Starting /dee2/code/volunteer_pipeline.sh SRR12671704 current disk space = 3049117573120 free memory = 1438763900 SRR12671704 SRAfilesize b8c51d81622bd9f182bcfc219486f8dd SRR12671704.sra SRR12671704.sra file validated SRR12671704 is paired end SRR12671704 is conventional basespace SRR12671704 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671704_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.54 37.0 37.0 37.0 37.0 37.0 2 36.28475 37.0 37.0 37.0 37.0 37.0 3 36.5965 37.0 37.0 37.0 37.0 37.0 4 36.525 37.0 37.0 37.0 37.0 37.0 5 36.5955 37.0 37.0 37.0 37.0 37.0 6 36.536 37.0 37.0 37.0 37.0 37.0 7 36.5135 37.0 37.0 37.0 37.0 37.0 8 36.573 37.0 37.0 37.0 37.0 37.0 9 36.638 37.0 37.0 37.0 37.0 37.0 10-14 36.5899 37.0 37.0 37.0 37.0 37.0 15-19 36.56519999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.5329 37.0 37.0 37.0 37.0 37.0 25-29 36.506899999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.4696 37.0 37.0 37.0 37.0 37.0 35-39 36.4552 37.0 37.0 37.0 37.0 37.0 40-44 36.4443 37.0 37.0 37.0 37.0 37.0 45-49 36.4282 37.0 37.0 37.0 37.0 37.0 50-54 36.4193 37.0 37.0 37.0 37.0 37.0 55-59 36.4106 37.0 37.0 37.0 37.0 37.0 60-64 36.389599999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.3937 37.0 37.0 37.0 37.0 37.0 70-74 36.3707 37.0 37.0 37.0 37.0 37.0 75-79 36.330499999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.3488 37.0 37.0 37.0 37.0 37.0 85-89 36.30200000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.2115 37.0 37.0 37.0 37.0 37.0 95-99 36.18150000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.2078 37.0 37.0 37.0 37.0 37.0 105-109 36.188 37.0 37.0 37.0 37.0 37.0 110-114 36.156600000000005 37.0 37.0 37.0 37.0 37.0 115-119 36.1785 37.0 37.0 37.0 37.0 37.0 120-124 36.0843 37.0 37.0 37.0 37.0 37.0 125-129 36.0615 37.0 37.0 37.0 37.0 37.0 130-134 35.984300000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.9611 37.0 37.0 37.0 37.0 37.0 140-144 35.9084 37.0 37.0 37.0 37.0 37.0 145-149 35.906499999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.40525 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 4.0 26 1.0 27 3.0 28 5.0 29 24.0 30 21.0 31 27.0 32 52.0 33 75.0 34 123.0 35 320.0 36 2946.0 37 399.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.75 15.25 11.825 43.175000000000004 2 20.080220606668338 21.082978190022562 39.60892454249185 19.227876660817248 3 18.125 26.85 26.35 28.675 4 21.6 35.325 21.55 21.525 5 22.1 37.45 22.6 17.849999999999998 6 17.349999999999998 36.475 26.450000000000003 19.725 7 12.950000000000001 22.35 43.95 20.75 8 18.475 22.275 30.25 28.999999999999996 9 17.575 22.6 33.125 26.700000000000003 10-14 18.73 29.98 26.584999999999997 24.705 15-19 19.575 28.215 28.125 24.085 20-24 19.61 28.694999999999997 28.599999999999998 23.095 25-29 19.7 28.27 27.365000000000002 24.665 30-34 19.305 29.205 27.27 24.22 35-39 19.869999999999997 28.18 28.310000000000002 23.64 40-44 19.575 28.985 27.800000000000004 23.64 45-49 19.68 28.435 28.115000000000002 23.77 50-54 20.150000000000002 28.63 27.52 23.7 55-59 19.975 28.884999999999998 27.26 23.880000000000003 60-64 19.905 27.905 28.005000000000003 24.185000000000002 65-69 20.18 28.29 28.42 23.11 70-74 19.81 28.305000000000003 27.900000000000002 23.985 75-79 19.765 28.815 27.650000000000002 23.77 80-84 20.19 28.865000000000002 27.400000000000002 23.544999999999998 85-89 20.015 28.360000000000003 28.205000000000002 23.419999999999998 90-94 20.325 28.02 27.875 23.78 95-99 20.27 28.275 27.544999999999998 23.91 100-104 20.525 28.525 27.77 23.18 105-109 20.474999999999998 27.97 28.08 23.474999999999998 110-114 20.685000000000002 28.349999999999998 27.57 23.395 115-119 20.5 27.445000000000004 27.639999999999997 24.415 120-124 20.285 28.575 27.515 23.625 125-129 20.605 28.24 27.26 23.895 130-134 20.44 28.525 27.445000000000004 23.59 135-139 20.724999999999998 28.610000000000003 27.095000000000002 23.57 140-144 21.029999999999998 27.689999999999998 27.005000000000003 24.275 145-149 20.845 28.51 26.810000000000002 23.835 150-151 21.05 28.1 26.775 24.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.5 21 3.0 22 2.0 23 1.0 24 2.5 25 2.5 26 5.0 27 8.0 28 6.5 29 16.0 30 23.0 31 25.5 32 39.0 33 43.0 34 64.0 35 81.5 36 91.5 37 102.0 38 132.5 39 174.0 40 191.0 41 218.0 42 235.0 43 279.0 44 305.0 45 266.5 46 248.0 47 244.5 48 217.5 49 196.5 50 175.0 51 134.5 52 115.5 53 99.0 54 71.0 55 51.5 56 40.5 57 28.0 58 14.5 59 12.5 60 9.5 61 6.5 62 5.5 63 3.0 64 2.0 65 1.5 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.17277763123187 90.2 2 4.273278818253759 8.1 3 0.474808757583751 1.35 4 0.026378264310208392 0.1 5 0.052756528620416784 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit CAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.36250000000000004 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.9125 0.0 0.0 0.0 0.0 102-103 0.9624999999999999 0.0 0.0 0.0 0.0 104-105 1.0750000000000002 0.0 0.0 0.0 0.0 106-107 1.3 0.0 0.0 0.0 0.0 108-109 1.3625 0.0 0.0 0.0 0.0 110-111 1.5125 0.0 0.0 0.0 0.0 112-113 1.7875 0.0 0.0 0.0 0.0 114-115 2.1 0.0 0.0 0.0 0.0 116-117 2.3375 0.0 0.0 0.0 0.0 118-119 2.6625 0.0 0.0 0.0 0.0 120-121 3.1125 0.0 0.0 0.0 0.0 122-123 3.3875 0.0 0.0 0.0 0.0 124-125 3.825 0.0 0.0 0.0 0.0 126-127 4.1625 0.0 0.0 0.0 0.0 128-129 4.7375 0.0 0.0 0.0 0.0 130-131 5.074999999999999 0.0 0.0 0.0 0.0 132-133 5.5 0.0 0.0 0.0 0.0 134-135 5.975 0.0 0.0 0.0 0.0 136-137 6.625 0.0 0.0 0.0 0.0 138-139 7.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTAGTC 10 0.006830828 145.0 145 AAGATCG 10 0.006830828 145.0 145 GTTAAAG 10 0.006830828 145.0 1 >>END_MODULE SRR12671704 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671704_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8915 37.0 37.0 37.0 37.0 37.0 2 35.7635 37.0 37.0 37.0 37.0 37.0 3 35.994 37.0 37.0 37.0 37.0 37.0 4 35.8405 37.0 37.0 37.0 37.0 37.0 5 36.1265 37.0 37.0 37.0 37.0 37.0 6 36.076 37.0 37.0 37.0 37.0 37.0 7 36.0035 37.0 37.0 37.0 37.0 37.0 8 36.192 37.0 37.0 37.0 37.0 37.0 9 36.097 37.0 37.0 37.0 37.0 37.0 10-14 36.1622 37.0 37.0 37.0 37.0 37.0 15-19 36.1214 37.0 37.0 37.0 37.0 37.0 20-24 36.092600000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.0364 37.0 37.0 37.0 37.0 37.0 30-34 35.9681 37.0 37.0 37.0 37.0 37.0 35-39 35.9625 37.0 37.0 37.0 37.0 37.0 40-44 35.9361 37.0 37.0 37.0 37.0 37.0 45-49 35.92139999999999 37.0 37.0 37.0 37.0 37.0 50-54 35.814099999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.7906 37.0 37.0 37.0 37.0 37.0 60-64 35.7757 37.0 37.0 37.0 37.0 37.0 65-69 35.7686 37.0 37.0 37.0 37.0 37.0 70-74 35.7203 37.0 37.0 37.0 37.0 37.0 75-79 35.67139999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.6934 37.0 37.0 37.0 37.0 37.0 85-89 35.62949999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.6085 37.0 37.0 37.0 37.0 37.0 95-99 35.6727 37.0 37.0 37.0 37.0 37.0 100-104 35.5738 37.0 37.0 37.0 37.0 37.0 105-109 35.5021 37.0 37.0 37.0 37.0 37.0 110-114 35.496900000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.422399999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.5048 37.0 37.0 37.0 37.0 37.0 125-129 35.306799999999996 37.0 37.0 37.0 32.2 37.0 130-134 35.3137 37.0 37.0 37.0 34.6 37.0 135-139 35.2993 37.0 37.0 37.0 32.2 37.0 140-144 34.9617 37.0 37.0 37.0 27.4 37.0 145-149 35.099900000000005 37.0 37.0 37.0 25.0 37.0 150-151 34.73625 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 2.0 18 1.0 19 2.0 20 3.0 21 4.0 22 2.0 23 5.0 24 4.0 25 9.0 26 13.0 27 21.0 28 18.0 29 23.0 30 35.0 31 55.0 32 95.0 33 137.0 34 231.0 35 700.0 36 2474.0 37 164.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.074999999999996 17.0 16.05 33.875 2 24.575 23.425 36.275 15.725 3 19.425 26.6 32.125 21.85 4 23.375 35.35 20.7 20.575 5 23.875 36.85 22.8 16.475 6 17.575 37.2 24.675 20.549999999999997 7 17.8 15.975 44.95 21.275 8 20.225 21.425 27.900000000000002 30.45 9 21.075 25.35 28.825 24.75 10-14 22.62 28.62 26.91 21.85 15-19 22.29 28.27 27.85 21.59 20-24 21.955 28.4 27.58 22.065 25-29 22.25 28.000000000000004 28.144999999999996 21.605 30-34 22.439999999999998 28.910000000000004 27.495000000000005 21.154999999999998 35-39 22.535 28.044999999999998 28.175 21.245 40-44 22.715 28.225 27.834999999999997 21.224999999999998 45-49 22.61 28.449999999999996 27.250000000000004 21.69 50-54 22.770000000000003 28.115000000000002 27.735 21.38 55-59 22.98 27.92 28.000000000000004 21.099999999999998 60-64 23.200000000000003 27.605 28.050000000000004 21.145 65-69 23.265 27.384999999999998 27.644999999999996 21.705 70-74 23.185 28.904999999999998 27.16 20.75 75-79 22.994999999999997 28.08 27.705000000000002 21.22 80-84 23.32 27.935 27.455000000000002 21.29 85-89 23.23 27.42 28.1 21.25 90-94 23.505000000000003 27.389999999999997 28.18 20.925 95-99 23.525 27.139999999999997 27.805000000000003 21.529999999999998 100-104 23.54 28.055000000000003 27.994999999999997 20.41 105-109 23.46 27.845 27.900000000000002 20.794999999999998 110-114 23.965 28.199999999999996 27.325 20.51 115-119 24.375 27.29 27.855 20.48 120-124 23.77 27.735 27.62 20.875 125-129 24.474999999999998 27.74 26.705000000000002 21.08 130-134 25.174999999999997 28.115000000000002 26.99 19.72 135-139 25.03 27.965 27.060000000000002 19.945 140-144 25.590000000000003 27.500000000000004 27.089999999999996 19.82 145-149 25.985000000000003 28.17 26.445 19.400000000000002 150-151 26.275 27.375 26.875 19.475 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 1.5 21 1.0 22 1.5 23 2.0 24 2.0 25 1.5 26 4.0 27 5.5 28 8.0 29 11.0 30 11.5 31 18.0 32 23.5 33 33.5 34 44.5 35 55.0 36 81.5 37 122.0 38 146.5 39 174.0 40 215.5 41 235.5 42 248.5 43 265.5 44 273.5 45 268.0 46 240.0 47 210.5 48 213.5 49 217.0 50 179.0 51 138.0 52 114.0 53 88.5 54 74.0 55 67.5 56 57.5 57 39.0 58 27.5 59 24.0 60 15.5 61 8.0 62 7.0 63 5.0 64 1.5 65 0.5 66 1.5 67 2.0 68 1.5 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 1.5 89 1.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.06466086038533 90.05 2 4.407495381367115 8.35 3 0.422275006598047 1.2 4 0.10556875164951175 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.36250000000000004 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.9125 0.0 0.0 0.0 0.0 102-103 0.9624999999999999 0.0 0.0 0.0 0.0 104-105 1.0750000000000002 0.0 0.0 0.0 0.0 106-107 1.3 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.5125 0.0 0.0 0.0 0.0 112-113 1.7875 0.0 0.0 0.0 0.0 114-115 2.1 0.0 0.0 0.0 0.0 116-117 2.35 0.0 0.0 0.0 0.0 118-119 2.6875 0.0 0.0 0.0 0.0 120-121 3.1375 0.0 0.0 0.0 0.0 122-123 3.4125 0.0 0.0 0.0 0.0 124-125 3.8375 0.0 0.0 0.0 0.0 126-127 4.15 0.0 0.0 0.0 0.0 128-129 4.7 0.0 0.0 0.0 0.0 130-131 5.012499999999999 0.0 0.0 0.0 0.0 132-133 5.425000000000001 0.0 0.0 0.0 0.0 134-135 5.9 0.0 0.0 0.0 0.0 136-137 6.5375 0.0 0.0 0.0 0.0 138-139 7.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCATAC 10 0.006830828 145.0 7 CATTCAT 10 0.006830828 145.0 5 ACACATT 10 0.006830828 145.0 2 ACATTCA 10 0.006830828 145.0 4 ATTCATA 10 0.006830828 145.0 6 AACACAT 10 0.006830828 145.0 1 >>END_MODULE Read 868379 spots for SRR12671704.sra Written 868379 spots for SRR12671704.sra Read 868379 spots for SRR12671704.sra Written 868379 spots for SRR12671704.sra Read 868379 spots for SRR12671704.sra Written 868379 spots for SRR12671704.sra Read 868379 spots for SRR12671704.sra Written 868379 spots for SRR12671704.sra Read 868379 spots for SRR12671704.sra Written 868379 spots for SRR12671704.sra Read 868379 spots for SRR12671704.sra Written 868379 spots for SRR12671704.sra Read 868379 spots for SRR12671704.sra Written 868379 spots for SRR12671704.sra Read 868379 spots for SRR12671704.sra Written 868379 spots for SRR12671704.sra Read 868379 spots for SRR12671704.sra Written 868379 spots for SRR12671704.sra Read 868379 spots for SRR12671704.sra Written 868379 spots for SRR12671704.sra Read 868379 spots for SRR12671704.sra Written 868379 spots for SRR12671704.sra Read 868379 spots for SRR12671704.sra Written 868379 spots for SRR12671704.sra Read 868379 spots for SRR12671704.sra Written 868379 spots for SRR12671704.sra Read 868379 spots for SRR12671704.sra Written 868379 spots for SRR12671704.sra Read 868379 spots for SRR12671704.sra Written 868379 spots for SRR12671704.sra Read 868379 spots for SRR12671704.sra Written 868379 spots for SRR12671704.sra Read 868379 spots for SRR12671704.sra Written 868379 spots for SRR12671704.sra Read 868379 spots for SRR12671704.sra Written 868379 spots for SRR12671704.sra Read 868386 spots for SRR12671704.sra Written 868386 spots for SRR12671704.sra Read 868379 spots for SRR12671704.sra Written 868379 spots for SRR12671704.sra SRR ids: ['SRR12671704.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b3p8_1zf SRR12671704.sra spots: 17367587 blocks: [[1, 868379], [868380, 1736758], [1736759, 2605137], [2605138, 3473516], [3473517, 4341895], [4341896, 5210274], [5210275, 6078653], [6078654, 6947032], [6947033, 7815411], [7815412, 8683790], [8683791, 9552169], [9552170, 10420548], [10420549, 11288927], [11288928, 12157306], [12157307, 13025685], [13025686, 13894064], [13894065, 14762443], [14762444, 15630822], [15630823, 16499201], [16499202, 17367587]] SRR12671704 file size 5880565 SRR12671704 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671704 SRR12671704_1.fastq SRR12671704_2.fastq Input file: SRR12671704_1.fastq Paired file: SRR12671704_2.fastq trimmed: SRR12671704-trimmed-pair1.fastq, SRR12671704-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:51:56 2025 >> started Wed Feb 12 04:52:15 2025 >> done (19.744s) 17367587 read pairs processed; of these: 9 ( 0.00%) short read pairs filtered out after trimming by size control 1297 ( 0.01%) empty read pairs filtered out after trimming by size control 17366281 (99.99%) read pairs available; of these: 1771084 (10.20%) trimmed read pairs available after processing 15595197 (89.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 1 0.00% 25 5 0.00% 26 4 0.00% 27 6 0.00% 28 4 0.00% 29 1 0.00% 30 3 0.00% 31 7 0.00% 32 7 0.00% 33 11 0.00% 34 8 0.00% 35 12 0.00% 36 14 0.00% 37 15 0.00% 38 12 0.00% 39 24 0.00% 40 29 0.00% 41 27 0.00% 42 35 0.00% 43 33 0.00% 44 38 0.00% 45 34 0.00% 46 38 0.00% 47 52 0.00% 48 41 0.00% 49 44 0.00% 50 57 0.00% 51 84 0.00% 52 87 0.00% 53 76 0.00% 54 104 0.00% 55 118 0.00% 56 114 0.00% 57 107 0.00% 58 139 0.00% 59 153 0.00% 60 166 0.00% 61 193 0.00% 62 233 0.00% 63 262 0.00% 64 247 0.00% 65 305 0.00% 66 340 0.00% 67 392 0.00% 68 399 0.00% 69 459 0.00% 70 508 0.00% 71 576 0.00% 72 666 0.00% 73 805 0.00% 74 874 0.01% 75 1066 0.01% 76 1085 0.01% 77 1180 0.01% 78 1354 0.01% 79 1510 0.01% 80 1671 0.01% 81 1767 0.01% 82 2141 0.01% 83 2412 0.01% 84 2683 0.02% 85 2998 0.02% 86 3281 0.02% 87 3625 0.02% 88 3822 0.02% 89 4151 0.02% 90 4740 0.03% 91 5387 0.03% 92 5833 0.03% 93 6400 0.04% 94 7029 0.04% 95 7571 0.04% 96 8347 0.05% 97 8901 0.05% 98 9207 0.05% 99 10028 0.06% 100 10862 0.06% 101 11409 0.07% 102 12384 0.07% 103 13124 0.08% 104 14188 0.08% 105 15241 0.09% 106 16258 0.09% 107 16610 0.10% 108 17635 0.10% 109 18437 0.11% 110 19109 0.11% 111 20108 0.12% 112 21032 0.12% 113 21911 0.13% 114 23157 0.13% 115 24532 0.14% 116 25137 0.14% 117 26394 0.15% 118 26656 0.15% 119 27661 0.16% 120 28425 0.16% 121 29311 0.17% 122 30126 0.17% 123 31521 0.18% 124 33015 0.19% 125 33272 0.19% 126 34296 0.20% 127 35339 0.20% 128 35886 0.21% 129 36679 0.21% 130 36629 0.21% 131 37818 0.22% 132 38753 0.22% 133 40366 0.23% 134 41094 0.24% 135 41764 0.24% 136 42918 0.25% 137 43414 0.25% 138 44244 0.25% 139 44775 0.26% 140 44762 0.26% 141 45355 0.26% 142 46773 0.27% 143 46821 0.27% 144 49178 0.28% 145 49359 0.28% 146 49864 0.29% 147 50296 0.29% 148 50198 0.29% 149 50395 0.29% 150 50432 0.29% 151 15595197 89.80% 17366281 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=25 prefix-density=0.32 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=58.23 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.4 sequence=ACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=27 prefix-density=0.81 prefix-fanout=2.1 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=66.15 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=15.2 sequence=AAGAAAACAGATTATCAAGCTTACTAGAATTATGGAAGGAATGAGTGTGGAGAACATGCACAAGATAGTGGTGGCAGTGGATGAGAGTGAGGAGAGCATGCATGCTCTTTCATGGTGTCTCAGCAACCTTATTTCTCACAACTCCACCGCCACGTTAGTCCTCCTCTAT SRR12671704 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:53:20 Started mapping on | Feb 12 04:53:20 Finished on | Feb 12 04:54:59 Mapping speed, Million of reads per hour | 631.50 Number of input reads | 17366281 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 15110799 Uniquely mapped reads % | 87.01% Average mapped length | 289.15 Number of splices: Total | 15430401 Number of splices: Annotated (sjdb) | 15088567 Number of splices: GT/AG | 15130377 Number of splices: GC/AG | 240085 Number of splices: AT/AC | 9879 Number of splices: Non-canonical | 50060 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 381284 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 103174 % of reads mapped to too many loci | 0.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.08% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1874198 1874198 1874198 N_multimapping 381284 381284 381284 N_noFeature 590230 14875649 670922 N_ambiguous 291942 1907 136238 UnstrandedReadsAssigned:14228627 PositiveStrandReadsAssigned:233243 NegativeStrandReadsAssigned:14303639 Dataset is classified negative stranded MeadianReadLen=143 20thPercentileLength=143 echo kmer=139 SRR12671704 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671704-trimmed-pair1.fastq SRR12671704-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,366,281 reads, 15,514,364 reads pseudoaligned [quant] estimated average fragment length: 272.061 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,119 rounds 52401 SRR12671704.ke.tsv 34699 SRR12671704.se.tsv 87100 total ==> SRR12671704.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1746.94 596 21.4702 Potri.005G024800.1.v4.1 1035 763.939 313 25.7842 Potri.004G059700.1.v4.1 961 690.425 4 0.364596 Potri.007G009000.2.v4.1 1416 1144.94 0 0 Potri.003G141000.2.v4.1 2943 2671.94 995.133 23.4381 Potri.016G087400.1.v4.1 270 91.2115 935 645.105 Potri.015G069301.1.v4.1 564 318.1 0 0 Potri.010G195200.1.v4.1 1773 1501.94 131 5.48893 Potri.012G127500.1.v4.1 977 706.214 42 3.74267 ==> SRR12671704.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 218 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 235 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR12671704 completed mapping pipeline successfully