Starting /dee2/code/volunteer_pipeline.sh SRR12671705 current disk space = 3048990273536 free memory = 1576261812 SRR12671705 SRAfilesize 797bf4723f6cc9882d06ffc0e4166186 SRR12671705.sra SRR12671705.sra file validated SRR12671705 is paired end SRR12671705 is conventional basespace SRR12671705 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671705_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3615 37.0 37.0 37.0 37.0 37.0 2 36.16075 37.0 37.0 37.0 37.0 37.0 3 36.4215 37.0 37.0 37.0 37.0 37.0 4 36.429 37.0 37.0 37.0 37.0 37.0 5 36.5225 37.0 37.0 37.0 37.0 37.0 6 36.576 37.0 37.0 37.0 37.0 37.0 7 36.498 37.0 37.0 37.0 37.0 37.0 8 36.526 37.0 37.0 37.0 37.0 37.0 9 36.584 37.0 37.0 37.0 37.0 37.0 10-14 36.5869 37.0 37.0 37.0 37.0 37.0 15-19 36.562400000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.5284 37.0 37.0 37.0 37.0 37.0 25-29 36.4806 37.0 37.0 37.0 37.0 37.0 30-34 36.480000000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.408699999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.4194 37.0 37.0 37.0 37.0 37.0 45-49 36.4051 37.0 37.0 37.0 37.0 37.0 50-54 36.4031 37.0 37.0 37.0 37.0 37.0 55-59 36.3934 37.0 37.0 37.0 37.0 37.0 60-64 36.4209 37.0 37.0 37.0 37.0 37.0 65-69 36.3587 37.0 37.0 37.0 37.0 37.0 70-74 36.3378 37.0 37.0 37.0 37.0 37.0 75-79 36.27760000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.3266 37.0 37.0 37.0 37.0 37.0 85-89 36.279700000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.2027 37.0 37.0 37.0 37.0 37.0 95-99 36.1981 37.0 37.0 37.0 37.0 37.0 100-104 36.230399999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.1829 37.0 37.0 37.0 37.0 37.0 110-114 36.1292 37.0 37.0 37.0 37.0 37.0 115-119 36.145599999999995 37.0 37.0 37.0 37.0 37.0 120-124 36.0869 37.0 37.0 37.0 37.0 37.0 125-129 36.0433 37.0 37.0 37.0 37.0 37.0 130-134 36.0101 37.0 37.0 37.0 37.0 37.0 135-139 35.9935 37.0 37.0 37.0 37.0 37.0 140-144 35.8844 37.0 37.0 37.0 37.0 37.0 145-149 35.9294 37.0 37.0 37.0 37.0 37.0 150-151 35.34475 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 2.0 25 2.0 26 3.0 27 8.0 28 4.0 29 22.0 30 26.0 31 35.0 32 47.0 33 70.0 34 130.0 35 300.0 36 2962.0 37 388.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.925 16.575 11.899999999999999 38.6 2 20.832288794184006 21.83504637753823 38.906994234143895 18.42567059413387 3 17.75 27.075 28.225 26.950000000000003 4 20.25 36.825 22.275 20.65 5 21.45 37.7 24.325 16.525000000000002 6 17.724999999999998 35.449999999999996 25.874999999999996 20.95 7 12.925 20.849999999999998 46.2 20.025000000000002 8 18.875 21.349999999999998 29.7 30.075000000000003 9 17.175 22.175 32.6 28.050000000000004 10-14 19.82 28.71 26.755000000000003 24.715 15-19 19.46 28.475 27.875 24.19 20-24 19.509999999999998 28.665000000000003 28.37 23.455000000000002 25-29 19.814999999999998 28.57 27.57 24.044999999999998 30-34 19.45 28.000000000000004 27.875 24.675 35-39 19.755 28.29 27.845 24.11 40-44 19.89 28.945 27.525 23.64 45-49 20.03 28.65 26.99 24.33 50-54 19.71 28.075 28.665000000000003 23.549999999999997 55-59 20.169999999999998 28.470000000000002 27.615000000000002 23.745 60-64 20.055 27.88 28.125 23.94 65-69 19.59 28.560000000000002 27.62 24.23 70-74 20.4 28.21 27.57 23.82 75-79 19.835 28.01 28.23 23.925 80-84 20.36 28.415000000000003 27.755000000000003 23.47 85-89 19.89 28.365000000000002 27.169999999999998 24.575 90-94 20.27 28.865000000000002 27.279999999999998 23.585 95-99 20.48 27.939999999999998 27.655 23.925 100-104 20.18 28.189999999999998 27.894999999999996 23.735 105-109 20.830000000000002 28.325 27.3 23.544999999999998 110-114 20.674999999999997 28.225 27.36 23.74 115-119 20.705000000000002 28.705000000000002 27.060000000000002 23.53 120-124 20.655 28.565 27.355 23.425 125-129 20.215 28.27 27.33 24.185000000000002 130-134 21.060000000000002 27.3 27.839999999999996 23.799999999999997 135-139 20.86 27.389999999999997 28.005000000000003 23.745 140-144 20.375 27.779999999999998 27.35 24.495 145-149 20.84 28.449999999999996 27.27 23.44 150-151 20.825 27.05 28.3875 23.7375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 1.5 22 1.5 23 3.0 24 4.5 25 3.5 26 3.5 27 9.0 28 10.5 29 13.5 30 17.5 31 18.5 32 28.0 33 39.0 34 57.0 35 81.5 36 102.5 37 112.0 38 124.5 39 165.5 40 200.0 41 227.0 42 263.0 43 271.5 44 258.5 45 257.0 46 255.0 47 241.5 48 239.5 49 213.5 50 167.5 51 127.0 52 97.5 53 89.0 54 67.5 55 48.5 56 44.0 57 33.5 58 27.0 59 23.0 60 16.0 61 9.5 62 4.5 63 5.0 64 4.5 65 2.5 66 2.0 67 2.0 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.625 #Duplication Level Percentage of deduplicated Percentage of total 1 92.79352226720647 85.95 2 6.50472334682861 12.049999999999999 3 0.6477732793522267 1.7999999999999998 4 0.053981106612685556 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.5249999999999999 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.7124999999999999 0.0 0.0 0.0 0.0 104-105 0.7749999999999999 0.0 0.0 0.0 0.0 106-107 0.9 0.0 0.0 0.0 0.0 108-109 0.975 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.175 0.0 0.0 0.0 0.0 114-115 1.2875 0.0 0.0 0.0 0.0 116-117 1.3875000000000002 0.0 0.0 0.0 0.0 118-119 1.5625 0.0 0.0 0.0 0.0 120-121 1.7 0.0 0.0 0.0 0.0 122-123 1.95 0.0 0.0 0.0 0.0 124-125 2.1625 0.0 0.0 0.0 0.0 126-127 2.425 0.0 0.0 0.0 0.0 128-129 2.6625 0.0 0.0 0.0 0.0 130-131 2.9375 0.0 0.0 0.0 0.0 132-133 3.35 0.0 0.0 0.0 0.0 134-135 3.6875 0.0 0.0 0.0 0.0 136-137 3.8875 0.0 0.0 0.0 0.0 138-139 4.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671705 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671705_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2715 37.0 37.0 37.0 37.0 37.0 2 35.979 37.0 37.0 37.0 37.0 37.0 3 36.129 37.0 37.0 37.0 37.0 37.0 4 36.1055 37.0 37.0 37.0 37.0 37.0 5 36.3035 37.0 37.0 37.0 37.0 37.0 6 36.172 37.0 37.0 37.0 37.0 37.0 7 36.2345 37.0 37.0 37.0 37.0 37.0 8 36.422 37.0 37.0 37.0 37.0 37.0 9 36.1725 37.0 37.0 37.0 37.0 37.0 10-14 36.272000000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.2637 37.0 37.0 37.0 37.0 37.0 20-24 36.2613 37.0 37.0 37.0 37.0 37.0 25-29 36.1553 37.0 37.0 37.0 37.0 37.0 30-34 36.144999999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.1104 37.0 37.0 37.0 37.0 37.0 40-44 36.1802 37.0 37.0 37.0 37.0 37.0 45-49 36.0978 37.0 37.0 37.0 37.0 37.0 50-54 36.088300000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.054500000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.957 37.0 37.0 37.0 37.0 37.0 65-69 35.9773 37.0 37.0 37.0 37.0 37.0 70-74 35.96810000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.9071 37.0 37.0 37.0 37.0 37.0 80-84 35.8995 37.0 37.0 37.0 37.0 37.0 85-89 35.8365 37.0 37.0 37.0 37.0 37.0 90-94 35.8173 37.0 37.0 37.0 37.0 37.0 95-99 35.8721 37.0 37.0 37.0 37.0 37.0 100-104 35.812599999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.7274 37.0 37.0 37.0 37.0 37.0 110-114 35.6571 37.0 37.0 37.0 37.0 37.0 115-119 35.6434 37.0 37.0 37.0 37.0 37.0 120-124 35.6197 37.0 37.0 37.0 37.0 37.0 125-129 35.512600000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.5163 37.0 37.0 37.0 37.0 37.0 135-139 35.4582 37.0 37.0 37.0 37.0 37.0 140-144 35.2341 37.0 37.0 37.0 29.8 37.0 145-149 35.33820000000001 37.0 37.0 37.0 34.6 37.0 150-151 34.9835 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 1.0 22 8.0 23 3.0 24 4.0 25 5.0 26 8.0 27 13.0 28 21.0 29 23.0 30 34.0 31 46.0 32 77.0 33 128.0 34 199.0 35 506.0 36 2666.0 37 255.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.3 18.925 15.775 30.0 2 27.125 23.325000000000003 35.15 14.399999999999999 3 18.975 27.900000000000002 32.324999999999996 20.8 4 22.125 34.9 23.849999999999998 19.125 5 23.1 36.85 22.5 17.549999999999997 6 18.475 37.875 24.275 19.375 7 16.925 16.675 44.474999999999994 21.925 8 19.85 23.45 27.0 29.7 9 20.849999999999998 25.025 29.275000000000002 24.85 10-14 22.985 28.754999999999995 26.400000000000002 21.86 15-19 22.009999999999998 28.015 28.16 21.815 20-24 21.7 28.12 28.03 22.15 25-29 22.035 27.994999999999997 28.52 21.45 30-34 22.005 27.575 28.349999999999998 22.07 35-39 22.5 28.425 27.48 21.595 40-44 22.285 28.46 27.965 21.29 45-49 22.16 28.315 27.950000000000003 21.575 50-54 23.03 27.725 28.28 20.965 55-59 22.830000000000002 27.72 27.944999999999997 21.505 60-64 22.57 27.52 27.68 22.23 65-69 23.095 27.815 27.79 21.3 70-74 23.32 28.08 27.235 21.365000000000002 75-79 22.965 28.110000000000003 27.189999999999998 21.735 80-84 22.86 28.494999999999997 27.279999999999998 21.365000000000002 85-89 23.13 27.884999999999998 27.105 21.88 90-94 22.625 28.505000000000003 27.26 21.61 95-99 23.05 27.715 27.839999999999996 21.395 100-104 22.675 27.279999999999998 28.444999999999997 21.6 105-109 23.74 27.500000000000004 27.775 20.985 110-114 24.21 27.415 27.384999999999998 20.990000000000002 115-119 24.165 27.125 27.805000000000003 20.905 120-124 23.515 27.700000000000003 27.894999999999996 20.89 125-129 24.39 27.79 27.125 20.695 130-134 24.01 27.735 27.425 20.830000000000002 135-139 24.529999999999998 27.755000000000003 27.565 20.150000000000002 140-144 24.695 27.67 27.21 20.424999999999997 145-149 25.055 27.095000000000002 27.405 20.445 150-151 25.1 27.875 27.075 19.950000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 2.0 13 1.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.5 21 2.5 22 3.0 23 2.5 24 2.0 25 3.0 26 3.0 27 5.0 28 12.0 29 16.5 30 18.0 31 21.0 32 26.0 33 32.0 34 43.0 35 62.5 36 86.0 37 106.0 38 134.5 39 163.5 40 189.0 41 215.0 42 236.0 43 265.5 44 269.5 45 265.5 46 257.0 47 251.0 48 236.5 49 205.5 50 182.0 51 138.5 52 106.5 53 95.5 54 86.0 55 67.5 56 51.0 57 37.0 58 27.5 59 23.5 60 16.0 61 10.5 62 7.5 63 4.5 64 2.5 65 1.5 66 1.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.84557235421165 85.975 2 6.452483801295897 11.95 3 0.593952483801296 1.6500000000000001 4 0.08099352051835854 0.3 5 0.02699784017278618 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TCTGCATTTGCTAGCTAGAAGTCACTCTACCCTTCGCATTACTTCCTCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.15 0.0 0.0 0.0 0.0 112-113 1.2 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.4125 0.0 0.0 0.0 0.0 118-119 1.6124999999999998 0.0 0.0 0.0 0.0 120-121 1.75 0.0 0.0 0.0 0.0 122-123 2.0 0.0 0.0 0.0 0.0 124-125 2.1875 0.0 0.0 0.0 0.0 126-127 2.45 0.0 0.0 0.0 0.0 128-129 2.6875 0.0 0.0 0.0 0.0 130-131 2.9625 0.0 0.0 0.0 0.0 132-133 3.375 0.0 0.0 0.0 0.0 134-135 3.7125 0.0 0.0 0.0 0.0 136-137 3.9125 0.0 0.0 0.0 0.0 138-139 4.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATTGGT 10 0.006830828 145.0 2 >>END_MODULE Read 1464488 spots for SRR12671705.sra Written 1464488 spots for SRR12671705.sra Read 1464488 spots for SRR12671705.sra Written 1464488 spots for SRR12671705.sra Read 1464488 spots for SRR12671705.sra Written 1464488 spots for SRR12671705.sra Read 1464488 spots for SRR12671705.sra Written 1464488 spots for SRR12671705.sra Read 1464488 spots for SRR12671705.sra Written 1464488 spots for SRR12671705.sra Read 1464488 spots for SRR12671705.sra Written 1464488 spots for SRR12671705.sra Read 1464488 spots for SRR12671705.sra Written 1464488 spots for SRR12671705.sra Read 1464488 spots for SRR12671705.sra Written 1464488 spots for SRR12671705.sra Read 1464488 spots for SRR12671705.sra Written 1464488 spots for SRR12671705.sra Read 1464488 spots for SRR12671705.sra Written 1464488 spots for SRR12671705.sra Read 1464499 spots for SRR12671705.sra Written 1464499 spots for SRR12671705.sra Read 1464488 spots for SRR12671705.sra Written 1464488 spots for SRR12671705.sra Read 1464488 spots for SRR12671705.sra Written 1464488 spots for SRR12671705.sra Read 1464488 spots for SRR12671705.sra Written 1464488 spots for SRR12671705.sra Read 1464488 spots for SRR12671705.sra Written 1464488 spots for SRR12671705.sra Read 1464488 spots for SRR12671705.sra Written 1464488 spots for SRR12671705.sra Read 1464488 spots for SRR12671705.sra Written 1464488 spots for SRR12671705.sra Read 1464488 spots for SRR12671705.sra Written 1464488 spots for SRR12671705.sra Read 1464488 spots for SRR12671705.sra Written 1464488 spots for SRR12671705.sra Read 1464488 spots for SRR12671705.sra Written 1464488 spots for SRR12671705.sra SRR ids: ['SRR12671705.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dq_hofun SRR12671705.sra spots: 29289771 blocks: [[1, 1464488], [1464489, 2928976], [2928977, 4393464], [4393465, 5857952], [5857953, 7322440], [7322441, 8786928], [8786929, 10251416], [10251417, 11715904], [11715905, 13180392], [13180393, 14644880], [14644881, 16109368], [16109369, 17573856], [17573857, 19038344], [19038345, 20502832], [20502833, 21967320], [21967321, 23431808], [23431809, 24896296], [24896297, 26360784], [26360785, 27825272], [27825273, 29289771]] SRR12671705 file size 9932245 SRR12671705 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671705 SRR12671705_1.fastq SRR12671705_2.fastq Input file: SRR12671705_1.fastq Paired file: SRR12671705_2.fastq trimmed: SRR12671705-trimmed-pair1.fastq, SRR12671705-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:16:03 2025 >> started Wed Feb 12 05:16:36 2025 >> done (32.927s) 29289771 read pairs processed; of these: 28 ( 0.00%) short read pairs filtered out after trimming by size control 1099 ( 0.00%) empty read pairs filtered out after trimming by size control 29288644 (100.00%) read pairs available; of these: 1542256 ( 5.27%) trimmed read pairs available after processing 27746388 (94.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 1 0.00% 21 7 0.00% 22 3 0.00% 23 5 0.00% 24 3 0.00% 25 6 0.00% 26 10 0.00% 27 7 0.00% 28 9 0.00% 29 6 0.00% 30 12 0.00% 31 9 0.00% 32 18 0.00% 33 19 0.00% 34 17 0.00% 35 28 0.00% 36 20 0.00% 37 30 0.00% 38 35 0.00% 39 30 0.00% 40 42 0.00% 41 47 0.00% 42 42 0.00% 43 61 0.00% 44 57 0.00% 45 54 0.00% 46 66 0.00% 47 68 0.00% 48 76 0.00% 49 89 0.00% 50 92 0.00% 51 106 0.00% 52 146 0.00% 53 130 0.00% 54 144 0.00% 55 139 0.00% 56 151 0.00% 57 156 0.00% 58 189 0.00% 59 210 0.00% 60 218 0.00% 61 296 0.00% 62 307 0.00% 63 301 0.00% 64 392 0.00% 65 380 0.00% 66 417 0.00% 67 447 0.00% 68 487 0.00% 69 533 0.00% 70 625 0.00% 71 736 0.00% 72 808 0.00% 73 985 0.00% 74 1062 0.00% 75 1044 0.00% 76 1228 0.00% 77 1248 0.00% 78 1400 0.00% 79 1485 0.01% 80 1751 0.01% 81 2039 0.01% 82 2315 0.01% 83 2631 0.01% 84 2957 0.01% 85 3029 0.01% 86 3304 0.01% 87 3458 0.01% 88 3808 0.01% 89 4085 0.01% 90 4465 0.02% 91 4963 0.02% 92 5520 0.02% 93 6002 0.02% 94 6734 0.02% 95 7124 0.02% 96 7405 0.03% 97 7684 0.03% 98 8057 0.03% 99 8439 0.03% 100 9137 0.03% 101 9513 0.03% 102 10385 0.04% 103 11095 0.04% 104 12057 0.04% 105 12676 0.04% 106 13045 0.04% 107 13506 0.05% 108 13760 0.05% 109 14366 0.05% 110 14659 0.05% 111 15610 0.05% 112 16577 0.06% 113 17493 0.06% 114 18277 0.06% 115 19523 0.07% 116 19878 0.07% 117 20684 0.07% 118 21076 0.07% 119 21298 0.07% 120 22022 0.08% 121 22902 0.08% 122 23895 0.08% 123 25627 0.09% 124 26180 0.09% 125 27275 0.09% 126 28420 0.10% 127 29337 0.10% 128 29303 0.10% 129 30003 0.10% 130 30572 0.10% 131 31039 0.11% 132 32131 0.11% 133 34188 0.12% 134 35211 0.12% 135 37178 0.13% 136 37983 0.13% 137 38516 0.13% 138 39260 0.13% 139 39696 0.14% 140 39640 0.14% 141 40720 0.14% 142 41868 0.14% 143 43224 0.15% 144 46015 0.16% 145 47200 0.16% 146 48232 0.16% 147 48767 0.17% 148 49251 0.17% 149 49672 0.17% 150 49800 0.17% 151 27746388 94.73% 29288644 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=21 prefix-density=0.58 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.18 sequence-density-rank=15 fanout-score=9.16 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=4.4 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=15 prefix-density=0.64 prefix-fanout=2.4 sequence=ATGGTGGCACCATTCAATGGTCTCAAGTCTGCCGCAGCTTTCCCAGTCAGTACCAGAAAGGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=25.30 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=5.3 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR12671705 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:17:20 Started mapping on | Feb 12 05:17:20 Finished on | Feb 12 05:20:11 Mapping speed, Million of reads per hour | 616.60 Number of input reads | 29288644 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 27612175 Uniquely mapped reads % | 94.28% Average mapped length | 298.28 Number of splices: Total | 28169946 Number of splices: Annotated (sjdb) | 27597151 Number of splices: GT/AG | 27620358 Number of splices: GC/AG | 453845 Number of splices: AT/AC | 16232 Number of splices: Non-canonical | 79511 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 694751 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 95118 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.93% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 981718 981718 981718 N_multimapping 694751 694751 694751 N_noFeature 998990 27172323 1153922 N_ambiguous 483464 1759 197527 UnstrandedReadsAssigned:26129721 PositiveStrandReadsAssigned:438093 NegativeStrandReadsAssigned:26260726 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671705 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671705-trimmed-pair1.fastq SRR12671705-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,288,644 reads, 26,189,754 reads pseudoaligned [quant] estimated average fragment length: 303.474 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52401 SRR12671705.ke.tsv 34699 SRR12671705.se.tsv 87100 total ==> SRR12671705.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1715.53 1267 26.768 Potri.005G024800.1.v4.1 1035 732.526 426 21.0777 Potri.004G059700.1.v4.1 961 659.095 9 0.494915 Potri.007G009000.2.v4.1 1416 1113.53 0 0 Potri.003G141000.2.v4.1 2943 2640.53 1312.86 18.0204 Potri.016G087400.1.v4.1 270 73.9111 1078.47 528.853 Potri.015G069301.1.v4.1 564 289.731 0 0 Potri.010G195200.1.v4.1 1773 1470.53 335.746 8.27513 Potri.012G127500.1.v4.1 977 674.876 328 17.6151 ==> SRR12671705.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 550 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 405 Potri.001G212900.v4.1 88 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 25 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 7 SRR12671705 completed mapping pipeline successfully