Starting /dee2/code/volunteer_pipeline.sh SRR12671706 current disk space = 3049028870144 free memory = 1578904640 SRR12671706 SRAfilesize bc83aa668f187101445e8a58009a3c5a SRR12671706.sra SRR12671706.sra file validated SRR12671706 is paired end SRR12671706 is conventional basespace SRR12671706 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671706_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4795 37.0 37.0 37.0 37.0 37.0 2 36.29125 37.0 37.0 37.0 37.0 37.0 3 36.467 37.0 37.0 37.0 37.0 37.0 4 36.515 37.0 37.0 37.0 37.0 37.0 5 36.582 37.0 37.0 37.0 37.0 37.0 6 36.5425 37.0 37.0 37.0 37.0 37.0 7 36.4315 37.0 37.0 37.0 37.0 37.0 8 36.4965 37.0 37.0 37.0 37.0 37.0 9 36.6195 37.0 37.0 37.0 37.0 37.0 10-14 36.5478 37.0 37.0 37.0 37.0 37.0 15-19 36.5071 37.0 37.0 37.0 37.0 37.0 20-24 36.5296 37.0 37.0 37.0 37.0 37.0 25-29 36.506899999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.46379999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.4653 37.0 37.0 37.0 37.0 37.0 40-44 36.4559 37.0 37.0 37.0 37.0 37.0 45-49 36.4724 37.0 37.0 37.0 37.0 37.0 50-54 36.397299999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.37910000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.4188 37.0 37.0 37.0 37.0 37.0 65-69 36.3766 37.0 37.0 37.0 37.0 37.0 70-74 36.307399999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.336400000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.30309999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.27290000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.2452 37.0 37.0 37.0 37.0 37.0 95-99 36.1577 37.0 37.0 37.0 37.0 37.0 100-104 36.2026 37.0 37.0 37.0 37.0 37.0 105-109 36.144800000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.090799999999994 37.0 37.0 37.0 37.0 37.0 115-119 36.0517 37.0 37.0 37.0 37.0 37.0 120-124 36.0487 37.0 37.0 37.0 37.0 37.0 125-129 36.0123 37.0 37.0 37.0 37.0 37.0 130-134 35.9759 37.0 37.0 37.0 37.0 37.0 135-139 35.923100000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.922999999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.8313 37.0 37.0 37.0 37.0 37.0 150-151 35.39775 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 2.0 25 3.0 26 6.0 27 9.0 28 8.0 29 15.0 30 25.0 31 36.0 32 48.0 33 80.0 34 122.0 35 300.0 36 2956.0 37 389.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.475 11.975 12.35 47.199999999999996 2 18.610484073238023 18.510158013544018 40.55680963130173 22.322548281916227 3 19.400000000000002 24.575 26.825 29.2 4 22.375 32.1 21.825 23.7 5 21.45 37.125 23.325000000000003 18.099999999999998 6 17.775 36.575 24.575 21.075 7 14.6 22.25 43.75 19.400000000000002 8 19.225 22.675 30.75 27.35 9 18.2 21.025 32.675 28.1 10-14 20.395 28.875 26.724999999999998 24.005000000000003 15-19 20.04 27.765 28.095 24.099999999999998 20-24 20.735 27.93 27.544999999999998 23.79 25-29 20.5 27.6 27.865000000000002 24.035 30-34 19.86 28.4 27.279999999999998 24.46 35-39 20.595 27.82 27.015 24.57 40-44 20.31 28.37 27.625 23.695 45-49 20.68 27.834999999999997 27.62 23.865 50-54 19.84 28.155 27.775 24.23 55-59 20.28 28.17 27.815 23.735 60-64 20.380000000000003 26.85 28.005000000000003 24.765 65-69 20.76 27.54 27.365000000000002 24.335 70-74 19.8 27.485 28.585 24.13 75-79 20.544999999999998 27.655 27.38 24.42 80-84 20.080000000000002 27.779999999999998 27.655 24.485 85-89 21.04 27.415 27.305 24.240000000000002 90-94 20.525 27.725 27.485 24.265 95-99 21.285 27.229999999999997 26.900000000000002 24.585 100-104 20.815 27.855 28.015 23.315 105-109 20.915 27.685 27.38 24.02 110-114 21.305 27.029999999999998 28.01 23.655 115-119 21.285 28.115000000000002 27.015 23.585 120-124 21.044999999999998 27.625 27.61 23.72 125-129 20.75 27.54 27.744999999999997 23.965 130-134 21.560000000000002 27.6 26.985 23.855 135-139 21.925 27.41 27.13 23.535 140-144 21.78 27.805000000000003 27.01 23.405 145-149 21.415 27.139999999999997 27.325 24.12 150-151 20.8125 27.35 26.987499999999997 24.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 1.5 25 3.5 26 2.5 27 5.0 28 6.5 29 9.5 30 16.0 31 18.0 32 26.5 33 36.5 34 45.0 35 66.5 36 89.5 37 102.0 38 119.0 39 138.0 40 168.0 41 208.0 42 222.5 43 240.5 44 264.5 45 256.0 46 253.5 47 262.0 48 249.0 49 216.5 50 186.5 51 161.0 52 139.5 53 115.0 54 92.5 55 72.5 56 60.0 57 45.5 58 23.0 59 18.0 60 13.0 61 11.0 62 13.5 63 8.5 64 3.0 65 3.0 66 1.5 67 0.0 68 1.5 69 1.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.44790547798067 87.0 2 5.853920515574651 10.9 3 0.5639097744360901 1.575 4 0.10741138560687433 0.4 5 0.02685284640171858 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.65 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.8625 0.0 0.0 0.0 0.0 114-115 1.05 0.0 0.0 0.0 0.0 116-117 1.15 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.4375 0.0 0.0 0.0 0.0 122-123 1.5875 0.0 0.0 0.0 0.0 124-125 1.75 0.0 0.0 0.0 0.0 126-127 1.8875 0.0 0.0 0.0 0.0 128-129 2.0875 0.0 0.0 0.0 0.0 130-131 2.2375 0.0 0.0 0.0 0.0 132-133 2.4625 0.0 0.0 0.0 0.0 134-135 2.75 0.0 0.0 0.0 0.0 136-137 3.0875 0.0 0.0 0.0 0.0 138-139 3.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCCAGT 10 0.006830828 145.0 6 GGCTTCC 10 0.006830828 145.0 5 >>END_MODULE SRR12671706 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671706_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.387 37.0 37.0 37.0 37.0 37.0 2 36.194 37.0 37.0 37.0 37.0 37.0 3 36.2035 37.0 37.0 37.0 37.0 37.0 4 36.229 37.0 37.0 37.0 37.0 37.0 5 36.348 37.0 37.0 37.0 37.0 37.0 6 36.205 37.0 37.0 37.0 37.0 37.0 7 36.3895 37.0 37.0 37.0 37.0 37.0 8 36.416 37.0 37.0 37.0 37.0 37.0 9 36.341 37.0 37.0 37.0 37.0 37.0 10-14 36.3504 37.0 37.0 37.0 37.0 37.0 15-19 36.3261 37.0 37.0 37.0 37.0 37.0 20-24 36.3156 37.0 37.0 37.0 37.0 37.0 25-29 36.2624 37.0 37.0 37.0 37.0 37.0 30-34 36.2597 37.0 37.0 37.0 37.0 37.0 35-39 36.2496 37.0 37.0 37.0 37.0 37.0 40-44 36.235200000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.147 37.0 37.0 37.0 37.0 37.0 50-54 36.1485 37.0 37.0 37.0 37.0 37.0 55-59 36.11800000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.0893 37.0 37.0 37.0 37.0 37.0 65-69 36.0349 37.0 37.0 37.0 37.0 37.0 70-74 36.0412 37.0 37.0 37.0 37.0 37.0 75-79 36.0353 37.0 37.0 37.0 37.0 37.0 80-84 36.01690000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.9633 37.0 37.0 37.0 37.0 37.0 90-94 35.9308 37.0 37.0 37.0 37.0 37.0 95-99 35.9821 37.0 37.0 37.0 37.0 37.0 100-104 35.8695 37.0 37.0 37.0 37.0 37.0 105-109 35.8684 37.0 37.0 37.0 37.0 37.0 110-114 35.7789 37.0 37.0 37.0 37.0 37.0 115-119 35.7754 37.0 37.0 37.0 37.0 37.0 120-124 35.7586 37.0 37.0 37.0 37.0 37.0 125-129 35.738 37.0 37.0 37.0 37.0 37.0 130-134 35.763400000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.6644 37.0 37.0 37.0 37.0 37.0 140-144 35.5112 37.0 37.0 37.0 37.0 37.0 145-149 35.5415 37.0 37.0 37.0 37.0 37.0 150-151 35.18325 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 1.0 18 0.0 19 0.0 20 1.0 21 1.0 22 4.0 23 6.0 24 4.0 25 6.0 26 9.0 27 10.0 28 9.0 29 17.0 30 23.0 31 49.0 32 60.0 33 101.0 34 177.0 35 490.0 36 2791.0 37 240.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.45 19.075 15.375 35.099999999999994 2 23.275000000000002 25.424999999999997 36.325 14.975 3 19.25 27.3 30.875000000000004 22.575 4 23.549999999999997 35.3 20.974999999999998 20.175 5 24.075 37.2 21.775 16.950000000000003 6 18.125 39.175 22.15 20.549999999999997 7 17.125 18.35 43.35 21.175 8 19.875 22.225 28.225 29.675 9 21.4 22.650000000000002 29.775000000000002 26.174999999999997 10-14 21.875 29.18 26.52 22.425 15-19 22.259999999999998 28.435 27.765 21.54 20-24 22.46 27.93 27.49 22.12 25-29 22.485 27.875 27.98 21.66 30-34 22.78 28.09 27.33 21.8 35-39 22.439999999999998 28.689999999999998 27.01 21.86 40-44 23.27 28.215 26.935 21.58 45-49 23.105 27.425 27.785 21.685 50-54 23.175 28.349999999999998 27.275 21.2 55-59 22.91 27.450000000000003 27.355 22.285 60-64 23.24 27.060000000000002 28.015 21.685 65-69 23.22 27.889999999999997 26.93 21.959999999999997 70-74 23.06 28.04 26.88 22.02 75-79 23.655 27.62 27.05 21.675 80-84 23.085 28.044999999999998 27.02 21.85 85-89 23.855 27.18 27.48 21.485000000000003 90-94 23.799999999999997 26.77 27.445000000000004 21.985 95-99 23.985 27.27 27.334999999999997 21.41 100-104 24.125 27.435 26.685 21.755 105-109 23.974999999999998 27.284999999999997 27.29 21.45 110-114 24.044999999999998 27.825 26.915 21.215 115-119 23.785 27.415 27.36 21.44 120-124 24.425 27.42 26.77 21.385 125-129 24.104999999999997 27.61 26.915 21.37 130-134 24.37 27.725 27.0 20.905 135-139 24.57 27.575 27.084999999999997 20.77 140-144 25.074999999999996 26.979999999999997 26.905 21.04 145-149 24.605 27.55 27.060000000000002 20.785 150-151 24.462500000000002 27.6375 27.0875 20.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 1.5 12 2.0 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 1.0 24 1.5 25 1.0 26 1.0 27 3.5 28 4.0 29 8.0 30 15.5 31 21.5 32 28.5 33 31.5 34 43.5 35 62.0 36 72.0 37 86.0 38 121.0 39 149.0 40 172.5 41 217.0 42 237.5 43 241.5 44 266.5 45 279.0 46 266.0 47 255.5 48 237.0 49 206.5 50 184.5 51 151.5 52 116.0 53 100.5 54 90.5 55 74.5 56 57.5 57 48.5 58 32.0 59 24.0 60 25.0 61 17.0 62 9.5 63 5.5 64 7.0 65 5.0 66 2.0 67 3.0 68 2.5 69 1.0 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.525 #Duplication Level Percentage of deduplicated Percentage of total 1 93.00189138070792 86.05000000000001 2 6.295595784922995 11.65 3 0.5403944879762227 1.5 4 0.027019724398811132 0.1 5 0.0810591731964334 0.375 6 0.027019724398811132 0.15 7 0.027019724398811132 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 7 0.17500000000000002 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 6 0.15 No Hit TCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCA 5 0.125 No Hit GGCCACCACAGCAGCCCTCTCCAGCGCCATGGTCAGCACATCGTTTACTC 5 0.125 No Hit TGAGGAATTGGGAGGGCCTTTGAGGGTTTTGCTTGCATCAATTACGGCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.65 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.8625 0.0 0.0 0.0 0.0 114-115 1.05 0.0 0.0 0.0 0.0 116-117 1.15 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.4375 0.0 0.0 0.0 0.0 122-123 1.575 0.0 0.0 0.0 0.0 124-125 1.725 0.0 0.0 0.0 0.0 126-127 1.8625 0.0 0.0 0.0 0.0 128-129 2.075 0.0 0.0 0.0 0.0 130-131 2.2375 0.0 0.0 0.0 0.0 132-133 2.4875 0.0 0.0 0.0 0.0 134-135 2.75 0.0 0.0 0.0 0.0 136-137 3.0625 0.0 0.0 0.0 0.0 138-139 3.3499999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCACAAA 10 0.006830828 145.0 7 >>END_MODULE Read 959163 spots for SRR12671706.sra Written 959163 spots for SRR12671706.sra Read 959163 spots for SRR12671706.sra Written 959163 spots for SRR12671706.sra Read 959163 spots for SRR12671706.sra Written 959163 spots for SRR12671706.sra Read 959163 spots for SRR12671706.sra Written 959163 spots for SRR12671706.sra Read 959163 spots for SRR12671706.sra Written 959163 spots for SRR12671706.sra Read 959163 spots for SRR12671706.sra Written 959163 spots for SRR12671706.sra Read 959163 spots for SRR12671706.sra Written 959163 spots for SRR12671706.sra Read 959163 spots for SRR12671706.sra Written 959163 spots for SRR12671706.sra Read 959163 spots for SRR12671706.sra Written 959163 spots for SRR12671706.sra Read 959163 spots for SRR12671706.sra Written 959163 spots for SRR12671706.sra Read 959163 spots for SRR12671706.sra Written 959163 spots for SRR12671706.sra Read 959163 spots for SRR12671706.sra Written 959163 spots for SRR12671706.sra Read 959163 spots for SRR12671706.sra Written 959163 spots for SRR12671706.sra Read 959163 spots for SRR12671706.sra Written 959163 spots for SRR12671706.sra Read 959163 spots for SRR12671706.sra Written 959163 spots for SRR12671706.sra Read 959163 spots for SRR12671706.sra Written 959163 spots for SRR12671706.sra Read 959181 spots for SRR12671706.sra Written 959181 spots for SRR12671706.sra Read 959163 spots for SRR12671706.sra Written 959163 spots for SRR12671706.sra Read 959163 spots for SRR12671706.sra Written 959163 spots for SRR12671706.sra Read 959163 spots for SRR12671706.sra Written 959163 spots for SRR12671706.sra SRR ids: ['SRR12671706.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pkz9bftt SRR12671706.sra spots: 19183278 blocks: [[1, 959163], [959164, 1918326], [1918327, 2877489], [2877490, 3836652], [3836653, 4795815], [4795816, 5754978], [5754979, 6714141], [6714142, 7673304], [7673305, 8632467], [8632468, 9591630], [9591631, 10550793], [10550794, 11509956], [11509957, 12469119], [12469120, 13428282], [13428283, 14387445], [14387446, 15346608], [15346609, 16305771], [16305772, 17264934], [17264935, 18224097], [18224098, 19183278]] SRR12671706 file size 6497616 SRR12671706 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671706 SRR12671706_1.fastq SRR12671706_2.fastq Input file: SRR12671706_1.fastq Paired file: SRR12671706_2.fastq trimmed: SRR12671706-trimmed-pair1.fastq, SRR12671706-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:03:49 2025 >> started Wed Feb 12 05:04:10 2025 >> done (20.967s) 19183278 read pairs processed; of these: 14 ( 0.00%) short read pairs filtered out after trimming by size control 516 ( 0.00%) empty read pairs filtered out after trimming by size control 19182748 (100.00%) read pairs available; of these: 1080027 ( 5.63%) trimmed read pairs available after processing 18102721 (94.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 4 0.00% 21 3 0.00% 22 4 0.00% 23 2 0.00% 24 1 0.00% 25 2 0.00% 26 1 0.00% 27 6 0.00% 28 2 0.00% 29 4 0.00% 30 8 0.00% 31 6 0.00% 32 6 0.00% 33 5 0.00% 34 8 0.00% 35 10 0.00% 36 4 0.00% 37 15 0.00% 38 17 0.00% 39 17 0.00% 40 14 0.00% 41 13 0.00% 42 12 0.00% 43 15 0.00% 44 25 0.00% 45 19 0.00% 46 26 0.00% 47 35 0.00% 48 27 0.00% 49 30 0.00% 50 35 0.00% 51 43 0.00% 52 55 0.00% 53 34 0.00% 54 38 0.00% 55 59 0.00% 56 62 0.00% 57 81 0.00% 58 90 0.00% 59 84 0.00% 60 101 0.00% 61 105 0.00% 62 118 0.00% 63 125 0.00% 64 162 0.00% 65 175 0.00% 66 155 0.00% 67 208 0.00% 68 224 0.00% 69 215 0.00% 70 292 0.00% 71 304 0.00% 72 339 0.00% 73 402 0.00% 74 477 0.00% 75 519 0.00% 76 565 0.00% 77 623 0.00% 78 717 0.00% 79 892 0.00% 80 871 0.00% 81 928 0.00% 82 1089 0.01% 83 1348 0.01% 84 1473 0.01% 85 1597 0.01% 86 1734 0.01% 87 1873 0.01% 88 2134 0.01% 89 2255 0.01% 90 2462 0.01% 91 2764 0.01% 92 3108 0.02% 93 3325 0.02% 94 3671 0.02% 95 3890 0.02% 96 4207 0.02% 97 4485 0.02% 98 4858 0.03% 99 5278 0.03% 100 5624 0.03% 101 5901 0.03% 102 6361 0.03% 103 6837 0.04% 104 7360 0.04% 105 7787 0.04% 106 8282 0.04% 107 8521 0.04% 108 9052 0.05% 109 9424 0.05% 110 9818 0.05% 111 10679 0.06% 112 10980 0.06% 113 11645 0.06% 114 12152 0.06% 115 12828 0.07% 116 13237 0.07% 117 13954 0.07% 118 14297 0.07% 119 15089 0.08% 120 15518 0.08% 121 16148 0.08% 122 16999 0.09% 123 17810 0.09% 124 18536 0.10% 125 19391 0.10% 126 19762 0.10% 127 20276 0.11% 128 20610 0.11% 129 21328 0.11% 130 22138 0.12% 131 22880 0.12% 132 23618 0.12% 133 24822 0.13% 134 25564 0.13% 135 26512 0.14% 136 26937 0.14% 137 27685 0.14% 138 28608 0.15% 139 29124 0.15% 140 29646 0.15% 141 30396 0.16% 142 31725 0.17% 143 32018 0.17% 144 34405 0.18% 145 34512 0.18% 146 35895 0.19% 147 35736 0.19% 148 36979 0.19% 149 36357 0.19% 150 37273 0.19% 151 18102721 94.37% 19182748 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=24 prefix-density=0.50 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=9.01 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=3.0 sequence=AAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=1.30 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=27 prefix-density=1.29 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC criterion=fanout-score sequence-density=0.11 sequence-density-rank=27 fanout-score=10.78 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=3.0 sequence=AACAGAAAAAAGAAAGATGGCCTCGGCATCATTTCTCAAGTCATCACCAGTTCTAGACAAGTCTGAGTTTGTTAAGGGTCAGACCCTCCGCTTGCCTTCTGCCTCCATTGTCCGGTGCCGCTCCACCGCCCCTTCTGCTCTTACCGTTCGTGCTGGTTCCTATGCTGAGGAGCTTGTCAAAACCGCGAAAAC SRR12671706 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:04:55 Started mapping on | Feb 12 05:04:55 Finished on | Feb 12 05:07:05 Mapping speed, Million of reads per hour | 531.21 Number of input reads | 19182748 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 17949898 Uniquely mapped reads % | 93.57% Average mapped length | 298.46 Number of splices: Total | 18045489 Number of splices: Annotated (sjdb) | 17688150 Number of splices: GT/AG | 17691250 Number of splices: GC/AG | 294810 Number of splices: AT/AC | 10394 Number of splices: Non-canonical | 49035 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 485619 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 177687 % of reads mapped to too many loci | 0.93% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.76% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 747231 747231 747231 N_multimapping 485619 485619 485619 N_noFeature 636267 17618987 716531 N_ambiguous 364056 1407 112496 UnstrandedReadsAssigned:16949575 PositiveStrandReadsAssigned:329504 NegativeStrandReadsAssigned:17120871 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671706 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671706-trimmed-pair1.fastq SRR12671706-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,182,748 reads, 17,107,271 reads pseudoaligned [quant] estimated average fragment length: 292.448 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52401 SRR12671706.ke.tsv 34699 SRR12671706.se.tsv 87100 total ==> SRR12671706.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1726.55 782 21.5 Potri.005G024800.1.v4.1 1035 743.552 309 19.7268 Potri.004G059700.1.v4.1 961 669.898 1 0.0708601 Potri.007G009000.2.v4.1 1416 1124.55 0 0 Potri.003G141000.2.v4.1 2943 2651.55 1448.79 25.9368 Potri.016G087400.1.v4.1 270 74.3355 752 480.211 Potri.015G069301.1.v4.1 564 295.453 0 0 Potri.010G195200.1.v4.1 1773 1481.55 85 2.72341 Potri.012G127500.1.v4.1 977 685.752 221 15.298 ==> SRR12671706.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 57 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 237 Potri.001G212900.v4.1 57 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671706 completed mapping pipeline successfully