Starting /dee2/code/volunteer_pipeline.sh SRR12671703 current disk space = 3049060241408 free memory = 1577768404 SRR12671703 SRAfilesize 539741342c94d22389f465e9d06aba4f SRR12671703.sra SRR12671703.sra file validated SRR12671703 is paired end SRR12671703 is conventional basespace SRR12671703 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671703_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4185 37.0 37.0 37.0 37.0 37.0 2 36.20775 37.0 37.0 37.0 37.0 37.0 3 36.6075 37.0 37.0 37.0 37.0 37.0 4 36.556 37.0 37.0 37.0 37.0 37.0 5 36.5695 37.0 37.0 37.0 37.0 37.0 6 36.5625 37.0 37.0 37.0 37.0 37.0 7 36.583 37.0 37.0 37.0 37.0 37.0 8 36.5995 37.0 37.0 37.0 37.0 37.0 9 36.5485 37.0 37.0 37.0 37.0 37.0 10-14 36.569 37.0 37.0 37.0 37.0 37.0 15-19 36.5613 37.0 37.0 37.0 37.0 37.0 20-24 36.5026 37.0 37.0 37.0 37.0 37.0 25-29 36.487899999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.526199999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.4654 37.0 37.0 37.0 37.0 37.0 40-44 36.4357 37.0 37.0 37.0 37.0 37.0 45-49 36.4173 37.0 37.0 37.0 37.0 37.0 50-54 36.370400000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.3661 37.0 37.0 37.0 37.0 37.0 60-64 36.389300000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.345400000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.29559999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.3215 37.0 37.0 37.0 37.0 37.0 80-84 36.3261 37.0 37.0 37.0 37.0 37.0 85-89 36.3335 37.0 37.0 37.0 37.0 37.0 90-94 36.2663 37.0 37.0 37.0 37.0 37.0 95-99 36.212 37.0 37.0 37.0 37.0 37.0 100-104 36.2443 37.0 37.0 37.0 37.0 37.0 105-109 36.1246 37.0 37.0 37.0 37.0 37.0 110-114 36.2049 37.0 37.0 37.0 37.0 37.0 115-119 36.1794 37.0 37.0 37.0 37.0 37.0 120-124 36.1386 37.0 37.0 37.0 37.0 37.0 125-129 36.0553 37.0 37.0 37.0 37.0 37.0 130-134 36.012299999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.9882 37.0 37.0 37.0 37.0 37.0 140-144 35.9754 37.0 37.0 37.0 37.0 37.0 145-149 35.8692 37.0 37.0 37.0 37.0 37.0 150-151 35.429500000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 5.0 26 4.0 27 8.0 28 7.0 29 11.0 30 31.0 31 29.0 32 55.0 33 67.0 34 109.0 35 310.0 36 2985.0 37 378.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.225 16.825000000000003 11.125 42.825 2 18.698165368182963 20.784116612214124 40.437295802965565 20.080422216637345 3 15.85 27.825 29.049999999999997 27.275 4 20.275000000000002 33.75 23.325000000000003 22.650000000000002 5 20.349999999999998 36.449999999999996 24.025 19.175 6 19.3 34.55 24.95 21.2 7 13.375 21.525 44.675 20.424999999999997 8 17.925 21.5 30.95 29.625 9 17.299999999999997 22.15 32.824999999999996 27.725 10-14 19.3 29.2 27.084999999999997 24.415 15-19 19.145 28.035 28.310000000000002 24.51 20-24 19.64 28.105000000000004 27.99 24.265 25-29 19.64 28.62 27.639999999999997 24.099999999999998 30-34 19.455 28.044999999999998 28.005000000000003 24.495 35-39 19.965 29.110000000000003 27.115000000000002 23.810000000000002 40-44 20.66 28.34 27.700000000000003 23.3 45-49 20.39 27.985 27.48 24.145 50-54 20.09 28.299999999999997 27.74 23.87 55-59 20.244999999999997 28.62 26.924999999999997 24.21 60-64 20.185 28.65 27.735 23.43 65-69 20.34 28.405 27.529999999999998 23.724999999999998 70-74 19.96 28.895 28.1 23.044999999999998 75-79 19.900000000000002 28.275 28.315 23.51 80-84 20.74 28.389999999999997 27.32 23.549999999999997 85-89 19.915 28.395 27.74 23.95 90-94 20.075000000000003 28.294999999999998 27.505000000000003 24.125 95-99 20.34 28.27 27.700000000000003 23.69 100-104 20.8 28.395 26.99 23.815 105-109 20.57 28.705000000000002 27.16 23.565 110-114 20.505000000000003 27.625 28.125 23.745 115-119 20.45 28.26 27.089999999999996 24.2 120-124 20.73 27.92 27.169999999999998 24.18 125-129 20.805 27.750000000000004 27.125 24.32 130-134 20.835 28.125 27.200000000000003 23.84 135-139 21.11 27.435 27.575 23.880000000000003 140-144 21.055 27.715 27.139999999999997 24.09 145-149 20.555 28.22 27.125 24.099999999999998 150-151 20.837500000000002 28.012500000000003 26.687499999999996 24.462500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.0 20 1.0 21 1.5 22 3.0 23 5.0 24 4.0 25 2.5 26 2.0 27 2.0 28 10.0 29 18.5 30 23.0 31 26.5 32 32.0 33 43.0 34 60.0 35 76.0 36 91.0 37 120.5 38 141.5 39 140.5 40 173.5 41 210.0 42 228.5 43 253.5 44 265.0 45 279.5 46 274.0 47 253.0 48 249.5 49 221.5 50 172.5 51 146.0 52 116.0 53 91.0 54 73.0 55 47.5 56 32.5 57 29.0 58 25.0 59 14.5 60 11.0 61 9.0 62 4.0 63 4.5 64 3.5 65 0.5 66 0.5 67 1.5 68 1.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.525 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.5 #Duplication Level Percentage of deduplicated Percentage of total 1 93.74331550802138 87.64999999999999 2 5.668449197860963 10.6 3 0.4812834224598931 1.35 4 0.10695187165775401 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.44999999999999996 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.6625000000000001 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.2 0.0 0.0 0.0 0.0 116-117 1.3250000000000002 0.0 0.0 0.0 0.0 118-119 1.4874999999999998 0.0 0.0 0.0 0.0 120-121 1.6 0.0 0.0 0.0 0.0 122-123 1.7125 0.0 0.0 0.0 0.0 124-125 1.925 0.0 0.0 0.0 0.0 126-127 2.0625 0.0 0.0 0.0 0.0 128-129 2.2875 0.0 0.0 0.0 0.0 130-131 2.4749999999999996 0.0 0.0 0.0 0.0 132-133 2.675 0.0 0.0 0.0 0.0 134-135 2.9875 0.0 0.0 0.0 0.0 136-137 3.3499999999999996 0.0 0.0 0.0 0.0 138-139 3.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671703 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671703_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.222 37.0 37.0 37.0 37.0 37.0 2 35.988 37.0 37.0 37.0 37.0 37.0 3 36.07 37.0 37.0 37.0 37.0 37.0 4 36.093 37.0 37.0 37.0 37.0 37.0 5 36.352 37.0 37.0 37.0 37.0 37.0 6 36.274 37.0 37.0 37.0 37.0 37.0 7 36.3365 37.0 37.0 37.0 37.0 37.0 8 36.3505 37.0 37.0 37.0 37.0 37.0 9 36.305 37.0 37.0 37.0 37.0 37.0 10-14 36.3159 37.0 37.0 37.0 37.0 37.0 15-19 36.289300000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.229 37.0 37.0 37.0 37.0 37.0 25-29 36.2308 37.0 37.0 37.0 37.0 37.0 30-34 36.173300000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.0724 37.0 37.0 37.0 37.0 37.0 40-44 36.148700000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.107200000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.13539999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.0889 37.0 37.0 37.0 37.0 37.0 60-64 35.9722 37.0 37.0 37.0 37.0 37.0 65-69 35.9309 37.0 37.0 37.0 37.0 37.0 70-74 36.028800000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.9126 37.0 37.0 37.0 37.0 37.0 80-84 35.96730000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.918 37.0 37.0 37.0 37.0 37.0 90-94 35.8182 37.0 37.0 37.0 37.0 37.0 95-99 35.8606 37.0 37.0 37.0 37.0 37.0 100-104 35.8048 37.0 37.0 37.0 37.0 37.0 105-109 35.7301 37.0 37.0 37.0 37.0 37.0 110-114 35.6688 37.0 37.0 37.0 37.0 37.0 115-119 35.7118 37.0 37.0 37.0 37.0 37.0 120-124 35.7168 37.0 37.0 37.0 37.0 37.0 125-129 35.5478 37.0 37.0 37.0 37.0 37.0 130-134 35.595600000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.534200000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.2907 37.0 37.0 37.0 34.6 37.0 145-149 35.4163 37.0 37.0 37.0 32.2 37.0 150-151 34.9455 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 1.0 16 1.0 17 0.0 18 2.0 19 2.0 20 0.0 21 2.0 22 5.0 23 2.0 24 2.0 25 3.0 26 7.0 27 11.0 28 14.0 29 17.0 30 26.0 31 45.0 32 62.0 33 110.0 34 218.0 35 596.0 36 2677.0 37 195.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.550000000000004 20.025000000000002 14.75 32.675 2 23.95 24.45 36.3 15.299999999999999 3 18.45 28.375 32.05 21.125 4 21.525 35.8 22.75 19.925 5 23.150000000000002 37.475 22.075 17.299999999999997 6 18.35 37.7 22.925 21.025 7 17.349999999999998 18.925 42.125 21.6 8 20.974999999999998 23.799999999999997 28.15 27.075 9 21.3 24.224999999999998 28.875 25.6 10-14 22.49 28.265 26.71 22.535 15-19 22.39 28.084999999999997 28.165000000000003 21.36 20-24 21.990000000000002 28.28 27.97 21.759999999999998 25-29 22.695 27.675 28.060000000000002 21.57 30-34 21.695 27.98 28.21 22.115000000000002 35-39 23.205000000000002 28.110000000000003 27.785 20.9 40-44 22.155 27.715 28.52 21.61 45-49 22.720000000000002 27.345000000000002 28.660000000000004 21.275 50-54 22.48 27.794999999999998 27.72 22.005 55-59 22.400000000000002 27.634999999999998 28.27 21.695 60-64 22.720000000000002 27.55 27.63 22.1 65-69 23.294999999999998 27.775 27.055 21.875 70-74 22.365 28.645 27.275 21.715 75-79 22.66 27.99 27.975 21.375 80-84 23.36 28.13 27.16 21.349999999999998 85-89 23.77 27.639999999999997 27.495000000000005 21.095 90-94 22.545 28.060000000000002 27.894999999999996 21.5 95-99 23.285 27.49 27.560000000000002 21.665 100-104 23.22 27.275 27.93 21.575 105-109 23.26 27.52 27.965 21.255 110-114 23.369999999999997 27.800000000000004 27.47 21.36 115-119 23.380000000000003 27.445000000000004 28.025 21.15 120-124 23.49 28.03 27.77 20.71 125-129 24.025 27.555000000000003 27.384999999999998 21.035 130-134 24.015 27.689999999999998 27.800000000000004 20.495 135-139 23.895 27.51 27.91 20.685000000000002 140-144 24.099999999999998 27.755000000000003 27.474999999999998 20.669999999999998 145-149 25.2 27.439999999999998 27.02 20.34 150-151 25.5 26.5875 27.0875 20.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.5 19 1.0 20 1.0 21 2.0 22 2.5 23 1.5 24 1.5 25 2.5 26 4.0 27 8.0 28 11.5 29 11.0 30 11.5 31 17.0 32 22.5 33 36.5 34 48.0 35 61.5 36 86.5 37 93.5 38 120.0 39 165.0 40 191.0 41 228.0 42 246.0 43 251.5 44 275.5 45 287.0 46 277.5 47 260.5 48 238.0 49 193.5 50 160.5 51 145.0 52 130.5 53 100.0 54 68.5 55 55.0 56 46.0 57 34.5 58 29.0 59 23.5 60 14.0 61 12.0 62 7.0 63 5.0 64 3.0 65 1.0 66 0.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.30000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.67631296891747 87.4 2 5.760986066452305 10.75 3 0.40192926045016075 1.125 4 0.08038585209003216 0.3 5 0.02679528403001072 0.125 6 0.05359056806002144 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGGGAGCACTGCATAGCTTACAAGCTTGTAAGAGATGGCTTCCTCCTCTA 6 0.15 No Hit CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 6 0.15 No Hit GCTCTTTTGAGCTCTCCAAGATTTGCTTTCCTTTGAACAACACTCACCAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.44999999999999996 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.6625000000000001 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.2 0.0 0.0 0.0 0.0 116-117 1.3250000000000002 0.0 0.0 0.0 0.0 118-119 1.5 0.0 0.0 0.0 0.0 120-121 1.6 0.0 0.0 0.0 0.0 122-123 1.75 0.0 0.0 0.0 0.0 124-125 1.975 0.0 0.0 0.0 0.0 126-127 2.1125 0.0 0.0 0.0 0.0 128-129 2.3499999999999996 0.0 0.0 0.0 0.0 130-131 2.5625 0.0 0.0 0.0 0.0 132-133 2.7750000000000004 0.0 0.0 0.0 0.0 134-135 3.1125 0.0 0.0 0.0 0.0 136-137 3.4749999999999996 0.0 0.0 0.0 0.0 138-139 3.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCGTCGT 10 0.006830828 145.0 145 >>END_MODULE Read 1092914 spots for SRR12671703.sra Written 1092914 spots for SRR12671703.sra Read 1092914 spots for SRR12671703.sra Written 1092914 spots for SRR12671703.sra Read 1092914 spots for SRR12671703.sra Written 1092914 spots for SRR12671703.sra Read 1092914 spots for SRR12671703.sra Written 1092914 spots for SRR12671703.sra Read 1092914 spots for SRR12671703.sra Written 1092914 spots for SRR12671703.sra Read 1092914 spots for SRR12671703.sra Written 1092914 spots for SRR12671703.sra Read 1092914 spots for SRR12671703.sra Written 1092914 spots for SRR12671703.sra Read 1092914 spots for SRR12671703.sra Written 1092914 spots for SRR12671703.sra Read 1092914 spots for SRR12671703.sra Written 1092914 spots for SRR12671703.sra Read 1092914 spots for SRR12671703.sra Written 1092914 spots for SRR12671703.sra Read 1092914 spots for SRR12671703.sra Written 1092914 spots for SRR12671703.sra Read 1092914 spots for SRR12671703.sra Written 1092914 spots for SRR12671703.sra Read 1092917 spots for SRR12671703.sra Written 1092917 spots for SRR12671703.sra Read 1092914 spots for SRR12671703.sra Written 1092914 spots for SRR12671703.sra Read 1092914 spots for SRR12671703.sra Written 1092914 spots for SRR12671703.sra Read 1092914 spots for SRR12671703.sra Written 1092914 spots for SRR12671703.sra Read 1092914 spots for SRR12671703.sra Written 1092914 spots for SRR12671703.sra Read 1092914 spots for SRR12671703.sra Written 1092914 spots for SRR12671703.sra Read 1092914 spots for SRR12671703.sra Written 1092914 spots for SRR12671703.sra Read 1092914 spots for SRR12671703.sra Written 1092914 spots for SRR12671703.sra SRR ids: ['SRR12671703.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t9y0zsjr SRR12671703.sra spots: 21858283 blocks: [[1, 1092914], [1092915, 2185828], [2185829, 3278742], [3278743, 4371656], [4371657, 5464570], [5464571, 6557484], [6557485, 7650398], [7650399, 8743312], [8743313, 9836226], [9836227, 10929140], [10929141, 12022054], [12022055, 13114968], [13114969, 14207882], [14207883, 15300796], [15300797, 16393710], [16393711, 17486624], [17486625, 18579538], [18579539, 19672452], [19672453, 20765366], [20765367, 21858283]] SRR12671703 file size 7406700 SRR12671703 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671703 SRR12671703_1.fastq SRR12671703_2.fastq Input file: SRR12671703_1.fastq Paired file: SRR12671703_2.fastq trimmed: SRR12671703-trimmed-pair1.fastq, SRR12671703-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:06:38 2025 >> started Wed Feb 12 05:07:01 2025 >> done (22.733s) 21858283 read pairs processed; of these: 16 ( 0.00%) short read pairs filtered out after trimming by size control 829 ( 0.00%) empty read pairs filtered out after trimming by size control 21857438 (100.00%) read pairs available; of these: 1287426 ( 5.89%) trimmed read pairs available after processing 20570012 (94.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 1 0.00% 21 4 0.00% 22 2 0.00% 23 2 0.00% 24 4 0.00% 25 0 0.00% 26 6 0.00% 27 9 0.00% 28 7 0.00% 29 6 0.00% 30 4 0.00% 31 6 0.00% 32 10 0.00% 33 5 0.00% 34 13 0.00% 35 15 0.00% 36 7 0.00% 37 18 0.00% 38 13 0.00% 39 13 0.00% 40 14 0.00% 41 17 0.00% 42 23 0.00% 43 27 0.00% 44 26 0.00% 45 21 0.00% 46 26 0.00% 47 32 0.00% 48 26 0.00% 49 35 0.00% 50 44 0.00% 51 40 0.00% 52 55 0.00% 53 51 0.00% 54 62 0.00% 55 59 0.00% 56 65 0.00% 57 67 0.00% 58 104 0.00% 59 87 0.00% 60 118 0.00% 61 141 0.00% 62 141 0.00% 63 159 0.00% 64 183 0.00% 65 202 0.00% 66 176 0.00% 67 232 0.00% 68 229 0.00% 69 276 0.00% 70 317 0.00% 71 436 0.00% 72 478 0.00% 73 487 0.00% 74 543 0.00% 75 586 0.00% 76 620 0.00% 77 630 0.00% 78 826 0.00% 79 844 0.00% 80 919 0.00% 81 1143 0.01% 82 1315 0.01% 83 1517 0.01% 84 1757 0.01% 85 1875 0.01% 86 2128 0.01% 87 2153 0.01% 88 2292 0.01% 89 2521 0.01% 90 2660 0.01% 91 3206 0.01% 92 3590 0.02% 93 3999 0.02% 94 4502 0.02% 95 4665 0.02% 96 5052 0.02% 97 5271 0.02% 98 5531 0.03% 99 5867 0.03% 100 6485 0.03% 101 6766 0.03% 102 7626 0.03% 103 8128 0.04% 104 8986 0.04% 105 9503 0.04% 106 9884 0.05% 107 10177 0.05% 108 10715 0.05% 109 10857 0.05% 110 11570 0.05% 111 12301 0.06% 112 13141 0.06% 113 13974 0.06% 114 14904 0.07% 115 16106 0.07% 116 16391 0.07% 117 16816 0.08% 118 17221 0.08% 119 17596 0.08% 120 18369 0.08% 121 18957 0.09% 122 20046 0.09% 123 21522 0.10% 124 22673 0.10% 125 23441 0.11% 126 24487 0.11% 127 24648 0.11% 128 25077 0.11% 129 25672 0.12% 130 26344 0.12% 131 26615 0.12% 132 28301 0.13% 133 29597 0.14% 134 30600 0.14% 135 31837 0.15% 136 33243 0.15% 137 33630 0.15% 138 34201 0.16% 139 34617 0.16% 140 34912 0.16% 141 35321 0.16% 142 37292 0.17% 143 37873 0.17% 144 40010 0.18% 145 41932 0.19% 146 42908 0.20% 147 42644 0.20% 148 43495 0.20% 149 43828 0.20% 150 43568 0.20% 151 20570012 94.11% 21857438 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=20 prefix-density=0.61 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=27.12 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=2.3 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTGTT criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=26 prefix-density=0.80 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=41.60 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.4 sequence=AACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATTTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGTATGCTTTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR12671703 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:07:44 Started mapping on | Feb 12 05:07:44 Finished on | Feb 12 05:10:06 Mapping speed, Million of reads per hour | 554.13 Number of input reads | 21857438 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20484580 Uniquely mapped reads % | 93.72% Average mapped length | 298.17 Number of splices: Total | 21178707 Number of splices: Annotated (sjdb) | 20762298 Number of splices: GT/AG | 20746049 Number of splices: GC/AG | 365268 Number of splices: AT/AC | 11394 Number of splices: Non-canonical | 55996 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 492128 % of reads mapped to multiple loci | 2.25% Number of reads mapped to too many loci | 48828 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.72% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 880730 880730 880730 N_multimapping 492128 492128 492128 N_noFeature 688819 20196629 791887 N_ambiguous 331025 1215 145449 UnstrandedReadsAssigned:19464736 PositiveStrandReadsAssigned:286736 NegativeStrandReadsAssigned:19547244 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671703 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671703-trimmed-pair1.fastq SRR12671703-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,857,438 reads, 19,528,149 reads pseudoaligned [quant] estimated average fragment length: 292.936 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52401 SRR12671703.ke.tsv 34699 SRR12671703.se.tsv 87100 total ==> SRR12671703.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1726.06 924 27.114 Potri.005G024800.1.v4.1 1035 743.064 252 17.1772 Potri.004G059700.1.v4.1 961 669.458 22 1.66448 Potri.007G009000.2.v4.1 1416 1124.06 0 0 Potri.003G141000.2.v4.1 2943 2651.06 1068.87 20.4213 Potri.016G087400.1.v4.1 270 75.7719 546 364.975 Potri.015G069301.1.v4.1 564 296.153 0 0 Potri.010G195200.1.v4.1 1773 1481.06 157 5.36913 Potri.012G127500.1.v4.1 977 685.336 110 8.12957 ==> SRR12671703.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 335 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 266 Potri.001G212900.v4.1 12 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 33 Potri.001G416900.v4.1 8 Potri.001G452600.v4.1 5 SRR12671703 completed mapping pipeline successfully