Starting /dee2/code/volunteer_pipeline.sh SRR12671708 current disk space = 3048928948224 free memory = 1581441896 SRR12671708 SRAfilesize 2d684ea4ee9a5752aa784d218590ada1 SRR12671708.sra SRR12671708.sra file validated SRR12671708 is paired end SRR12671708 is conventional basespace SRR12671708 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671708_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.391 37.0 37.0 37.0 37.0 37.0 2 36.1925 37.0 37.0 37.0 37.0 37.0 3 36.531 37.0 37.0 37.0 37.0 37.0 4 36.4655 37.0 37.0 37.0 37.0 37.0 5 36.451 37.0 37.0 37.0 37.0 37.0 6 36.4655 37.0 37.0 37.0 37.0 37.0 7 36.4905 37.0 37.0 37.0 37.0 37.0 8 36.5905 37.0 37.0 37.0 37.0 37.0 9 36.532 37.0 37.0 37.0 37.0 37.0 10-14 36.532 37.0 37.0 37.0 37.0 37.0 15-19 36.4898 37.0 37.0 37.0 37.0 37.0 20-24 36.4982 37.0 37.0 37.0 37.0 37.0 25-29 36.459199999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.457300000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.4193 37.0 37.0 37.0 37.0 37.0 40-44 36.3947 37.0 37.0 37.0 37.0 37.0 45-49 36.39119999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.3745 37.0 37.0 37.0 37.0 37.0 55-59 36.3458 37.0 37.0 37.0 37.0 37.0 60-64 36.351800000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.3138 37.0 37.0 37.0 37.0 37.0 70-74 36.297399999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.2473 37.0 37.0 37.0 37.0 37.0 80-84 36.242999999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.224399999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.208600000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.1115 37.0 37.0 37.0 37.0 37.0 100-104 36.2419 37.0 37.0 37.0 37.0 37.0 105-109 36.0937 37.0 37.0 37.0 37.0 37.0 110-114 36.11409999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.0588 37.0 37.0 37.0 37.0 37.0 120-124 36.027699999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.993399999999994 37.0 37.0 37.0 37.0 37.0 130-134 36.0159 37.0 37.0 37.0 37.0 37.0 135-139 35.972 37.0 37.0 37.0 37.0 37.0 140-144 35.906400000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.7741 37.0 37.0 37.0 37.0 37.0 150-151 35.352999999999994 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 5.0 26 0.0 27 11.0 28 9.0 29 28.0 30 32.0 31 39.0 32 45.0 33 83.0 34 119.0 35 301.0 36 2956.0 37 372.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.325000000000003 14.799999999999999 9.875 45.0 2 18.50551654964895 20.260782347041122 40.972918756268804 20.260782347041122 3 17.575 25.650000000000002 28.025 28.749999999999996 4 22.875 33.800000000000004 22.75 20.575 5 20.1 36.4 24.725 18.775 6 16.400000000000002 35.449999999999996 26.974999999999998 21.175 7 13.675 21.475 45.775 19.075 8 17.549999999999997 21.75 30.975 29.725 9 18.0 21.224999999999998 33.550000000000004 27.224999999999998 10-14 19.105 29.075 27.12 24.7 15-19 19.74 27.900000000000002 28.139999999999997 24.22 20-24 19.98 28.744999999999997 27.52 23.755000000000003 25-29 19.689999999999998 28.54 27.575 24.195 30-34 19.66 28.605000000000004 27.665 24.07 35-39 20.315 27.700000000000003 27.865000000000002 24.12 40-44 20.294999999999998 28.395 27.700000000000003 23.61 45-49 19.965 28.435 27.325 24.275 50-54 20.25 28.215 27.67 23.865 55-59 20.395 27.855 28.194999999999997 23.555 60-64 20.27 28.155 27.675 23.9 65-69 20.235 28.144999999999996 27.98 23.64 70-74 20.035 28.315 27.99 23.66 75-79 20.145 27.694999999999997 28.335 23.825 80-84 20.84 27.839999999999996 27.794999999999998 23.525 85-89 20.28 28.105000000000004 27.74 23.875 90-94 19.744999999999997 28.155 28.105000000000004 23.995 95-99 19.975 28.000000000000004 28.235 23.79 100-104 20.635 28.15 27.32 23.895 105-109 21.21 28.7 26.47 23.62 110-114 20.79 28.470000000000002 27.279999999999998 23.46 115-119 21.52 27.534999999999997 27.495000000000005 23.45 120-124 20.755000000000003 28.38 27.045 23.82 125-129 20.765 28.18 27.055 24.0 130-134 21.21 28.025 26.924999999999997 23.84 135-139 20.785 28.595 26.83 23.79 140-144 20.830000000000002 27.925 27.255000000000003 23.990000000000002 145-149 21.165 28.134999999999998 27.145000000000003 23.555 150-151 21.224999999999998 26.950000000000003 27.400000000000002 24.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.0 23 2.0 24 3.0 25 2.5 26 3.0 27 8.0 28 10.0 29 11.0 30 18.5 31 22.5 32 33.0 33 46.5 34 61.0 35 78.0 36 91.5 37 114.0 38 141.0 39 161.0 40 186.5 41 218.0 42 252.5 43 259.0 44 250.5 45 264.0 46 262.0 47 261.0 48 238.5 49 195.0 50 164.5 51 126.5 52 102.5 53 88.5 54 73.5 55 60.5 56 47.5 57 39.0 58 29.0 59 20.5 60 13.5 61 8.5 62 9.0 63 7.5 64 4.5 65 2.5 66 2.0 67 2.0 68 1.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.37814903208698 88.97500000000001 2 5.197560328825245 9.8 3 0.3977724741447892 1.125 4 0.026518164942985947 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.32499999999999996 0.025 0.0 0.0 0.0 102-103 0.475 0.025 0.0 0.0 0.0 104-105 0.5125 0.025 0.0 0.0 0.0 106-107 0.6 0.025 0.0 0.0 0.0 108-109 0.825 0.025 0.0 0.0 0.0 110-111 1.0 0.025 0.0 0.0 0.0 112-113 1.175 0.025 0.0 0.0 0.0 114-115 1.375 0.025 0.0 0.0 0.0 116-117 1.575 0.025 0.0 0.0 0.0 118-119 1.7875 0.025 0.0 0.0 0.0 120-121 1.95 0.025 0.0 0.0 0.0 122-123 2.1375 0.025 0.0 0.0 0.0 124-125 2.375 0.025 0.0 0.0 0.0 126-127 2.625 0.025 0.0 0.0 0.0 128-129 2.825 0.025 0.0 0.0 0.0 130-131 3.0875 0.025 0.0 0.0 0.0 132-133 3.3 0.025 0.0 0.0 0.0 134-135 3.7125 0.025 0.0 0.0 0.0 136-137 3.9875 0.025 0.0 0.0 0.0 138-139 4.45 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCGGGA 10 0.006830828 145.0 9 >>END_MODULE SRR12671708 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671708_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.264 37.0 37.0 37.0 37.0 37.0 2 35.9685 37.0 37.0 37.0 37.0 37.0 3 36.0695 37.0 37.0 37.0 37.0 37.0 4 36.0685 37.0 37.0 37.0 37.0 37.0 5 36.1685 37.0 37.0 37.0 37.0 37.0 6 36.0725 37.0 37.0 37.0 37.0 37.0 7 36.173 37.0 37.0 37.0 37.0 37.0 8 36.2295 37.0 37.0 37.0 37.0 37.0 9 36.096 37.0 37.0 37.0 37.0 37.0 10-14 36.2096 37.0 37.0 37.0 37.0 37.0 15-19 36.1203 37.0 37.0 37.0 37.0 37.0 20-24 36.0938 37.0 37.0 37.0 37.0 37.0 25-29 36.0255 37.0 37.0 37.0 37.0 37.0 30-34 36.1044 37.0 37.0 37.0 37.0 37.0 35-39 36.0462 37.0 37.0 37.0 37.0 37.0 40-44 36.013400000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.9567 37.0 37.0 37.0 37.0 37.0 50-54 35.978100000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.841899999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.8922 37.0 37.0 37.0 37.0 37.0 65-69 35.8554 37.0 37.0 37.0 37.0 37.0 70-74 35.8732 37.0 37.0 37.0 37.0 37.0 75-79 35.8664 37.0 37.0 37.0 37.0 37.0 80-84 35.81850000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.7562 37.0 37.0 37.0 37.0 37.0 90-94 35.7716 37.0 37.0 37.0 37.0 37.0 95-99 35.7646 37.0 37.0 37.0 37.0 37.0 100-104 35.6735 37.0 37.0 37.0 37.0 37.0 105-109 35.71040000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.5963 37.0 37.0 37.0 37.0 37.0 115-119 35.5646 37.0 37.0 37.0 37.0 37.0 120-124 35.571000000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.4259 37.0 37.0 37.0 37.0 37.0 130-134 35.4465 37.0 37.0 37.0 37.0 37.0 135-139 35.4597 37.0 37.0 37.0 34.6 37.0 140-144 35.2258 37.0 37.0 37.0 32.2 37.0 145-149 35.242599999999996 37.0 37.0 37.0 32.2 37.0 150-151 34.95325 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 1.0 15 1.0 16 0.0 17 2.0 18 0.0 19 0.0 20 0.0 21 4.0 22 5.0 23 3.0 24 9.0 25 6.0 26 13.0 27 15.0 28 14.0 29 27.0 30 33.0 31 46.0 32 66.0 33 123.0 34 234.0 35 607.0 36 2585.0 37 202.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.25 17.65 14.45 32.65 2 23.3 24.525 36.95 15.225 3 19.975 26.650000000000002 31.45 21.925 4 22.125 35.925000000000004 22.2 19.75 5 23.150000000000002 37.075 21.625 18.15 6 17.825 37.824999999999996 23.974999999999998 20.375 7 16.775000000000002 16.650000000000002 44.1 22.475 8 20.200000000000003 24.05 27.650000000000002 28.1 9 21.675 22.8 30.349999999999998 25.174999999999997 10-14 22.525000000000002 28.055000000000003 27.18 22.24 15-19 22.525000000000002 27.725 28.215 21.535 20-24 22.52 28.345 27.765 21.37 25-29 22.884999999999998 28.105000000000004 27.855 21.154999999999998 30-34 22.325 28.055000000000003 27.939999999999998 21.68 35-39 22.285 28.525 27.925 21.265 40-44 22.795 27.775 27.965 21.465 45-49 22.425 27.779999999999998 28.33 21.465 50-54 22.264999999999997 27.825 28.349999999999998 21.560000000000002 55-59 22.89 27.084999999999997 28.415000000000003 21.61 60-64 23.095 27.084999999999997 28.16 21.66 65-69 22.46 27.634999999999998 28.1 21.805 70-74 23.080000000000002 27.615000000000002 27.534999999999997 21.77 75-79 23.3 27.405 27.66 21.634999999999998 80-84 22.68 27.42 27.875 22.025 85-89 23.175 27.544999999999998 27.495000000000005 21.785 90-94 22.814999999999998 27.465 28.389999999999997 21.33 95-99 23.369999999999997 27.224999999999998 27.884999999999998 21.52 100-104 23.415 28.24 27.27 21.075 105-109 23.895 27.845 27.345000000000002 20.915 110-114 23.02 28.64 26.965 21.375 115-119 23.43 27.675 27.310000000000002 21.584999999999997 120-124 23.345 28.139999999999997 27.38 21.135 125-129 23.5 27.62 27.595 21.285 130-134 24.104999999999997 27.35 27.91 20.635 135-139 25.014999999999997 27.91 26.755000000000003 20.32 140-144 24.59 28.060000000000002 27.334999999999997 20.015 145-149 24.675 28.28 26.44 20.605 150-151 25.362499999999997 28.249999999999996 25.85 20.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 0.5 24 2.0 25 4.0 26 5.0 27 7.5 28 13.0 29 13.0 30 9.5 31 16.5 32 23.5 33 37.0 34 41.5 35 54.5 36 79.5 37 113.0 38 142.0 39 172.5 40 209.0 41 238.5 42 252.5 43 256.0 44 274.0 45 259.5 46 250.5 47 241.5 48 215.0 49 192.5 50 173.5 51 137.5 52 102.5 53 89.0 54 79.5 55 61.5 56 44.0 57 40.5 58 28.0 59 23.5 60 30.0 61 24.5 62 13.5 63 9.5 64 5.0 65 2.0 66 1.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.825 #Duplication Level Percentage of deduplicated Percentage of total 1 94.21795896616041 88.4 2 5.1958433253397285 9.75 3 0.4796163069544364 1.35 4 0.07993605115907274 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02664535038635758 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.32499999999999996 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 0.9874999999999999 0.0 0.0 0.0 0.0 112-113 1.15 0.0 0.0 0.0 0.0 114-115 1.375 0.0 0.0 0.0 0.0 116-117 1.55 0.0 0.0 0.0 0.0 118-119 1.7374999999999998 0.0 0.0 0.0 0.0 120-121 1.9 0.0 0.0 0.0 0.0 122-123 2.1125 0.0 0.0 0.0 0.0 124-125 2.3625 0.0 0.0 0.0 0.0 126-127 2.5999999999999996 0.0 0.0 0.0 0.0 128-129 2.775 0.0 0.0 0.0 0.0 130-131 3.05 0.0 0.0 0.0 0.0 132-133 3.3 0.0 0.0 0.0 0.0 134-135 3.7375 0.0 0.0 0.0 0.0 136-137 4.012499999999999 0.0 0.0 0.0 0.0 138-139 4.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 983870 spots for SRR12671708.sra Written 983870 spots for SRR12671708.sra Read 983870 spots for SRR12671708.sra Written 983870 spots for SRR12671708.sra Read 983870 spots for SRR12671708.sra Written 983870 spots for SRR12671708.sra Read 983870 spots for SRR12671708.sra Written 983870 spots for SRR12671708.sra Read 983870 spots for SRR12671708.sra Written 983870 spots for SRR12671708.sra Read 983870 spots for SRR12671708.sra Written 983870 spots for SRR12671708.sra Read 983870 spots for SRR12671708.sra Written 983870 spots for SRR12671708.sra Read 983870 spots for SRR12671708.sra Written 983870 spots for SRR12671708.sra Read 983870 spots for SRR12671708.sra Written 983870 spots for SRR12671708.sra Read 983870 spots for SRR12671708.sra Written 983870 spots for SRR12671708.sra Read 983870 spots for SRR12671708.sra Written 983870 spots for SRR12671708.sra Read 983870 spots for SRR12671708.sra Written 983870 spots for SRR12671708.sra Read 983870 spots for SRR12671708.sra Written 983870 spots for SRR12671708.sra Read 983870 spots for SRR12671708.sra Written 983870 spots for SRR12671708.sra Read 983870 spots for SRR12671708.sra Written 983870 spots for SRR12671708.sra Read 983870 spots for SRR12671708.sra Written 983870 spots for SRR12671708.sra Read 983870 spots for SRR12671708.sra Written 983870 spots for SRR12671708.sra Read 983870 spots for SRR12671708.sra Written 983870 spots for SRR12671708.sra Read 983887 spots for SRR12671708.sra Written 983887 spots for SRR12671708.sra Read 983870 spots for SRR12671708.sra Written 983870 spots for SRR12671708.sra SRR ids: ['SRR12671708.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8da0hhjj SRR12671708.sra spots: 19677417 blocks: [[1, 983870], [983871, 1967740], [1967741, 2951610], [2951611, 3935480], [3935481, 4919350], [4919351, 5903220], [5903221, 6887090], [6887091, 7870960], [7870961, 8854830], [8854831, 9838700], [9838701, 10822570], [10822571, 11806440], [11806441, 12790310], [12790311, 13774180], [13774181, 14758050], [14758051, 15741920], [15741921, 16725790], [16725791, 17709660], [17709661, 18693530], [18693531, 19677417]] SRR12671708 file size 6665546 SRR12671708 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671708 SRR12671708_1.fastq SRR12671708_2.fastq Input file: SRR12671708_1.fastq Paired file: SRR12671708_2.fastq trimmed: SRR12671708-trimmed-pair1.fastq, SRR12671708-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:26:40 2025 >> started Wed Feb 12 05:27:06 2025 >> done (26.357s) 19677417 read pairs processed; of these: 7 ( 0.00%) short read pairs filtered out after trimming by size control 1098 ( 0.01%) empty read pairs filtered out after trimming by size control 19676312 (99.99%) read pairs available; of these: 1428836 ( 7.26%) trimmed read pairs available after processing 18247476 (92.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 4 0.00% 21 1 0.00% 22 6 0.00% 23 2 0.00% 24 4 0.00% 25 3 0.00% 26 9 0.00% 27 2 0.00% 28 9 0.00% 29 7 0.00% 30 4 0.00% 31 4 0.00% 32 5 0.00% 33 11 0.00% 34 7 0.00% 35 8 0.00% 36 3 0.00% 37 17 0.00% 38 25 0.00% 39 24 0.00% 40 20 0.00% 41 22 0.00% 42 21 0.00% 43 38 0.00% 44 19 0.00% 45 31 0.00% 46 29 0.00% 47 28 0.00% 48 66 0.00% 49 44 0.00% 50 52 0.00% 51 64 0.00% 52 70 0.00% 53 59 0.00% 54 59 0.00% 55 65 0.00% 56 71 0.00% 57 105 0.00% 58 96 0.00% 59 102 0.00% 60 142 0.00% 61 133 0.00% 62 181 0.00% 63 185 0.00% 64 208 0.00% 65 245 0.00% 66 237 0.00% 67 294 0.00% 68 318 0.00% 69 376 0.00% 70 451 0.00% 71 493 0.00% 72 556 0.00% 73 619 0.00% 74 707 0.00% 75 781 0.00% 76 910 0.00% 77 914 0.00% 78 1104 0.01% 79 1163 0.01% 80 1290 0.01% 81 1570 0.01% 82 1752 0.01% 83 1908 0.01% 84 2167 0.01% 85 2416 0.01% 86 2663 0.01% 87 2741 0.01% 88 3119 0.02% 89 3372 0.02% 90 3649 0.02% 91 4103 0.02% 92 4404 0.02% 93 5087 0.03% 94 5452 0.03% 95 6077 0.03% 96 6463 0.03% 97 6800 0.03% 98 7084 0.04% 99 7514 0.04% 100 8084 0.04% 101 8898 0.05% 102 9478 0.05% 103 10131 0.05% 104 10696 0.05% 105 11317 0.06% 106 12085 0.06% 107 12535 0.06% 108 12818 0.07% 109 13437 0.07% 110 14153 0.07% 111 14926 0.08% 112 15500 0.08% 113 16404 0.08% 114 17054 0.09% 115 18149 0.09% 116 18694 0.10% 117 19517 0.10% 118 20255 0.10% 119 20811 0.11% 120 21503 0.11% 121 22527 0.11% 122 22981 0.12% 123 24119 0.12% 124 25051 0.13% 125 25893 0.13% 126 26959 0.14% 127 27297 0.14% 128 28413 0.14% 129 28693 0.15% 130 29328 0.15% 131 30217 0.15% 132 31311 0.16% 133 33006 0.17% 134 33124 0.17% 135 34681 0.18% 136 34542 0.18% 137 35663 0.18% 138 36230 0.18% 139 37429 0.19% 140 37666 0.19% 141 38183 0.19% 142 39647 0.20% 143 40271 0.20% 144 42437 0.22% 145 42997 0.22% 146 43402 0.22% 147 43936 0.22% 148 45081 0.23% 149 45166 0.23% 150 45272 0.23% 151 18247476 92.74% 19676312 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=20 prefix-density=0.42 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=23 fanout-score=37.58 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=9.2 sequence=CCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCA criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=33 prefix-density=0.58 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=64.93 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.9 sequence=AAACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATTTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGTATGCTTTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR12671708 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:27:51 Started mapping on | Feb 12 05:27:51 Finished on | Feb 12 05:30:01 Mapping speed, Million of reads per hour | 544.88 Number of input reads | 19676312 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 18440010 Uniquely mapped reads % | 93.72% Average mapped length | 297.50 Number of splices: Total | 18883593 Number of splices: Annotated (sjdb) | 18484072 Number of splices: GT/AG | 18508458 Number of splices: GC/AG | 307035 Number of splices: AT/AC | 11801 Number of splices: Non-canonical | 56299 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 482789 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 269017 % of reads mapped to too many loci | 1.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.22% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 753513 753513 753513 N_multimapping 482789 482789 482789 N_noFeature 716223 18167193 807027 N_ambiguous 314503 1472 131663 UnstrandedReadsAssigned:17409284 PositiveStrandReadsAssigned:271345 NegativeStrandReadsAssigned:17501320 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671708 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671708-trimmed-pair1.fastq SRR12671708-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,676,312 reads, 17,582,903 reads pseudoaligned [quant] estimated average fragment length: 292.326 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52401 SRR12671708.ke.tsv 34699 SRR12671708.se.tsv 87100 total ==> SRR12671708.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1726.67 960 29.4271 Potri.005G024800.1.v4.1 1035 743.674 295 20.9955 Potri.004G059700.1.v4.1 961 670.241 6 0.473812 Potri.007G009000.2.v4.1 1416 1124.67 0 0 Potri.003G141000.2.v4.1 2943 2651.67 848.395 16.9342 Potri.016G087400.1.v4.1 270 79.225 703 469.655 Potri.015G069301.1.v4.1 564 299.97 0 0 Potri.010G195200.1.v4.1 1773 1481.67 95 3.39357 Potri.012G127500.1.v4.1 977 685.981 132 10.1847 ==> SRR12671708.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 165 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 226 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12671708 completed mapping pipeline successfully