Starting /dee2/code/volunteer_pipeline.sh SRR12671707 current disk space = 3048909529088 free memory = 1579488108 SRR12671707 SRAfilesize 3be99888ae43698d4026a6c0d43c29d2 SRR12671707.sra SRR12671707.sra file validated SRR12671707 is paired end SRR12671707 is conventional basespace SRR12671707 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671707_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.416 37.0 37.0 37.0 37.0 37.0 2 36.1775 37.0 37.0 37.0 37.0 37.0 3 36.46 37.0 37.0 37.0 37.0 37.0 4 36.5115 37.0 37.0 37.0 37.0 37.0 5 36.5555 37.0 37.0 37.0 37.0 37.0 6 36.4865 37.0 37.0 37.0 37.0 37.0 7 36.5225 37.0 37.0 37.0 37.0 37.0 8 36.5225 37.0 37.0 37.0 37.0 37.0 9 36.573 37.0 37.0 37.0 37.0 37.0 10-14 36.526799999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.4526 37.0 37.0 37.0 37.0 37.0 20-24 36.4854 37.0 37.0 37.0 37.0 37.0 25-29 36.4498 37.0 37.0 37.0 37.0 37.0 30-34 36.393100000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.4369 37.0 37.0 37.0 37.0 37.0 40-44 36.3939 37.0 37.0 37.0 37.0 37.0 45-49 36.3814 37.0 37.0 37.0 37.0 37.0 50-54 36.366 37.0 37.0 37.0 37.0 37.0 55-59 36.34689999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.35099999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.34160000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.284 37.0 37.0 37.0 37.0 37.0 75-79 36.2715 37.0 37.0 37.0 37.0 37.0 80-84 36.2496 37.0 37.0 37.0 37.0 37.0 85-89 36.2627 37.0 37.0 37.0 37.0 37.0 90-94 36.2161 37.0 37.0 37.0 37.0 37.0 95-99 36.138999999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.2744 37.0 37.0 37.0 37.0 37.0 105-109 36.1216 37.0 37.0 37.0 37.0 37.0 110-114 36.166700000000006 37.0 37.0 37.0 37.0 37.0 115-119 36.1036 37.0 37.0 37.0 37.0 37.0 120-124 36.04019999999999 37.0 37.0 37.0 37.0 37.0 125-129 36.016 37.0 37.0 37.0 37.0 37.0 130-134 35.9495 37.0 37.0 37.0 37.0 37.0 135-139 35.968 37.0 37.0 37.0 37.0 37.0 140-144 35.8711 37.0 37.0 37.0 37.0 37.0 145-149 35.7771 37.0 37.0 37.0 37.0 37.0 150-151 35.46725 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 2.0 26 5.0 27 4.0 28 17.0 29 22.0 30 26.0 31 54.0 32 44.0 33 70.0 34 124.0 35 302.0 36 2949.0 37 380.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.55 12.625 10.15 46.675 2 18.44879518072289 17.92168674698795 39.959839357429715 23.669678714859437 3 18.375 24.125 28.525 28.975 4 21.7 31.374999999999996 22.825 24.099999999999998 5 22.225 34.575 24.25 18.95 6 17.1 37.2 25.374999999999996 20.325 7 13.625000000000002 22.575 44.425 19.375 8 18.275 21.2 31.15 29.375 9 18.65 22.400000000000002 32.675 26.275 10-14 19.425 28.925 26.93 24.72 15-19 19.805 28.165000000000003 27.61 24.42 20-24 20.575 27.85 27.58 23.995 25-29 19.62 28.43 28.18 23.77 30-34 19.805 28.084999999999997 27.915 24.195 35-39 20.61 27.450000000000003 27.860000000000003 24.08 40-44 19.689999999999998 28.575 27.46 24.275 45-49 20.064999999999998 28.355000000000004 27.115000000000002 24.465 50-54 20.165 27.79 27.855 24.19 55-59 20.465 28.09 27.675 23.77 60-64 20.075000000000003 27.845 27.735 24.345 65-69 20.45 28.115000000000002 27.265 24.169999999999998 70-74 20.125 27.944999999999997 27.384999999999998 24.545 75-79 19.595000000000002 28.235 27.52 24.65 80-84 20.025000000000002 28.549999999999997 27.265 24.16 85-89 20.380000000000003 28.765 27.055 23.799999999999997 90-94 20.71 28.444999999999997 27.405 23.44 95-99 20.655 28.37 27.21 23.765 100-104 20.990000000000002 27.755000000000003 27.450000000000003 23.805 105-109 21.135 27.61 27.43 23.825 110-114 21.175 28.03 27.35 23.445 115-119 21.135 27.98 27.150000000000002 23.735 120-124 21.279999999999998 27.565 27.27 23.885 125-129 21.185000000000002 28.144999999999996 27.02 23.65 130-134 20.93 28.144999999999996 27.495000000000005 23.43 135-139 21.715 28.215 26.605 23.465 140-144 21.775 27.51 26.495 24.22 145-149 21.224999999999998 28.315 26.724999999999998 23.735 150-151 22.162499999999998 27.237499999999997 26.337500000000002 24.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.5 19 1.5 20 0.0 21 0.0 22 0.0 23 1.0 24 2.5 25 2.0 26 5.5 27 7.5 28 8.5 29 11.5 30 15.5 31 20.5 32 24.5 33 40.0 34 53.0 35 64.0 36 83.0 37 109.5 38 135.0 39 151.0 40 176.0 41 208.0 42 224.5 43 243.5 44 271.5 45 265.0 46 262.0 47 267.5 48 234.5 49 215.0 50 187.5 51 135.5 52 111.0 53 103.0 54 92.0 55 73.0 56 56.5 57 40.0 58 25.5 59 20.5 60 14.5 61 10.5 62 8.0 63 4.5 64 2.5 65 2.0 66 2.0 67 1.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 93.35298847493969 87.075 2 6.191369606003752 11.55 3 0.40203698740284105 1.125 4 0.0 0.0 5 0.05360493165371214 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.037500000000000006 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5375 0.0 0.0 0.0 0.0 102-103 0.5874999999999999 0.0 0.0 0.0 0.0 104-105 0.7250000000000001 0.0 0.0 0.0 0.0 106-107 0.8875 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.1124999999999998 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.4125 0.0 0.0 0.0 0.0 116-117 1.5125 0.0 0.0 0.0 0.0 118-119 1.55 0.0 0.0 0.0 0.0 120-121 1.675 0.0 0.0 0.0 0.0 122-123 1.9 0.0 0.0 0.0 0.0 124-125 2.2375 0.0 0.0 0.0 0.0 126-127 2.425 0.0 0.0 0.0 0.0 128-129 2.6625 0.0 0.0 0.0 0.0 130-131 2.9375 0.0 0.0 0.0 0.0 132-133 3.2375 0.0 0.0 0.0 0.0 134-135 3.5250000000000004 0.0 0.0 0.0 0.0 136-137 3.7875 0.0 0.0 0.0 0.0 138-139 4.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGATG 25 8.7132835E-4 87.0 2 TGATGAT 40 0.005621335 54.375 1 >>END_MODULE SRR12671707 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671707_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1795 37.0 37.0 37.0 37.0 37.0 2 36.058 37.0 37.0 37.0 37.0 37.0 3 36.126 37.0 37.0 37.0 37.0 37.0 4 36.076 37.0 37.0 37.0 37.0 37.0 5 36.181 37.0 37.0 37.0 37.0 37.0 6 36.205 37.0 37.0 37.0 37.0 37.0 7 36.2705 37.0 37.0 37.0 37.0 37.0 8 36.291 37.0 37.0 37.0 37.0 37.0 9 36.2615 37.0 37.0 37.0 37.0 37.0 10-14 36.263400000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.2522 37.0 37.0 37.0 37.0 37.0 20-24 36.193999999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.168400000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.1339 37.0 37.0 37.0 37.0 37.0 35-39 36.149699999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.103300000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.0903 37.0 37.0 37.0 37.0 37.0 50-54 36.0458 37.0 37.0 37.0 37.0 37.0 55-59 36.03009999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.927099999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.985499999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.9892 37.0 37.0 37.0 37.0 37.0 75-79 35.8984 37.0 37.0 37.0 37.0 37.0 80-84 35.92190000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.862899999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.808299999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.8507 37.0 37.0 37.0 37.0 37.0 100-104 35.8463 37.0 37.0 37.0 37.0 37.0 105-109 35.7502 37.0 37.0 37.0 37.0 37.0 110-114 35.7102 37.0 37.0 37.0 37.0 37.0 115-119 35.769400000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.6315 37.0 37.0 37.0 37.0 37.0 125-129 35.5933 37.0 37.0 37.0 37.0 37.0 130-134 35.6307 37.0 37.0 37.0 37.0 37.0 135-139 35.5274 37.0 37.0 37.0 37.0 37.0 140-144 35.296800000000005 37.0 37.0 37.0 32.2 37.0 145-149 35.413799999999995 37.0 37.0 37.0 34.6 37.0 150-151 34.94825 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 1.0 15 0.0 16 0.0 17 2.0 18 0.0 19 1.0 20 1.0 21 0.0 22 4.0 23 2.0 24 6.0 25 10.0 26 9.0 27 14.0 28 16.0 29 18.0 30 37.0 31 35.0 32 69.0 33 105.0 34 192.0 35 554.0 36 2718.0 37 204.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.300000000000004 17.974999999999998 14.325 34.4 2 24.275 24.6 35.75 15.375 3 19.475 27.025 32.2 21.3 4 22.8 33.675 23.599999999999998 19.925 5 25.2 35.75 22.6 16.45 6 17.849999999999998 38.425 23.175 20.549999999999997 7 17.925 17.325 41.85 22.900000000000002 8 19.7 23.974999999999998 28.075 28.249999999999996 9 22.95 22.85 28.7 25.5 10-14 22.814999999999998 28.74 26.279999999999998 22.165000000000003 15-19 22.895 28.050000000000004 27.325 21.73 20-24 22.45 28.02 27.744999999999997 21.785 25-29 22.405 28.1 27.865000000000002 21.63 30-34 22.96 28.244999999999997 27.66 21.135 35-39 22.759999999999998 27.605 27.42 22.215 40-44 22.985 28.294999999999998 27.195000000000004 21.525 45-49 22.189999999999998 28.15 27.794999999999998 21.865000000000002 50-54 22.935 28.13 27.55 21.385 55-59 22.86 27.439999999999998 27.87 21.83 60-64 22.165000000000003 27.24 27.675 22.919999999999998 65-69 22.74 28.105000000000004 27.405 21.75 70-74 22.605 27.165 27.685 22.545 75-79 22.91 27.284999999999997 27.339999999999996 22.465 80-84 23.02 27.405 27.105 22.470000000000002 85-89 23.745 27.534999999999997 27.305 21.415 90-94 23.294999999999998 27.665 26.97 22.07 95-99 23.395 27.279999999999998 27.775 21.55 100-104 23.195 27.51 27.639999999999997 21.654999999999998 105-109 23.380000000000003 26.905 27.689999999999998 22.025 110-114 23.655 28.255000000000003 26.645000000000003 21.445 115-119 24.104999999999997 27.46 26.72 21.715 120-124 24.005000000000003 27.685 27.08 21.23 125-129 24.36 28.005000000000003 26.705000000000002 20.93 130-134 24.355 27.810000000000002 26.240000000000002 21.595 135-139 24.59 28.04 26.484999999999996 20.885 140-144 24.04 27.884999999999998 27.084999999999997 20.990000000000002 145-149 25.185000000000002 27.445000000000004 27.115000000000002 20.255000000000003 150-151 25.95 27.725 26.3 20.025000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.5 24 2.0 25 3.0 26 4.0 27 4.5 28 8.0 29 10.5 30 10.0 31 13.5 32 23.0 33 26.5 34 38.0 35 55.0 36 72.5 37 94.5 38 127.0 39 162.5 40 195.5 41 222.0 42 242.5 43 254.5 44 276.5 45 294.5 46 274.5 47 232.5 48 216.0 49 215.5 50 177.0 51 130.5 52 113.5 53 106.5 54 80.5 55 67.0 56 53.5 57 39.5 58 37.0 59 33.0 60 25.0 61 14.0 62 10.5 63 10.5 64 5.0 65 1.5 66 1.0 67 1.0 68 1.5 69 1.0 70 0.5 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.5907750067042 87.25 2 5.819254491820863 10.85 3 0.4022526146419952 1.125 4 0.13408420488066505 0.5 5 0.026816840976133013 0.125 6 0.026816840976133013 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 6 0.15 No Hit TCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.07500000000000001 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.5375000000000001 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.8375 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.1749999999999998 0.0 0.0 0.0 0.0 114-115 1.3625 0.0 0.0 0.0 0.0 116-117 1.4625 0.0 0.0 0.0 0.0 118-119 1.525 0.0 0.0 0.0 0.0 120-121 1.675 0.0 0.0 0.0 0.0 122-123 1.9249999999999998 0.0 0.0 0.0 0.0 124-125 2.2625 0.0 0.0 0.0 0.0 126-127 2.45 0.0 0.0 0.0 0.0 128-129 2.6875 0.0 0.0 0.0 0.0 130-131 2.9875 0.0 0.0 0.0 0.0 132-133 3.2625 0.0 0.0 0.0 0.0 134-135 3.5875 0.0 0.0 0.0 0.0 136-137 3.8499999999999996 0.0 0.0 0.0 0.0 138-139 4.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAACCT 10 0.006830828 145.0 8 >>END_MODULE Read 1022930 spots for SRR12671707.sra Written 1022930 spots for SRR12671707.sra Read 1022930 spots for SRR12671707.sra Written 1022930 spots for SRR12671707.sra Read 1022930 spots for SRR12671707.sra Written 1022930 spots for SRR12671707.sra Read 1022930 spots for SRR12671707.sra Written 1022930 spots for SRR12671707.sra Read 1022930 spots for SRR12671707.sra Written 1022930 spots for SRR12671707.sra Read 1022930 spots for SRR12671707.sra Written 1022930 spots for SRR12671707.sra Read 1022930 spots for SRR12671707.sra Written 1022930 spots for SRR12671707.sra Read 1022930 spots for SRR12671707.sra Written 1022930 spots for SRR12671707.sra Read 1022930 spots for SRR12671707.sra Written 1022930 spots for SRR12671707.sra Read 1022930 spots for SRR12671707.sra Written 1022930 spots for SRR12671707.sra Read 1022930 spots for SRR12671707.sra Written 1022930 spots for SRR12671707.sra Read 1022930 spots for SRR12671707.sra Written 1022930 spots for SRR12671707.sra Read 1022940 spots for SRR12671707.sra Written 1022940 spots for SRR12671707.sra Read 1022930 spots for SRR12671707.sra Written 1022930 spots for SRR12671707.sra Read 1022930 spots for SRR12671707.sra Written 1022930 spots for SRR12671707.sra Read 1022930 spots for SRR12671707.sra Written 1022930 spots for SRR12671707.sra Read 1022930 spots for SRR12671707.sra Written 1022930 spots for SRR12671707.sra Read 1022930 spots for SRR12671707.sra Written 1022930 spots for SRR12671707.sra Read 1022930 spots for SRR12671707.sra Written 1022930 spots for SRR12671707.sra Read 1022930 spots for SRR12671707.sra Written 1022930 spots for SRR12671707.sra SRR ids: ['SRR12671707.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1snlt9_z SRR12671707.sra spots: 20458610 blocks: [[1, 1022930], [1022931, 2045860], [2045861, 3068790], [3068791, 4091720], [4091721, 5114650], [5114651, 6137580], [6137581, 7160510], [7160511, 8183440], [8183441, 9206370], [9206371, 10229300], [10229301, 11252230], [11252231, 12275160], [12275161, 13298090], [13298091, 14321020], [14321021, 15343950], [15343951, 16366880], [16366881, 17389810], [17389811, 18412740], [18412741, 19435670], [19435671, 20458610]] SRR12671707 file size 6931030 SRR12671707 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671707 SRR12671707_1.fastq SRR12671707_2.fastq Input file: SRR12671707_1.fastq Paired file: SRR12671707_2.fastq trimmed: SRR12671707-trimmed-pair1.fastq, SRR12671707-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:34:38 2025 >> started Wed Feb 12 05:35:01 2025 >> done (23.198s) 20458610 read pairs processed; of these: 13 ( 0.00%) short read pairs filtered out after trimming by size control 1400 ( 0.01%) empty read pairs filtered out after trimming by size control 20457197 (99.99%) read pairs available; of these: 1428564 ( 6.98%) trimmed read pairs available after processing 19028633 (93.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 2 0.00% 22 2 0.00% 23 2 0.00% 24 2 0.00% 25 0 0.00% 26 4 0.00% 27 5 0.00% 28 5 0.00% 29 5 0.00% 30 4 0.00% 31 7 0.00% 32 10 0.00% 33 13 0.00% 34 7 0.00% 35 7 0.00% 36 13 0.00% 37 13 0.00% 38 19 0.00% 39 19 0.00% 40 19 0.00% 41 32 0.00% 42 21 0.00% 43 32 0.00% 44 29 0.00% 45 31 0.00% 46 41 0.00% 47 46 0.00% 48 41 0.00% 49 55 0.00% 50 52 0.00% 51 78 0.00% 52 85 0.00% 53 80 0.00% 54 97 0.00% 55 105 0.00% 56 98 0.00% 57 119 0.00% 58 155 0.00% 59 143 0.00% 60 189 0.00% 61 170 0.00% 62 240 0.00% 63 210 0.00% 64 237 0.00% 65 285 0.00% 66 331 0.00% 67 359 0.00% 68 390 0.00% 69 446 0.00% 70 520 0.00% 71 608 0.00% 72 667 0.00% 73 790 0.00% 74 821 0.00% 75 921 0.00% 76 961 0.00% 77 1104 0.01% 78 1229 0.01% 79 1464 0.01% 80 1597 0.01% 81 1792 0.01% 82 1998 0.01% 83 2116 0.01% 84 2427 0.01% 85 2714 0.01% 86 2928 0.01% 87 3242 0.02% 88 3461 0.02% 89 3893 0.02% 90 4192 0.02% 91 4493 0.02% 92 4823 0.02% 93 5278 0.03% 94 5692 0.03% 95 6278 0.03% 96 6602 0.03% 97 6980 0.03% 98 7390 0.04% 99 7664 0.04% 100 8306 0.04% 101 8716 0.04% 102 9470 0.05% 103 9876 0.05% 104 10504 0.05% 105 10970 0.05% 106 11526 0.06% 107 12295 0.06% 108 12771 0.06% 109 13348 0.07% 110 13841 0.07% 111 14698 0.07% 112 15140 0.07% 113 15498 0.08% 114 16367 0.08% 115 17554 0.09% 116 18028 0.09% 117 18899 0.09% 118 19468 0.10% 119 20193 0.10% 120 20882 0.10% 121 21885 0.11% 122 22289 0.11% 123 23731 0.12% 124 24487 0.12% 125 24902 0.12% 126 25756 0.13% 127 26426 0.13% 128 26949 0.13% 129 28098 0.14% 130 29019 0.14% 131 29872 0.15% 132 30955 0.15% 133 32462 0.16% 134 32566 0.16% 135 33770 0.17% 136 34423 0.17% 137 35806 0.18% 138 36286 0.18% 139 37272 0.18% 140 37601 0.18% 141 38944 0.19% 142 39841 0.19% 143 40890 0.20% 144 43406 0.21% 145 43870 0.21% 146 44674 0.22% 147 45375 0.22% 148 46090 0.23% 149 45931 0.22% 150 47637 0.23% 151 19028633 93.02% 20457197 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=14 prefix-density=0.60 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=21 fanout-score=73.84 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.2 sequence=CAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=18 prefix-density=0.76 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.26 sequence-density-rank=16 fanout-score=8.28 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=4.9 sequence=AAGAAAGCTTACCCTAAC SRR12671707 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:35:44 Started mapping on | Feb 12 05:35:44 Finished on | Feb 12 05:37:48 Mapping speed, Million of reads per hour | 593.92 Number of input reads | 20457197 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 19445264 Uniquely mapped reads % | 95.05% Average mapped length | 297.79 Number of splices: Total | 20318179 Number of splices: Annotated (sjdb) | 19899733 Number of splices: GT/AG | 19919608 Number of splices: GC/AG | 332096 Number of splices: AT/AC | 11208 Number of splices: Non-canonical | 55267 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 467682 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 102029 % of reads mapped to too many loci | 0.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.03% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 544251 544251 544251 N_multimapping 467682 467682 467682 N_noFeature 632869 19121917 726841 N_ambiguous 346513 1349 116464 UnstrandedReadsAssigned:18465882 PositiveStrandReadsAssigned:321998 NegativeStrandReadsAssigned:18601959 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671707 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671707-trimmed-pair1.fastq SRR12671707-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,457,197 reads, 18,549,660 reads pseudoaligned [quant] estimated average fragment length: 280.945 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52401 SRR12671707.ke.tsv 34699 SRR12671707.se.tsv 87100 total ==> SRR12671707.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1738.06 619 16.2828 Potri.005G024800.1.v4.1 1035 755.055 270 16.3489 Potri.004G059700.1.v4.1 961 681.36 6 0.402604 Potri.007G009000.2.v4.1 1416 1136.06 0 0 Potri.003G141000.2.v4.1 2943 2663.06 1001 17.1853 Potri.016G087400.1.v4.1 270 77.0757 864 512.506 Potri.015G069301.1.v4.1 564 302.741 0 0 Potri.010G195200.1.v4.1 1773 1493.06 66 2.02102 Potri.012G127500.1.v4.1 977 697.225 96 6.29509 ==> SRR12671707.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 253 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 230 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR12671707 completed mapping pipeline successfully