Starting /dee2/code/volunteer_pipeline.sh SRR12671710 current disk space = 3049057972224 free memory = 1488657460 SRR12671710 SRAfilesize 6d01a199b926af16682ef260060bab7a SRR12671710.sra SRR12671710.sra file validated SRR12671710 is paired end SRR12671710 is conventional basespace SRR12671710 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671710_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.371 37.0 37.0 37.0 37.0 37.0 2 36.0275 37.0 37.0 37.0 37.0 37.0 3 36.5165 37.0 37.0 37.0 37.0 37.0 4 36.5415 37.0 37.0 37.0 37.0 37.0 5 36.5225 37.0 37.0 37.0 37.0 37.0 6 36.476 37.0 37.0 37.0 37.0 37.0 7 36.497 37.0 37.0 37.0 37.0 37.0 8 36.544 37.0 37.0 37.0 37.0 37.0 9 36.608 37.0 37.0 37.0 37.0 37.0 10-14 36.514599999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.5332 37.0 37.0 37.0 37.0 37.0 20-24 36.4749 37.0 37.0 37.0 37.0 37.0 25-29 36.4584 37.0 37.0 37.0 37.0 37.0 30-34 36.3999 37.0 37.0 37.0 37.0 37.0 35-39 36.42190000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.3658 37.0 37.0 37.0 37.0 37.0 45-49 36.366299999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.363 37.0 37.0 37.0 37.0 37.0 55-59 36.349900000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.3664 37.0 37.0 37.0 37.0 37.0 65-69 36.333000000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.2369 37.0 37.0 37.0 37.0 37.0 75-79 36.220099999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.2687 37.0 37.0 37.0 37.0 37.0 85-89 36.1942 37.0 37.0 37.0 37.0 37.0 90-94 36.153200000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.155 37.0 37.0 37.0 37.0 37.0 100-104 36.1748 37.0 37.0 37.0 37.0 37.0 105-109 36.100100000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.0817 37.0 37.0 37.0 37.0 37.0 115-119 36.0997 37.0 37.0 37.0 37.0 37.0 120-124 36.0307 37.0 37.0 37.0 37.0 37.0 125-129 35.97410000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.9701 37.0 37.0 37.0 37.0 37.0 135-139 35.894000000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.83389999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.7787 37.0 37.0 37.0 37.0 37.0 150-151 35.23075 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 2.0 25 0.0 26 6.0 27 11.0 28 11.0 29 24.0 30 27.0 31 36.0 32 51.0 33 75.0 34 115.0 35 341.0 36 2942.0 37 357.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.9 14.95 8.95 45.2 2 17.8643216080402 20.402010050251256 42.36180904522613 19.371859296482413 3 16.45 24.925 29.4 29.225 4 23.799999999999997 33.300000000000004 22.55 20.349999999999998 5 20.974999999999998 36.35 23.974999999999998 18.7 6 16.6 37.125 25.874999999999996 20.4 7 14.224999999999998 21.0 44.125 20.65 8 16.75 22.375 31.775 29.099999999999998 9 17.349999999999998 20.775 35.575 26.3 10-14 19.605 29.65 26.634999999999998 24.11 15-19 19.865 28.205000000000002 27.650000000000002 24.279999999999998 20-24 19.985 28.410000000000004 27.555000000000003 24.05 25-29 19.384999999999998 28.165000000000003 28.165000000000003 24.285 30-34 19.935 29.085 27.284999999999997 23.695 35-39 19.525000000000002 28.675 27.915 23.885 40-44 20.265 28.77 27.705000000000002 23.26 45-49 20.005 28.744999999999997 27.284999999999997 23.965 50-54 19.994999999999997 28.035 27.6 24.37 55-59 20.185 28.655 27.935 23.225 60-64 19.925 28.505000000000003 27.58 23.990000000000002 65-69 20.155 29.37 26.700000000000003 23.775 70-74 19.97 28.98 27.305 23.745 75-79 19.98 28.32 28.410000000000004 23.29 80-84 20.815 27.43 27.46 24.295 85-89 20.105 28.355000000000004 27.794999999999998 23.745 90-94 20.465 28.615000000000002 27.24 23.68 95-99 19.655 28.199999999999996 27.935 24.21 100-104 20.19 28.265 27.150000000000002 24.395 105-109 20.34 28.455000000000002 27.529999999999998 23.674999999999997 110-114 20.64 28.865000000000002 27.125 23.369999999999997 115-119 20.585 28.050000000000004 27.71 23.655 120-124 20.474999999999998 28.075 27.555000000000003 23.895 125-129 20.380000000000003 28.549999999999997 27.250000000000004 23.82 130-134 20.44 28.65 27.51 23.400000000000002 135-139 21.310000000000002 28.410000000000004 26.784999999999997 23.494999999999997 140-144 20.974999999999998 27.785 27.165 24.075 145-149 20.71 28.46 27.025 23.805 150-151 21.475 28.5875 27.1625 22.775000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 1.0 15 1.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 2.0 23 2.5 24 1.0 25 3.0 26 6.0 27 11.0 28 15.0 29 13.5 30 21.5 31 31.5 32 35.5 33 40.5 34 56.5 35 78.5 36 94.0 37 120.0 38 148.0 39 164.0 40 192.0 41 218.0 42 217.5 43 242.0 44 262.5 45 271.0 46 272.5 47 230.0 48 216.0 49 202.0 50 161.5 51 138.0 52 116.5 53 94.0 54 74.0 55 59.0 56 50.0 57 39.0 58 26.0 59 20.0 60 17.5 61 13.0 62 9.0 63 5.0 64 1.0 65 1.5 66 1.5 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.29578975596675 86.97500000000001 2 6.1946902654867255 11.55 3 0.45588629659426116 1.275 4 0.053633681952266025 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.36250000000000004 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.6625000000000001 0.0 0.0 0.0 0.0 110-111 0.6875 0.0 0.0 0.0 0.0 112-113 0.7124999999999999 0.0 0.0 0.0 0.0 114-115 0.85 0.0 0.0 0.0 0.0 116-117 0.9875 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.2625000000000002 0.0 0.0 0.0 0.0 122-123 1.4375 0.0 0.0 0.0 0.0 124-125 1.5625 0.0 0.0 0.0 0.0 126-127 1.6625 0.0 0.0 0.0 0.0 128-129 1.8875000000000002 0.0 0.0 0.0 0.0 130-131 2.2125000000000004 0.0 0.0 0.0 0.0 132-133 2.45 0.0 0.0 0.0 0.0 134-135 2.6500000000000004 0.0 0.0 0.0 0.0 136-137 2.975 0.0 0.0 0.0 0.0 138-139 3.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATAAA 10 0.006830828 145.0 4 >>END_MODULE SRR12671710 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671710_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.161 37.0 37.0 37.0 37.0 37.0 2 35.995 37.0 37.0 37.0 37.0 37.0 3 36.012 37.0 37.0 37.0 37.0 37.0 4 35.9955 37.0 37.0 37.0 37.0 37.0 5 36.1785 37.0 37.0 37.0 37.0 37.0 6 36.172 37.0 37.0 37.0 37.0 37.0 7 36.1695 37.0 37.0 37.0 37.0 37.0 8 36.3215 37.0 37.0 37.0 37.0 37.0 9 36.248 37.0 37.0 37.0 37.0 37.0 10-14 36.218900000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.1638 37.0 37.0 37.0 37.0 37.0 20-24 36.14810000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.0967 37.0 37.0 37.0 37.0 37.0 30-34 36.0284 37.0 37.0 37.0 37.0 37.0 35-39 36.0522 37.0 37.0 37.0 37.0 37.0 40-44 36.0156 37.0 37.0 37.0 37.0 37.0 45-49 35.9834 37.0 37.0 37.0 37.0 37.0 50-54 36.0495 37.0 37.0 37.0 37.0 37.0 55-59 35.9534 37.0 37.0 37.0 37.0 37.0 60-64 35.9319 37.0 37.0 37.0 37.0 37.0 65-69 35.866299999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.9171 37.0 37.0 37.0 37.0 37.0 75-79 35.7762 37.0 37.0 37.0 37.0 37.0 80-84 35.8353 37.0 37.0 37.0 37.0 37.0 85-89 35.7235 37.0 37.0 37.0 37.0 37.0 90-94 35.707499999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.7954 37.0 37.0 37.0 37.0 37.0 100-104 35.7401 37.0 37.0 37.0 37.0 37.0 105-109 35.6468 37.0 37.0 37.0 37.0 37.0 110-114 35.567899999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.5558 37.0 37.0 37.0 37.0 37.0 120-124 35.56099999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.435700000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.49580000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.4853 37.0 37.0 37.0 37.0 37.0 140-144 35.246300000000005 37.0 37.0 37.0 32.2 37.0 145-149 35.3147 37.0 37.0 37.0 32.2 37.0 150-151 34.878 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 1.0 16 1.0 17 1.0 18 0.0 19 1.0 20 1.0 21 0.0 22 3.0 23 6.0 24 3.0 25 8.0 26 13.0 27 15.0 28 20.0 29 27.0 30 32.0 31 68.0 32 75.0 33 112.0 34 226.0 35 561.0 36 2599.0 37 224.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.449999999999996 19.2 11.95 34.4 2 23.3 23.549999999999997 38.625 14.524999999999999 3 19.05 26.674999999999997 32.85 21.425 4 23.175 35.875 22.45 18.5 5 23.599999999999998 37.55 21.8 17.05 6 17.599999999999998 37.375 25.75 19.275000000000002 7 17.125 17.65 44.15 21.075 8 19.400000000000002 22.45 28.999999999999996 29.15 9 21.8 23.625 28.95 25.624999999999996 10-14 22.245 28.785 27.165 21.805 15-19 22.470000000000002 28.060000000000002 27.625 21.845 20-24 22.745 28.610000000000003 27.839999999999996 20.805 25-29 22.515 27.900000000000002 27.965 21.62 30-34 22.39 27.765 28.16 21.685 35-39 22.58 28.055000000000003 27.939999999999998 21.425 40-44 22.57 27.435 28.475 21.52 45-49 22.05 27.82 27.975 22.155 50-54 22.650000000000002 27.43 28.194999999999997 21.725 55-59 22.535 27.200000000000003 28.255000000000003 22.009999999999998 60-64 22.74 26.875 28.215 22.17 65-69 22.275 27.560000000000002 28.384999999999998 21.78 70-74 22.95 27.295 27.765 21.990000000000002 75-79 23.035 27.92 27.644999999999996 21.4 80-84 22.74 28.025 27.700000000000003 21.535 85-89 23.22 28.07 27.389999999999997 21.32 90-94 23.0 28.025 27.634999999999998 21.34 95-99 23.435 28.025 27.485 21.055 100-104 23.419999999999998 27.310000000000002 27.625 21.645 105-109 23.285 27.584999999999997 27.675 21.455 110-114 23.91 27.27 27.775 21.044999999999998 115-119 23.49 27.865000000000002 27.755000000000003 20.89 120-124 23.555 27.96 27.165 21.32 125-129 23.825 27.744999999999997 27.62 20.810000000000002 130-134 23.96 27.165 27.85 21.025 135-139 24.529999999999998 27.595 27.36 20.515 140-144 24.9 27.665 27.11 20.325 145-149 24.54 27.650000000000002 26.93 20.880000000000003 150-151 24.2 28.050000000000004 27.3125 20.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.5 22 1.0 23 1.5 24 3.5 25 5.0 26 4.5 27 4.5 28 8.0 29 14.5 30 19.0 31 27.5 32 35.5 33 44.0 34 62.5 35 68.0 36 77.0 37 99.0 38 123.0 39 167.0 40 186.0 41 208.0 42 246.5 43 259.5 44 273.5 45 257.5 46 255.0 47 251.5 48 218.0 49 191.5 50 170.5 51 143.5 52 115.0 53 95.0 54 75.0 55 65.0 56 54.0 57 43.5 58 36.0 59 30.0 60 18.5 61 9.0 62 8.0 63 7.5 64 4.5 65 1.5 66 0.5 67 0.5 68 1.0 69 1.0 70 0.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.075 #Duplication Level Percentage of deduplicated Percentage of total 1 93.31184528605962 86.85000000000001 2 6.043513295729251 11.25 3 0.59092130002686 1.6500000000000001 4 0.0 0.0 5 0.05372011818426001 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit AAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.38749999999999996 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.7124999999999999 0.0 0.0 0.0 0.0 112-113 0.7375 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 1.0125 0.0 0.0 0.0 0.0 118-119 1.15 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.4625 0.0 0.0 0.0 0.0 124-125 1.5875 0.0 0.0 0.0 0.0 126-127 1.6875 0.0 0.0 0.0 0.0 128-129 1.9125 0.0 0.0 0.0 0.0 130-131 2.2375 0.0 0.0 0.0 0.0 132-133 2.4875 0.0 0.0 0.0 0.0 134-135 2.7 0.0 0.0 0.0 0.0 136-137 3.05 0.0 0.0 0.0 0.0 138-139 3.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCATAC 10 0.006830828 145.0 7 CACATTC 10 0.006830828 145.0 3 ACACATT 10 0.006830828 145.0 2 AGACTGA 10 0.006830828 145.0 145 ATTCATA 10 0.006830828 145.0 6 AACACAT 10 0.006830828 145.0 1 >>END_MODULE Read 1098398 spots for SRR12671710.sra Written 1098398 spots for SRR12671710.sra Read 1098405 spots for SRR12671710.sra Written 1098405 spots for SRR12671710.sra Read 1098398 spots for SRR12671710.sra Written 1098398 spots for SRR12671710.sra Read 1098398 spots for SRR12671710.sra Written 1098398 spots for SRR12671710.sra Read 1098398 spots for SRR12671710.sra Written 1098398 spots for SRR12671710.sra Read 1098398 spots for SRR12671710.sra Written 1098398 spots for SRR12671710.sra Read 1098398 spots for SRR12671710.sra Written 1098398 spots for SRR12671710.sra Read 1098398 spots for SRR12671710.sra Written 1098398 spots for SRR12671710.sra Read 1098398 spots for SRR12671710.sra Written 1098398 spots for SRR12671710.sra Read 1098398 spots for SRR12671710.sra Written 1098398 spots for SRR12671710.sra Read 1098398 spots for SRR12671710.sra Written 1098398 spots for SRR12671710.sra Read 1098398 spots for SRR12671710.sra Written 1098398 spots for SRR12671710.sra Read 1098398 spots for SRR12671710.sra Written 1098398 spots for SRR12671710.sra Read 1098398 spots for SRR12671710.sra Written 1098398 spots for SRR12671710.sra Read 1098398 spots for SRR12671710.sra Written 1098398 spots for SRR12671710.sra Read 1098398 spots for SRR12671710.sra Written 1098398 spots for SRR12671710.sra Read 1098398 spots for SRR12671710.sra Written 1098398 spots for SRR12671710.sra Read 1098398 spots for SRR12671710.sra Written 1098398 spots for SRR12671710.sra Read 1098398 spots for SRR12671710.sra Written 1098398 spots for SRR12671710.sra Read 1098398 spots for SRR12671710.sra Written 1098398 spots for SRR12671710.sra SRR ids: ['SRR12671710.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4yuupxi0 SRR12671710.sra spots: 21967967 blocks: [[1, 1098398], [1098399, 2196796], [2196797, 3295194], [3295195, 4393592], [4393593, 5491990], [5491991, 6590388], [6590389, 7688786], [7688787, 8787184], [8787185, 9885582], [9885583, 10983980], [10983981, 12082378], [12082379, 13180776], [13180777, 14279174], [14279175, 15377572], [15377573, 16475970], [16475971, 17574368], [17574369, 18672766], [18672767, 19771164], [19771165, 20869562], [20869563, 21967967]] SRR12671710 file size 7443975 SRR12671710 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671710 SRR12671710_1.fastq SRR12671710_2.fastq Input file: SRR12671710_1.fastq Paired file: SRR12671710_2.fastq trimmed: SRR12671710-trimmed-pair1.fastq, SRR12671710-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:05:10 2025 >> started Wed Feb 12 05:05:34 2025 >> done (24.389s) 21967967 read pairs processed; of these: 20 ( 0.00%) short read pairs filtered out after trimming by size control 2214 ( 0.01%) empty read pairs filtered out after trimming by size control 21965733 (99.99%) read pairs available; of these: 1095551 ( 4.99%) trimmed read pairs available after processing 20870182 (95.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 3 0.00% 21 3 0.00% 22 1 0.00% 23 2 0.00% 24 3 0.00% 25 2 0.00% 26 5 0.00% 27 12 0.00% 28 11 0.00% 29 9 0.00% 30 7 0.00% 31 17 0.00% 32 9 0.00% 33 11 0.00% 34 16 0.00% 35 11 0.00% 36 12 0.00% 37 15 0.00% 38 21 0.00% 39 22 0.00% 40 28 0.00% 41 35 0.00% 42 38 0.00% 43 37 0.00% 44 46 0.00% 45 30 0.00% 46 42 0.00% 47 47 0.00% 48 42 0.00% 49 43 0.00% 50 48 0.00% 51 72 0.00% 52 72 0.00% 53 73 0.00% 54 82 0.00% 55 90 0.00% 56 98 0.00% 57 103 0.00% 58 109 0.00% 59 118 0.00% 60 143 0.00% 61 150 0.00% 62 147 0.00% 63 198 0.00% 64 199 0.00% 65 222 0.00% 66 276 0.00% 67 262 0.00% 68 259 0.00% 69 343 0.00% 70 374 0.00% 71 407 0.00% 72 478 0.00% 73 554 0.00% 74 564 0.00% 75 659 0.00% 76 717 0.00% 77 740 0.00% 78 873 0.00% 79 964 0.00% 80 1060 0.00% 81 1240 0.01% 82 1402 0.01% 83 1520 0.01% 84 1685 0.01% 85 1854 0.01% 86 1982 0.01% 87 2285 0.01% 88 2366 0.01% 89 2644 0.01% 90 2762 0.01% 91 3081 0.01% 92 3360 0.02% 93 3781 0.02% 94 3948 0.02% 95 4379 0.02% 96 4719 0.02% 97 4801 0.02% 98 5267 0.02% 99 5456 0.02% 100 5824 0.03% 101 6231 0.03% 102 6698 0.03% 103 7108 0.03% 104 7528 0.03% 105 8119 0.04% 106 8415 0.04% 107 8887 0.04% 108 9121 0.04% 109 9540 0.04% 110 10200 0.05% 111 10641 0.05% 112 11263 0.05% 113 11514 0.05% 114 12265 0.06% 115 12779 0.06% 116 13450 0.06% 117 13956 0.06% 118 14830 0.07% 119 15099 0.07% 120 15406 0.07% 121 16139 0.07% 122 16714 0.08% 123 17672 0.08% 124 18275 0.08% 125 19009 0.09% 126 19561 0.09% 127 20131 0.09% 128 20591 0.09% 129 21485 0.10% 130 22210 0.10% 131 23011 0.10% 132 23577 0.11% 133 24926 0.11% 134 25853 0.12% 135 26181 0.12% 136 26846 0.12% 137 27748 0.13% 138 28507 0.13% 139 29277 0.13% 140 29764 0.14% 141 30365 0.14% 142 31508 0.14% 143 32544 0.15% 144 34189 0.16% 145 35010 0.16% 146 36334 0.17% 147 36299 0.17% 148 37367 0.17% 149 37556 0.17% 150 38455 0.18% 151 20870182 95.01% 21965733 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=22 prefix-density=0.56 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=11.57 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=2.0 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=23 prefix-density=0.74 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.19 sequence-density-rank=19 fanout-score=11.25 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=5.9 sequence=AAGAAAGCTTACCCTAAC SRR12671710 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:06:19 Started mapping on | Feb 12 05:06:19 Finished on | Feb 12 05:08:33 Mapping speed, Million of reads per hour | 590.12 Number of input reads | 21965733 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20695585 Uniquely mapped reads % | 94.22% Average mapped length | 298.47 Number of splices: Total | 20656477 Number of splices: Annotated (sjdb) | 20243108 Number of splices: GT/AG | 20258095 Number of splices: GC/AG | 325821 Number of splices: AT/AC | 11792 Number of splices: Non-canonical | 60769 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 527832 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 103431 % of reads mapped to too many loci | 0.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.77% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 742316 742316 742316 N_multimapping 527832 527832 527832 N_noFeature 762869 20354707 871314 N_ambiguous 365072 1369 131829 UnstrandedReadsAssigned:19567644 PositiveStrandReadsAssigned:339509 NegativeStrandReadsAssigned:19692442 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671710 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671710-trimmed-pair1.fastq SRR12671710-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,965,733 reads, 19,655,631 reads pseudoaligned [quant] estimated average fragment length: 303.739 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52401 SRR12671710.ke.tsv 34699 SRR12671710.se.tsv 87100 total ==> SRR12671710.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1715.26 811 22.0522 Potri.005G024800.1.v4.1 1035 732.261 389 24.7767 Potri.004G059700.1.v4.1 961 658.821 5 0.353967 Potri.007G009000.2.v4.1 1416 1113.26 0 0 Potri.003G141000.2.v4.1 2943 2640.26 1856.56 32.7961 Potri.016G087400.1.v4.1 270 72.9914 754 481.793 Potri.015G069301.1.v4.1 564 289.741 0 0 Potri.010G195200.1.v4.1 1773 1470.26 118.724 3.7662 Potri.012G127500.1.v4.1 977 674.556 171 11.8233 ==> SRR12671710.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 249 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 237 Potri.001G212900.v4.1 40 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR12671710 completed mapping pipeline successfully