Starting /dee2/code/volunteer_pipeline.sh SRR12671711 current disk space = 3048987959296 free memory = 1544894020 SRR12671711 SRAfilesize 7f683c5d0a7597bb8fc5c36a645569fe SRR12671711.sra SRR12671711.sra file validated SRR12671711 is paired end SRR12671711 is conventional basespace SRR12671711 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671711_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4415 37.0 37.0 37.0 37.0 37.0 2 36.294 37.0 37.0 37.0 37.0 37.0 3 36.57 37.0 37.0 37.0 37.0 37.0 4 36.5495 37.0 37.0 37.0 37.0 37.0 5 36.4875 37.0 37.0 37.0 37.0 37.0 6 36.5655 37.0 37.0 37.0 37.0 37.0 7 36.4615 37.0 37.0 37.0 37.0 37.0 8 36.554 37.0 37.0 37.0 37.0 37.0 9 36.5875 37.0 37.0 37.0 37.0 37.0 10-14 36.605399999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5373 37.0 37.0 37.0 37.0 37.0 20-24 36.5687 37.0 37.0 37.0 37.0 37.0 25-29 36.489 37.0 37.0 37.0 37.0 37.0 30-34 36.4553 37.0 37.0 37.0 37.0 37.0 35-39 36.5193 37.0 37.0 37.0 37.0 37.0 40-44 36.4766 37.0 37.0 37.0 37.0 37.0 45-49 36.437599999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.429500000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.42100000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.44 37.0 37.0 37.0 37.0 37.0 65-69 36.3689 37.0 37.0 37.0 37.0 37.0 70-74 36.3652 37.0 37.0 37.0 37.0 37.0 75-79 36.298500000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.3409 37.0 37.0 37.0 37.0 37.0 85-89 36.3608 37.0 37.0 37.0 37.0 37.0 90-94 36.326 37.0 37.0 37.0 37.0 37.0 95-99 36.1828 37.0 37.0 37.0 37.0 37.0 100-104 36.282399999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.161699999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.1843 37.0 37.0 37.0 37.0 37.0 115-119 36.1666 37.0 37.0 37.0 37.0 37.0 120-124 36.1297 37.0 37.0 37.0 37.0 37.0 125-129 36.092 37.0 37.0 37.0 37.0 37.0 130-134 36.070299999999996 37.0 37.0 37.0 37.0 37.0 135-139 36.018899999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.868399999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.94539999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.4935 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 3.0 24 1.0 25 1.0 26 5.0 27 3.0 28 12.0 29 19.0 30 24.0 31 29.0 32 43.0 33 74.0 34 96.0 35 290.0 36 3011.0 37 389.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.400000000000002 13.725000000000001 11.799999999999999 47.075 2 18.693467336683415 19.09547738693467 41.834170854271356 20.376884422110553 3 17.65 24.5 27.175 30.675 4 20.974999999999998 33.45 22.650000000000002 22.925 5 21.95 37.35 23.674999999999997 17.025000000000002 6 18.275 34.425 26.575 20.724999999999998 7 13.775 22.625 43.6 20.0 8 17.675 22.55 30.975 28.799999999999997 9 18.6 22.225 33.800000000000004 25.374999999999996 10-14 19.705000000000002 29.13 26.61 24.555 15-19 19.825 28.16 28.09 23.925 20-24 20.07 27.495000000000005 28.199999999999996 24.235 25-29 19.685 28.610000000000003 27.655 24.05 30-34 19.7 27.925 28.59 23.785 35-39 20.549999999999997 28.01 27.575 23.865 40-44 19.845 28.535 27.96 23.66 45-49 20.21 27.82 27.865000000000002 24.104999999999997 50-54 19.86 27.725 28.24 24.175 55-59 20.745 27.82 27.534999999999997 23.9 60-64 19.575 28.18 27.375 24.87 65-69 20.28 27.775 27.37 24.575 70-74 20.03 28.09 27.715 24.165 75-79 20.31 28.08 27.3 24.310000000000002 80-84 20.05 27.384999999999998 28.055000000000003 24.51 85-89 20.305 28.744999999999997 27.525 23.425 90-94 20.669999999999998 27.894999999999996 27.525 23.91 95-99 20.41 27.91 28.01 23.669999999999998 100-104 20.72 28.375 27.01 23.895 105-109 20.8 27.825 27.47 23.905 110-114 20.74 27.744999999999997 27.345000000000002 24.169999999999998 115-119 21.01 27.99 26.900000000000002 24.099999999999998 120-124 20.855 28.299999999999997 26.995 23.849999999999998 125-129 21.295 27.49 27.42 23.794999999999998 130-134 21.26 28.415000000000003 26.484999999999996 23.84 135-139 21.525 28.139999999999997 27.16 23.175 140-144 20.59 27.700000000000003 27.185 24.525 145-149 20.8 27.96 26.924999999999997 24.315 150-151 21.337500000000002 27.400000000000002 27.05 24.212500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 1.0 24 1.5 25 3.5 26 4.5 27 6.5 28 12.0 29 14.0 30 12.0 31 18.5 32 31.5 33 43.0 34 57.5 35 71.5 36 84.0 37 109.5 38 130.5 39 147.5 40 173.0 41 199.5 42 228.5 43 241.5 44 263.0 45 292.0 46 294.5 47 268.5 48 238.0 49 223.0 50 187.0 51 133.0 52 104.5 53 92.5 54 71.0 55 54.0 56 46.0 57 39.0 58 31.0 59 21.5 60 15.5 61 11.5 62 8.0 63 5.5 64 3.0 65 1.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.125 #Duplication Level Percentage of deduplicated Percentage of total 1 94.28950863213812 88.75 2 5.285524568393094 9.950000000000001 3 0.3452855245683931 0.975 4 0.05312084993359894 0.2 5 0.02656042496679947 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCGGGTCCAACTCAGGTGGAGTGAAGCCCACCGGAGCCTCTTTGACAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.175 0.0 0.0 0.0 0.0 116-117 1.325 0.0 0.0 0.0 0.0 118-119 1.45 0.0 0.0 0.0 0.0 120-121 1.55 0.0 0.0 0.0 0.0 122-123 1.75 0.0 0.0 0.0 0.0 124-125 1.9375 0.0 0.0 0.0 0.0 126-127 2.075 0.0 0.0 0.0 0.0 128-129 2.3125 0.0 0.0 0.0 0.0 130-131 2.6875 0.0 0.0 0.0 0.0 132-133 3.0 0.0 0.0 0.0 0.0 134-135 3.3499999999999996 0.0 0.0 0.0 0.0 136-137 3.6625 0.0 0.0 0.0 0.0 138-139 3.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACTCA 10 0.006830828 145.0 4 CAACAAC 10 0.006830828 145.0 1 AACTCAT 10 0.006830828 145.0 5 TCCTGGA 10 0.006830828 145.0 9 TGGCCTT 10 0.006830828 145.0 8 >>END_MODULE SRR12671711 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671711_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.35 37.0 37.0 37.0 37.0 37.0 2 36.199 37.0 37.0 37.0 37.0 37.0 3 36.191 37.0 37.0 37.0 37.0 37.0 4 36.225 37.0 37.0 37.0 37.0 37.0 5 36.352 37.0 37.0 37.0 37.0 37.0 6 36.265 37.0 37.0 37.0 37.0 37.0 7 36.2715 37.0 37.0 37.0 37.0 37.0 8 36.38 37.0 37.0 37.0 37.0 37.0 9 36.3425 37.0 37.0 37.0 37.0 37.0 10-14 36.3793 37.0 37.0 37.0 37.0 37.0 15-19 36.34949999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.3489 37.0 37.0 37.0 37.0 37.0 25-29 36.2853 37.0 37.0 37.0 37.0 37.0 30-34 36.3184 37.0 37.0 37.0 37.0 37.0 35-39 36.21040000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.2313 37.0 37.0 37.0 37.0 37.0 45-49 36.1825 37.0 37.0 37.0 37.0 37.0 50-54 36.1704 37.0 37.0 37.0 37.0 37.0 55-59 36.11800000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.071400000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.093199999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.0472 37.0 37.0 37.0 37.0 37.0 75-79 35.9874 37.0 37.0 37.0 37.0 37.0 80-84 36.0293 37.0 37.0 37.0 37.0 37.0 85-89 35.9559 37.0 37.0 37.0 37.0 37.0 90-94 35.9833 37.0 37.0 37.0 37.0 37.0 95-99 35.97089999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.8936 37.0 37.0 37.0 37.0 37.0 105-109 35.882200000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.8374 37.0 37.0 37.0 37.0 37.0 115-119 35.7665 37.0 37.0 37.0 37.0 37.0 120-124 35.763999999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.721199999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.7181 37.0 37.0 37.0 37.0 37.0 135-139 35.6764 37.0 37.0 37.0 37.0 37.0 140-144 35.5193 37.0 37.0 37.0 37.0 37.0 145-149 35.51879999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.13275 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 1.0 16 0.0 17 0.0 18 1.0 19 0.0 20 1.0 21 1.0 22 5.0 23 4.0 24 6.0 25 5.0 26 8.0 27 7.0 28 15.0 29 17.0 30 20.0 31 37.0 32 68.0 33 76.0 34 184.0 35 517.0 36 2784.0 37 241.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.775 16.5 15.575 36.15 2 24.725 23.025000000000002 37.175000000000004 15.075 3 19.625 25.974999999999998 32.975 21.425 4 22.05 35.375 22.725 19.85 5 23.1 38.275 21.925 16.7 6 17.224999999999998 39.300000000000004 24.099999999999998 19.375 7 17.875 18.125 44.375 19.625 8 19.475 23.025000000000002 27.55 29.95 9 21.9 23.45 29.799999999999997 24.85 10-14 22.685 28.825 26.61 21.88 15-19 22.735 27.435 28.13 21.7 20-24 23.13 27.655 27.67 21.545 25-29 21.68 28.265 27.985 22.07 30-34 22.465 27.6 27.74 22.195 35-39 21.925 28.310000000000002 27.644999999999996 22.12 40-44 22.925 27.834999999999997 27.715 21.525 45-49 22.54 27.315 28.035 22.11 50-54 22.759999999999998 28.1 27.439999999999998 21.7 55-59 23.095 27.450000000000003 27.694999999999997 21.759999999999998 60-64 23.325000000000003 27.310000000000002 27.43 21.935 65-69 23.23 27.55 28.165000000000003 21.055 70-74 23.055 28.249999999999996 26.99 21.705 75-79 23.185 27.825 27.0 21.990000000000002 80-84 23.615 28.34 26.979999999999997 21.065 85-89 23.415 27.93 26.99 21.665 90-94 23.395 28.155 26.340000000000003 22.11 95-99 22.994999999999997 28.544999999999998 27.034999999999997 21.425 100-104 23.655 26.93 27.715 21.7 105-109 23.375 28.38 27.26 20.985 110-114 23.855 27.794999999999998 27.175 21.175 115-119 23.715 27.47 27.525 21.29 120-124 23.669999999999998 27.544999999999998 27.944999999999997 20.84 125-129 24.43 27.79 27.1 20.68 130-134 24.25 27.939999999999998 27.139999999999997 20.669999999999998 135-139 24.265 27.900000000000002 27.150000000000002 20.685000000000002 140-144 24.38 28.33 26.400000000000002 20.89 145-149 24.685000000000002 27.77 26.75 20.794999999999998 150-151 26.3 27.037499999999998 25.937500000000004 20.724999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.5 24 1.5 25 2.0 26 1.5 27 4.0 28 7.0 29 7.0 30 13.0 31 18.5 32 20.0 33 28.0 34 41.0 35 59.5 36 85.5 37 111.5 38 132.0 39 150.0 40 178.0 41 218.5 42 250.5 43 259.0 44 264.0 45 281.0 46 263.5 47 227.5 48 223.5 49 215.0 50 179.0 51 145.5 52 123.0 53 116.5 54 101.5 55 71.5 56 51.5 57 38.5 58 29.5 59 22.5 60 19.0 61 11.5 62 5.0 63 4.5 64 5.0 65 2.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.2144373673036 88.75 2 5.467091295116773 10.299999999999999 3 0.2653927813163482 0.75 4 0.05307855626326964 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.44999999999999996 0.0 0.0 0.0 0.0 102-103 0.5375000000000001 0.0 0.0 0.0 0.0 104-105 0.65 0.0 0.0 0.0 0.0 106-107 0.7125 0.0 0.0 0.0 0.0 108-109 0.8374999999999999 0.0 0.0 0.0 0.0 110-111 0.95 0.0 0.0 0.0 0.0 112-113 0.975 0.0 0.0 0.0 0.0 114-115 1.15 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.525 0.0 0.0 0.0 0.0 120-121 1.625 0.0 0.0 0.0 0.0 122-123 1.825 0.0 0.0 0.0 0.0 124-125 2.0125 0.0 0.0 0.0 0.0 126-127 2.1500000000000004 0.0 0.0 0.0 0.0 128-129 2.3875 0.0 0.0 0.0 0.0 130-131 2.7875 0.0 0.0 0.0 0.0 132-133 3.1 0.0 0.0 0.0 0.0 134-135 3.4375 0.0 0.0 0.0 0.0 136-137 3.7125 0.0 0.0 0.0 0.0 138-139 3.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCCTCT 10 0.006830828 145.0 4 >>END_MODULE Read 843265 spots for SRR12671711.sra Written 843265 spots for SRR12671711.sra Read 843265 spots for SRR12671711.sra Written 843265 spots for SRR12671711.sra Read 843265 spots for SRR12671711.sra Written 843265 spots for SRR12671711.sra Read 843265 spots for SRR12671711.sra Written 843265 spots for SRR12671711.sra Read 843265 spots for SRR12671711.sra Written 843265 spots for SRR12671711.sra Read 843265 spots for SRR12671711.sra Written 843265 spots for SRR12671711.sra Read 843265 spots for SRR12671711.sra Written 843265 spots for SRR12671711.sra Read 843265 spots for SRR12671711.sra Written 843265 spots for SRR12671711.sra Read 843265 spots for SRR12671711.sra Written 843265 spots for SRR12671711.sra Read 843265 spots for SRR12671711.sra Written 843265 spots for SRR12671711.sra Read 843265 spots for SRR12671711.sra Written 843265 spots for SRR12671711.sra Read 843265 spots for SRR12671711.sra Written 843265 spots for SRR12671711.sra Read 843265 spots for SRR12671711.sra Written 843265 spots for SRR12671711.sra Read 843265 spots for SRR12671711.sra Written 843265 spots for SRR12671711.sra Read 843265 spots for SRR12671711.sra Written 843265 spots for SRR12671711.sra Read 843265 spots for SRR12671711.sra Written 843265 spots for SRR12671711.sra Read 843265 spots for SRR12671711.sra Written 843265 spots for SRR12671711.sra Read 843276 spots for SRR12671711.sra Written 843276 spots for SRR12671711.sra Read 843265 spots for SRR12671711.sra Written 843265 spots for SRR12671711.sra Read 843265 spots for SRR12671711.sra Written 843265 spots for SRR12671711.sra SRR ids: ['SRR12671711.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xydfp_go SRR12671711.sra spots: 16865311 blocks: [[1, 843265], [843266, 1686530], [1686531, 2529795], [2529796, 3373060], [3373061, 4216325], [4216326, 5059590], [5059591, 5902855], [5902856, 6746120], [6746121, 7589385], [7589386, 8432650], [8432651, 9275915], [9275916, 10119180], [10119181, 10962445], [10962446, 11805710], [11805711, 12648975], [12648976, 13492240], [13492241, 14335505], [14335506, 15178770], [15178771, 16022035], [16022036, 16865311]] SRR12671711 file size 5709870 SRR12671711 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671711 SRR12671711_1.fastq SRR12671711_2.fastq Input file: SRR12671711_1.fastq Paired file: SRR12671711_2.fastq trimmed: SRR12671711-trimmed-pair1.fastq, SRR12671711-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:20:44 2025 >> started Wed Feb 12 05:21:02 2025 >> done (17.804s) 16865311 read pairs processed; of these: 14 ( 0.00%) short read pairs filtered out after trimming by size control 1134 ( 0.01%) empty read pairs filtered out after trimming by size control 16864163 (99.99%) read pairs available; of these: 1065550 ( 6.32%) trimmed read pairs available after processing 15798613 (93.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 3 0.00% 22 4 0.00% 23 2 0.00% 24 1 0.00% 25 6 0.00% 26 5 0.00% 27 4 0.00% 28 2 0.00% 29 4 0.00% 30 3 0.00% 31 2 0.00% 32 5 0.00% 33 6 0.00% 34 4 0.00% 35 8 0.00% 36 6 0.00% 37 9 0.00% 38 12 0.00% 39 15 0.00% 40 15 0.00% 41 18 0.00% 42 21 0.00% 43 28 0.00% 44 24 0.00% 45 35 0.00% 46 27 0.00% 47 27 0.00% 48 42 0.00% 49 54 0.00% 50 52 0.00% 51 53 0.00% 52 68 0.00% 53 54 0.00% 54 64 0.00% 55 72 0.00% 56 89 0.00% 57 83 0.00% 58 88 0.00% 59 109 0.00% 60 109 0.00% 61 134 0.00% 62 146 0.00% 63 159 0.00% 64 171 0.00% 65 174 0.00% 66 189 0.00% 67 222 0.00% 68 267 0.00% 69 312 0.00% 70 333 0.00% 71 396 0.00% 72 453 0.00% 73 502 0.00% 74 560 0.00% 75 621 0.00% 76 684 0.00% 77 753 0.00% 78 849 0.01% 79 945 0.01% 80 1028 0.01% 81 1227 0.01% 82 1293 0.01% 83 1466 0.01% 84 1615 0.01% 85 1700 0.01% 86 1950 0.01% 87 2143 0.01% 88 2440 0.01% 89 2532 0.02% 90 2863 0.02% 91 2996 0.02% 92 3398 0.02% 93 3708 0.02% 94 4038 0.02% 95 4286 0.03% 96 4549 0.03% 97 5019 0.03% 98 5093 0.03% 99 5389 0.03% 100 6097 0.04% 101 6388 0.04% 102 6637 0.04% 103 7020 0.04% 104 7596 0.05% 105 7885 0.05% 106 8550 0.05% 107 8865 0.05% 108 9361 0.06% 109 9898 0.06% 110 10118 0.06% 111 10567 0.06% 112 11313 0.07% 113 11754 0.07% 114 12107 0.07% 115 12921 0.08% 116 13526 0.08% 117 13851 0.08% 118 14558 0.09% 119 14964 0.09% 120 15781 0.09% 121 16006 0.09% 122 16808 0.10% 123 17655 0.10% 124 18244 0.11% 125 18364 0.11% 126 19549 0.12% 127 19920 0.12% 128 20546 0.12% 129 21219 0.13% 130 21536 0.13% 131 22593 0.13% 132 23532 0.14% 133 24291 0.14% 134 24798 0.15% 135 25422 0.15% 136 25990 0.15% 137 27079 0.16% 138 27402 0.16% 139 27797 0.16% 140 28749 0.17% 141 29426 0.17% 142 30373 0.18% 143 31096 0.18% 144 32666 0.19% 145 33029 0.20% 146 33791 0.20% 147 34046 0.20% 148 34993 0.21% 149 35248 0.21% 150 35787 0.21% 151 15798613 93.68% 16864163 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=23 prefix-density=0.55 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=10.84 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=5.4 sequence=TGCTCAACAAGAACATCAACCATCTTCTTGCCATCAGT criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=21 prefix-density=0.53 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGT criterion=fanout-score sequence-density=0.17 sequence-density-rank=20 fanout-score=30.17 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=12.6 sequence=AAGAAAAGAAAA SRR12671711 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:21:49 Started mapping on | Feb 12 05:21:49 Finished on | Feb 12 05:23:39 Mapping speed, Million of reads per hour | 551.92 Number of input reads | 16864163 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 15951962 Uniquely mapped reads % | 94.59% Average mapped length | 298.09 Number of splices: Total | 16312519 Number of splices: Annotated (sjdb) | 15985420 Number of splices: GT/AG | 15997723 Number of splices: GC/AG | 259993 Number of splices: AT/AC | 9188 Number of splices: Non-canonical | 45615 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 401504 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 81392 % of reads mapped to too many loci | 0.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.40% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 510697 510697 510697 N_multimapping 401504 401504 401504 N_noFeature 539605 15697605 624638 N_ambiguous 262141 1073 92329 UnstrandedReadsAssigned:15150216 PositiveStrandReadsAssigned:253284 NegativeStrandReadsAssigned:15234995 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671711 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671711-trimmed-pair1.fastq SRR12671711-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,864,163 reads, 15,227,353 reads pseudoaligned [quant] estimated average fragment length: 286.832 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,212 rounds 52401 SRR12671711.ke.tsv 34699 SRR12671711.se.tsv 87100 total ==> SRR12671711.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1732.17 534 17.7852 Potri.005G024800.1.v4.1 1035 749.168 222 17.0955 Potri.004G059700.1.v4.1 961 675.573 9 0.76856 Potri.007G009000.2.v4.1 1416 1130.17 0 0 Potri.003G141000.2.v4.1 2943 2657.17 832 18.0639 Potri.016G087400.1.v4.1 270 75.4248 822 628.731 Potri.015G069301.1.v4.1 564 299.218 0 0 Potri.010G195200.1.v4.1 1773 1487.17 123 4.77147 Potri.012G127500.1.v4.1 977 691.426 237 19.7747 ==> SRR12671711.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 542 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 212 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR12671711 completed mapping pipeline successfully