR12671702 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:34:51 Started mapping on | Feb 12 04:34:52 Finished on | Feb 12 04:37:32 Mapping speed, Million of reads per hour | 460.54 Number of input reads | 20468653 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 19099121 Uniquely mapped reads % | 93.31% Average mapped length | 298.44 Number of splices: Total | 19344460 Number of splices: Annotated (sjdb) | 18855583 Number of splices: GT/AG | 18977796 Number of splices: GC/AG | 277149 Number of splices: AT/AC | 13339 Number of splices: Non-canonical | 76176 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 583739 % of reads mapped to multiple loci | 2.85% Number of reads mapped to too many loci | 58080 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.43% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 785793 785793 785793 N_multimapping 583739 583739 583739 N_noFeature 748603 18741132 846066 N_ambiguous 429954 1464 168645 UnstrandedReadsAssigned:17920564 PositiveStrandReadsAssigned:356525 NegativeStrandReadsAssigned:18084410 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671702 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671702-trimmed-pair1.fastq SRR12671702-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,468,653 reads, 17,887,651 reads pseudoaligned [quant] estimated average fragment length: 306.867 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,242 rounds 52401 SRR12671702.ke.tsv 34699 SRR12671702.se.tsv 87100 total ==> SRR12671702.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1712.13 1593 44.0972 Potri.005G024800.1.v4.1 1035 729.133 514 33.411 Potri.004G059700.1.v4.1 961 655.752 1 0.0722759 Potri.007G009000.2.v4.1 1416 1110.13 0 0 Potri.003G141000.2.v4.1 2943 2637.13 1243.46 22.3476 Potri.016G087400.1.v4.1 270 72.8518 1541 1002.53 Potri.015G069301.1.v4.1 564 288.335 0 0 Potri.010G195200.1.v4.1 1773 1467.13 1254.91 40.5393 Potri.012G127500.1.v4.1 977 671.45 361 25.4816 ==> SRR12671702.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 148 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 226 Potri.001G212900.v4.1 21 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 18 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 20 SRR12671702 completed mapping pipeline successfully