Starting /dee2/code/volunteer_pipeline.sh SRR12671709 current disk space = 3048956592128 free memory = 1405841728 SRR12671709 SRAfilesize 6cc7a3b768836d670b78770c479be0e7 SRR12671709.sra SRR12671709.sra file validated SRR12671709 is paired end SRR12671709 is conventional basespace SRR12671709 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671709_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.382 37.0 37.0 37.0 37.0 37.0 2 36.16125 37.0 37.0 37.0 37.0 37.0 3 36.5585 37.0 37.0 37.0 37.0 37.0 4 36.541 37.0 37.0 37.0 37.0 37.0 5 36.5145 37.0 37.0 37.0 37.0 37.0 6 36.5175 37.0 37.0 37.0 37.0 37.0 7 36.5175 37.0 37.0 37.0 37.0 37.0 8 36.529 37.0 37.0 37.0 37.0 37.0 9 36.506 37.0 37.0 37.0 37.0 37.0 10-14 36.5685 37.0 37.0 37.0 37.0 37.0 15-19 36.563900000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.4919 37.0 37.0 37.0 37.0 37.0 25-29 36.471700000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.4461 37.0 37.0 37.0 37.0 37.0 35-39 36.428000000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.430600000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.3882 37.0 37.0 37.0 37.0 37.0 50-54 36.373799999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.363299999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.386300000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.319599999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.346900000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.2799 37.0 37.0 37.0 37.0 37.0 80-84 36.2983 37.0 37.0 37.0 37.0 37.0 85-89 36.2848 37.0 37.0 37.0 37.0 37.0 90-94 36.2412 37.0 37.0 37.0 37.0 37.0 95-99 36.1765 37.0 37.0 37.0 37.0 37.0 100-104 36.2344 37.0 37.0 37.0 37.0 37.0 105-109 36.1378 37.0 37.0 37.0 37.0 37.0 110-114 36.157300000000006 37.0 37.0 37.0 37.0 37.0 115-119 36.21320000000001 37.0 37.0 37.0 37.0 37.0 120-124 36.116200000000006 37.0 37.0 37.0 37.0 37.0 125-129 36.0926 37.0 37.0 37.0 37.0 37.0 130-134 36.0024 37.0 37.0 37.0 37.0 37.0 135-139 35.971199999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.9572 37.0 37.0 37.0 37.0 37.0 145-149 35.9163 37.0 37.0 37.0 37.0 37.0 150-151 35.3945 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 0.0 24 3.0 25 4.0 26 5.0 27 8.0 28 10.0 29 15.0 30 23.0 31 32.0 32 50.0 33 75.0 34 105.0 35 289.0 36 3009.0 37 371.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.5 15.575 9.35 39.574999999999996 2 20.04521477015825 19.341873901029892 40.26626475759859 20.346646571213263 3 17.474999999999998 26.55 28.475 27.500000000000004 4 21.975 33.45 22.375 22.2 5 19.950000000000003 38.75 21.9 19.400000000000002 6 17.275 37.55 26.0 19.175 7 14.649999999999999 22.900000000000002 43.775 18.675 8 17.575 23.35 30.225 28.849999999999998 9 17.7 23.7 32.725 25.874999999999996 10-14 20.02 28.9 27.125 23.955000000000002 15-19 19.74 27.794999999999998 28.015 24.45 20-24 19.98 28.835 27.79 23.395 25-29 19.53 28.860000000000003 27.785 23.825 30-34 20.06 28.660000000000004 28.005000000000003 23.275000000000002 35-39 19.555 28.64 27.605 24.2 40-44 19.85 28.565 28.275 23.31 45-49 19.82 28.15 27.805000000000003 24.224999999999998 50-54 20.095 27.965 27.715 24.224999999999998 55-59 20.75 28.07 27.375 23.805 60-64 19.8 28.625 27.63 23.945 65-69 19.93 28.49 27.284999999999997 24.295 70-74 20.599999999999998 27.744999999999997 27.71 23.945 75-79 19.67 28.7 27.305 24.325 80-84 20.25 27.794999999999998 27.815 24.14 85-89 20.175 28.32 27.905 23.599999999999998 90-94 20.68 27.505000000000003 27.700000000000003 24.115000000000002 95-99 20.4 28.139999999999997 27.93 23.53 100-104 20.265 28.28 27.35 24.104999999999997 105-109 20.375 28.345 27.68 23.599999999999998 110-114 20.630000000000003 27.775 28.16 23.435 115-119 20.335 28.18 27.500000000000004 23.985 120-124 20.82 28.044999999999998 26.76 24.375 125-129 21.315 28.03 26.779999999999998 23.875 130-134 20.03 28.565 27.63 23.775 135-139 21.21 28.715000000000003 27.060000000000002 23.015 140-144 21.01 27.88 27.150000000000002 23.96 145-149 20.585 28.185 27.015 24.215 150-151 22.3 27.9125 26.2125 23.575 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 1.0 21 1.5 22 0.5 23 1.0 24 2.0 25 3.0 26 5.0 27 7.0 28 8.5 29 9.5 30 16.5 31 30.0 32 46.0 33 50.5 34 57.0 35 71.5 36 89.5 37 117.5 38 141.0 39 155.0 40 191.0 41 226.5 42 233.5 43 237.5 44 237.0 45 262.0 46 265.5 47 244.5 48 237.0 49 215.0 50 187.5 51 156.5 52 120.0 53 89.5 54 67.5 55 47.5 56 37.5 57 36.5 58 26.5 59 15.5 60 16.5 61 13.5 62 6.5 63 3.5 64 2.0 65 1.5 66 1.5 67 1.5 68 2.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.475 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.4 #Duplication Level Percentage of deduplicated Percentage of total 1 93.38865096359743 87.225 2 6.183083511777302 11.55 3 0.4014989293361884 1.125 4 0.02676659528907923 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.65 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.8375 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.15 0.0 0.0 0.0 0.0 114-115 1.325 0.0 0.0 0.0 0.0 116-117 1.6124999999999998 0.0 0.0 0.0 0.0 118-119 1.8375 0.0 0.0 0.0 0.0 120-121 2.0375 0.0 0.0 0.0 0.0 122-123 2.175 0.0 0.0 0.0 0.0 124-125 2.35 0.0 0.0 0.0 0.0 126-127 2.55 0.0 0.0 0.0 0.0 128-129 2.7625 0.0 0.0 0.0 0.0 130-131 3.025 0.0 0.0 0.0 0.0 132-133 3.2375 0.0 0.0 0.0 0.0 134-135 3.5125 0.0 0.0 0.0 0.0 136-137 3.875 0.0 0.0 0.0 0.0 138-139 4.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671709 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671709_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9625 37.0 37.0 37.0 37.0 37.0 2 35.89 37.0 37.0 37.0 37.0 37.0 3 36.154 37.0 37.0 37.0 37.0 37.0 4 35.934 37.0 37.0 37.0 37.0 37.0 5 36.0415 37.0 37.0 37.0 37.0 37.0 6 36.0755 37.0 37.0 37.0 37.0 37.0 7 36.0725 37.0 37.0 37.0 37.0 37.0 8 36.269 37.0 37.0 37.0 37.0 37.0 9 36.051 37.0 37.0 37.0 37.0 37.0 10-14 36.1549 37.0 37.0 37.0 37.0 37.0 15-19 36.188900000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.1126 37.0 37.0 37.0 37.0 37.0 25-29 36.0679 37.0 37.0 37.0 37.0 37.0 30-34 36.061400000000006 37.0 37.0 37.0 37.0 37.0 35-39 35.998000000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.0712 37.0 37.0 37.0 37.0 37.0 45-49 35.9985 37.0 37.0 37.0 37.0 37.0 50-54 36.007999999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.9594 37.0 37.0 37.0 37.0 37.0 60-64 35.89970000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.8156 37.0 37.0 37.0 37.0 37.0 70-74 35.89149999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.813900000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.87519999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.765100000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.7384 37.0 37.0 37.0 37.0 37.0 95-99 35.754200000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.7212 37.0 37.0 37.0 37.0 37.0 105-109 35.692400000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.5972 37.0 37.0 37.0 37.0 37.0 115-119 35.5552 37.0 37.0 37.0 37.0 37.0 120-124 35.6481 37.0 37.0 37.0 37.0 37.0 125-129 35.5093 37.0 37.0 37.0 37.0 37.0 130-134 35.5609 37.0 37.0 37.0 37.0 37.0 135-139 35.4641 37.0 37.0 37.0 34.6 37.0 140-144 35.1866 37.0 37.0 37.0 27.4 37.0 145-149 35.31060000000001 37.0 37.0 37.0 32.2 37.0 150-151 34.980000000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 1.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 2.0 23 6.0 24 6.0 25 7.0 26 13.0 27 21.0 28 18.0 29 21.0 30 24.0 31 45.0 32 71.0 33 117.0 34 209.0 35 655.0 36 2612.0 37 164.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.65 18.375 13.0 29.975 2 25.174999999999997 22.575 36.35 15.9 3 19.45 27.750000000000004 33.375 19.425 4 23.525 35.325 22.15 19.0 5 24.224999999999998 36.725 22.15 16.900000000000002 6 20.325 36.675000000000004 23.425 19.575 7 18.9 17.575 42.15 21.375 8 20.150000000000002 23.775 29.725 26.35 9 22.925 24.025 27.775 25.275 10-14 22.650000000000002 29.485 26.665 21.2 15-19 23.055 27.815 28.305000000000003 20.825 20-24 22.805 28.244999999999997 27.944999999999997 21.005 25-29 23.16 28.055000000000003 27.665 21.12 30-34 22.29 28.244999999999997 28.185 21.279999999999998 35-39 22.509999999999998 28.060000000000002 28.005000000000003 21.425 40-44 23.205000000000002 28.12 27.49 21.185000000000002 45-49 22.735 27.985 27.950000000000003 21.33 50-54 23.330000000000002 27.57 27.705000000000002 21.395 55-59 22.455 27.994999999999997 27.91 21.64 60-64 22.8 27.54 28.305000000000003 21.355 65-69 22.78 27.589999999999996 27.565 22.065 70-74 23.335 27.785 27.38 21.5 75-79 22.88 27.675 27.655 21.790000000000003 80-84 23.385 27.875 27.229999999999997 21.51 85-89 22.945 27.584999999999997 27.55 21.92 90-94 23.69 27.47 27.425 21.415 95-99 23.385 27.785 27.775 21.055 100-104 23.54 27.71 28.455000000000002 20.294999999999998 105-109 22.869999999999997 28.465 28.17 20.495 110-114 23.375 28.38 26.845000000000002 21.4 115-119 23.200000000000003 27.744999999999997 27.58 21.475 120-124 23.535 27.785 27.345000000000002 21.335 125-129 24.044999999999998 27.865000000000002 27.400000000000002 20.69 130-134 24.585 28.105000000000004 26.955000000000002 20.355 135-139 24.779999999999998 28.28 27.065 19.875 140-144 24.635 27.060000000000002 27.79 20.515 145-149 24.27 28.005000000000003 26.99 20.735 150-151 24.9375 28.075 26.5625 20.424999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.5 14 1.0 15 1.5 16 1.0 17 0.5 18 1.0 19 1.0 20 2.0 21 2.0 22 2.0 23 1.5 24 3.5 25 5.5 26 4.5 27 4.5 28 5.5 29 9.5 30 18.5 31 19.5 32 21.0 33 34.0 34 47.0 35 62.5 36 90.5 37 115.0 38 138.5 39 160.5 40 187.0 41 227.0 42 241.0 43 261.5 44 263.0 45 257.0 46 258.0 47 230.5 48 209.0 49 192.5 50 174.0 51 150.5 52 126.5 53 100.0 54 82.5 55 68.5 56 48.5 57 36.0 58 26.0 59 18.5 60 17.5 61 17.0 62 16.0 63 10.0 64 5.5 65 5.0 66 2.5 67 2.0 68 1.5 69 1.5 70 2.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.5 #Duplication Level Percentage of deduplicated Percentage of total 1 93.79679144385027 87.7 2 5.561497326203209 10.4 3 0.53475935828877 1.5 4 0.10695187165775401 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.025 0.0 80-81 0.1 0.0 0.0 0.025 0.0 82-83 0.1 0.0 0.0 0.025 0.0 84-85 0.1 0.0 0.0 0.025 0.0 86-87 0.1 0.0 0.0 0.025 0.0 88-89 0.2 0.0 0.0 0.025 0.0 90-91 0.225 0.0 0.0 0.025 0.0 92-93 0.2625 0.0 0.0 0.025 0.0 94-95 0.30000000000000004 0.0 0.0 0.025 0.0 96-97 0.3625 0.0 0.0 0.025 0.0 98-99 0.3875 0.0 0.0 0.025 0.0 100-101 0.42500000000000004 0.0 0.0 0.025 0.0 102-103 0.5625 0.0 0.0 0.025 0.0 104-105 0.7 0.0 0.0 0.025 0.0 106-107 0.775 0.0 0.0 0.025 0.0 108-109 0.8875 0.0 0.0 0.025 0.0 110-111 1.0499999999999998 0.0 0.0 0.025 0.0 112-113 1.25 0.0 0.0 0.025 0.0 114-115 1.425 0.0 0.0 0.025 0.0 116-117 1.7125 0.0 0.0 0.025 0.0 118-119 1.9375 0.0 0.0 0.025 0.0 120-121 2.1375 0.0 0.0 0.025 0.0 122-123 2.275 0.0 0.0 0.025 0.0 124-125 2.45 0.0 0.0 0.025 0.0 126-127 2.6500000000000004 0.0 0.0 0.025 0.0 128-129 2.8625 0.0 0.0 0.025 0.0 130-131 3.125 0.0 0.0 0.025 0.0 132-133 3.3375 0.0 0.0 0.025 0.0 134-135 3.6125 0.0 0.0 0.025 0.0 136-137 3.975 0.0 0.0 0.025 0.0 138-139 4.3625 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACCGAG 10 0.006830828 145.0 9 TTTTTTT 40 0.0076550315 18.125 60-64 >>END_MODULE Read 1123957 spots for SRR12671709.sra Written 1123957 spots for SRR12671709.sra Read 1123946 spots for SRR12671709.sra Written 1123946 spots for SRR12671709.sra Read 1123946 spots for SRR12671709.sra Written 1123946 spots for SRR12671709.sra Read 1123946 spots for SRR12671709.sra Written 1123946 spots for SRR12671709.sra Read 1123946 spots for SRR12671709.sra Written 1123946 spots for SRR12671709.sra Read 1123946 spots for SRR12671709.sra Written 1123946 spots for SRR12671709.sra Read 1123946 spots for SRR12671709.sra Written 1123946 spots for SRR12671709.sra Read 1123946 spots for SRR12671709.sra Written 1123946 spots for SRR12671709.sra Read 1123946 spots for SRR12671709.sra Written 1123946 spots for SRR12671709.sra Read 1123946 spots for SRR12671709.sra Written 1123946 spots for SRR12671709.sra Read 1123946 spots for SRR12671709.sra Written 1123946 spots for SRR12671709.sra Read 1123946 spots for SRR12671709.sra Written 1123946 spots for SRR12671709.sra Read 1123946 spots for SRR12671709.sra Written 1123946 spots for SRR12671709.sra Read 1123946 spots for SRR12671709.sra Written 1123946 spots for SRR12671709.sra Read 1123946 spots for SRR12671709.sra Written 1123946 spots for SRR12671709.sra Read 1123946 spots for SRR12671709.sra Written 1123946 spots for SRR12671709.sra Read 1123946 spots for SRR12671709.sra Written 1123946 spots for SRR12671709.sra Read 1123946 spots for SRR12671709.sra Written 1123946 spots for SRR12671709.sra Read 1123946 spots for SRR12671709.sra Written 1123946 spots for SRR12671709.sra Read 1123946 spots for SRR12671709.sra Written 1123946 spots for SRR12671709.sra SRR ids: ['SRR12671709.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7q9pauo7 SRR12671709.sra spots: 22478931 blocks: [[1, 1123946], [1123947, 2247892], [2247893, 3371838], [3371839, 4495784], [4495785, 5619730], [5619731, 6743676], [6743677, 7867622], [7867623, 8991568], [8991569, 10115514], [10115515, 11239460], [11239461, 12363406], [12363407, 13487352], [13487353, 14611298], [14611299, 15735244], [15735245, 16859190], [16859191, 17983136], [17983137, 19107082], [19107083, 20231028], [20231029, 21354974], [21354975, 22478931]] SRR12671709 file size 7617623 SRR12671709 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671709 SRR12671709_1.fastq SRR12671709_2.fastq Input file: SRR12671709_1.fastq Paired file: SRR12671709_2.fastq trimmed: SRR12671709-trimmed-pair1.fastq, SRR12671709-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:23:54 2025 >> started Wed Feb 12 05:24:28 2025 >> done (33.699s) 22478931 read pairs processed; of these: 18 ( 0.00%) short read pairs filtered out after trimming by size control 2993 ( 0.01%) empty read pairs filtered out after trimming by size control 22475920 (99.99%) read pairs available; of these: 1384631 ( 6.16%) trimmed read pairs available after processing 21091289 (93.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 2 0.00% 21 4 0.00% 22 0 0.00% 23 2 0.00% 24 2 0.00% 25 6 0.00% 26 7 0.00% 27 8 0.00% 28 7 0.00% 29 2 0.00% 30 5 0.00% 31 10 0.00% 32 12 0.00% 33 12 0.00% 34 10 0.00% 35 10 0.00% 36 7 0.00% 37 19 0.00% 38 26 0.00% 39 22 0.00% 40 27 0.00% 41 31 0.00% 42 27 0.00% 43 40 0.00% 44 38 0.00% 45 38 0.00% 46 46 0.00% 47 47 0.00% 48 32 0.00% 49 52 0.00% 50 62 0.00% 51 67 0.00% 52 79 0.00% 53 104 0.00% 54 91 0.00% 55 101 0.00% 56 96 0.00% 57 125 0.00% 58 129 0.00% 59 131 0.00% 60 169 0.00% 61 184 0.00% 62 231 0.00% 63 233 0.00% 64 270 0.00% 65 274 0.00% 66 300 0.00% 67 335 0.00% 68 344 0.00% 69 426 0.00% 70 446 0.00% 71 545 0.00% 72 668 0.00% 73 735 0.00% 74 784 0.00% 75 890 0.00% 76 912 0.00% 77 1035 0.00% 78 1096 0.00% 79 1283 0.01% 80 1411 0.01% 81 1596 0.01% 82 1845 0.01% 83 2209 0.01% 84 2315 0.01% 85 2545 0.01% 86 2837 0.01% 87 2903 0.01% 88 3257 0.01% 89 3476 0.02% 90 3661 0.02% 91 4248 0.02% 92 4722 0.02% 93 5025 0.02% 94 5644 0.03% 95 6036 0.03% 96 6315 0.03% 97 6571 0.03% 98 6996 0.03% 99 7393 0.03% 100 7837 0.03% 101 8447 0.04% 102 9005 0.04% 103 9767 0.04% 104 10500 0.05% 105 10774 0.05% 106 11546 0.05% 107 11853 0.05% 108 12399 0.06% 109 12965 0.06% 110 13264 0.06% 111 13879 0.06% 112 14747 0.07% 113 15733 0.07% 114 16332 0.07% 115 17393 0.08% 116 18188 0.08% 117 18582 0.08% 118 18771 0.08% 119 19265 0.09% 120 19691 0.09% 121 20901 0.09% 122 21581 0.10% 123 22758 0.10% 124 24024 0.11% 125 24730 0.11% 126 25782 0.11% 127 26120 0.12% 128 26955 0.12% 129 27307 0.12% 130 27565 0.12% 131 28814 0.13% 132 29461 0.13% 133 31024 0.14% 134 32286 0.14% 135 33134 0.15% 136 34131 0.15% 137 34952 0.16% 138 35074 0.16% 139 35924 0.16% 140 36025 0.16% 141 36994 0.16% 142 37776 0.17% 143 38830 0.17% 144 41425 0.18% 145 42678 0.19% 146 43949 0.20% 147 44568 0.20% 148 45334 0.20% 149 45208 0.20% 150 44675 0.20% 151 21091289 93.84% 22475920 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=20 prefix-density=0.56 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.22 sequence-density-rank=17 fanout-score=11.43 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=6.0 sequence=TTCTTTCCAATGCT criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=32 prefix-density=0.94 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=38.00 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.6 sequence=CCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR12671709 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:25:12 Started mapping on | Feb 12 05:25:14 Finished on | Feb 12 05:27:31 Mapping speed, Million of reads per hour | 590.61 Number of input reads | 22475920 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20924178 Uniquely mapped reads % | 93.10% Average mapped length | 298.02 Number of splices: Total | 20962363 Number of splices: Annotated (sjdb) | 20565156 Number of splices: GT/AG | 20548063 Number of splices: GC/AG | 351950 Number of splices: AT/AC | 12432 Number of splices: Non-canonical | 49918 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 553352 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 234941 % of reads mapped to too many loci | 1.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.21% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 998390 998390 998390 N_multimapping 553352 553352 553352 N_noFeature 757148 20615330 870430 N_ambiguous 322287 1470 125871 UnstrandedReadsAssigned:19844743 PositiveStrandReadsAssigned:307378 NegativeStrandReadsAssigned:19927877 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671709 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671709-trimmed-pair1.fastq SRR12671709-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,475,920 reads, 20,067,544 reads pseudoaligned [quant] estimated average fragment length: 288.28 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,049 rounds 52401 SRR12671709.ke.tsv 34699 SRR12671709.se.tsv 87100 total ==> SRR12671709.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1730.72 706 19.8584 Potri.005G024800.1.v4.1 1035 747.72 313 20.3784 Potri.004G059700.1.v4.1 961 674.081 9 0.649974 Potri.007G009000.2.v4.1 1416 1128.72 0 0 Potri.003G141000.2.v4.1 2943 2655.72 973.191 17.8395 Potri.016G087400.1.v4.1 270 75.809 780 500.887 Potri.015G069301.1.v4.1 564 298.617 0 0 Potri.010G195200.1.v4.1 1773 1485.72 52 1.70385 Potri.012G127500.1.v4.1 977 689.892 146 10.3024 ==> SRR12671709.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1000 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 337 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 4 SRR12671709 completed mapping pipeline successfully