Starting /dee2/code/volunteer_pipeline.sh SRR12671712 current disk space = 3049677606912 free memory = 1382153020 SRR12671712 SRAfilesize 6e8caae1abf558efe1824dbd0e8a7ab9 SRR12671712.sra SRR12671712.sra file validated SRR12671712 is paired end SRR12671712 is conventional basespace SRR12671712 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671712_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.36 37.0 37.0 37.0 37.0 37.0 2 36.279 37.0 37.0 37.0 37.0 37.0 3 36.4335 37.0 37.0 37.0 37.0 37.0 4 36.523 37.0 37.0 37.0 37.0 37.0 5 36.5535 37.0 37.0 37.0 37.0 37.0 6 36.538 37.0 37.0 37.0 37.0 37.0 7 36.546 37.0 37.0 37.0 37.0 37.0 8 36.483 37.0 37.0 37.0 37.0 37.0 9 36.487 37.0 37.0 37.0 37.0 37.0 10-14 36.5514 37.0 37.0 37.0 37.0 37.0 15-19 36.5244 37.0 37.0 37.0 37.0 37.0 20-24 36.499300000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.4928 37.0 37.0 37.0 37.0 37.0 30-34 36.4902 37.0 37.0 37.0 37.0 37.0 35-39 36.4612 37.0 37.0 37.0 37.0 37.0 40-44 36.401500000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.3779 37.0 37.0 37.0 37.0 37.0 50-54 36.420700000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.326800000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.3702 37.0 37.0 37.0 37.0 37.0 65-69 36.3484 37.0 37.0 37.0 37.0 37.0 70-74 36.27910000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.304899999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.2718 37.0 37.0 37.0 37.0 37.0 85-89 36.2856 37.0 37.0 37.0 37.0 37.0 90-94 36.1653 37.0 37.0 37.0 37.0 37.0 95-99 36.120400000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.2152 37.0 37.0 37.0 37.0 37.0 105-109 36.152699999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.1406 37.0 37.0 37.0 37.0 37.0 115-119 36.12329999999999 37.0 37.0 37.0 37.0 37.0 120-124 36.0642 37.0 37.0 37.0 37.0 37.0 125-129 35.998 37.0 37.0 37.0 37.0 37.0 130-134 35.9827 37.0 37.0 37.0 37.0 37.0 135-139 35.89399999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.92 37.0 37.0 37.0 37.0 37.0 145-149 35.859500000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.35 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 3.0 26 6.0 27 7.0 28 10.0 29 19.0 30 40.0 31 26.0 32 48.0 33 66.0 34 102.0 35 317.0 36 3002.0 37 352.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.074999999999996 16.475 10.674999999999999 39.775 2 20.572002007024587 21.17410938283994 38.610135474159556 19.643753135975917 3 16.05 28.95 28.575 26.424999999999997 4 20.1 35.25 23.724999999999998 20.925 5 22.225 35.675000000000004 24.7 17.4 6 17.424999999999997 35.9 25.7 20.974999999999998 7 13.450000000000001 21.3 46.125 19.125 8 18.75 20.525 30.3 30.425 9 16.325 22.1 33.475 28.1 10-14 19.68 28.82 27.125 24.375 15-19 19.405 29.005 27.694999999999997 23.895 20-24 19.11 28.74 28.449999999999996 23.7 25-29 19.035 28.51 28.425 24.03 30-34 18.990000000000002 28.555000000000003 28.28 24.175 35-39 19.53 28.76 27.61 24.099999999999998 40-44 19.62 28.71 28.4 23.27 45-49 19.655 28.37 28.02 23.955000000000002 50-54 19.945 28.51 27.744999999999997 23.799999999999997 55-59 19.455 28.875 28.035 23.635 60-64 20.18 28.825 27.565 23.43 65-69 20.05 28.23 28.105000000000004 23.615 70-74 20.375 28.825 27.279999999999998 23.52 75-79 20.24 28.67 27.32 23.77 80-84 20.005 28.475 27.815 23.705000000000002 85-89 20.07 28.725 27.775 23.43 90-94 20.265 27.975 27.515 24.245 95-99 19.615 28.555000000000003 28.405 23.425 100-104 20.07 28.24 28.470000000000002 23.22 105-109 20.53 28.22 27.785 23.465 110-114 20.330000000000002 27.884999999999998 28.585 23.200000000000003 115-119 20.69 28.42 27.68 23.21 120-124 20.54 28.599999999999998 27.634999999999998 23.225 125-129 20.005 28.365000000000002 27.345000000000002 24.285 130-134 20.335 28.665000000000003 27.735 23.265 135-139 20.575 27.860000000000003 27.615000000000002 23.95 140-144 20.565 28.73 26.974999999999998 23.73 145-149 20.875 28.599999999999998 27.375 23.150000000000002 150-151 21.425 27.712500000000002 27.175 23.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 1.0 22 2.5 23 3.0 24 3.5 25 3.0 26 5.5 27 7.5 28 10.0 29 14.5 30 20.0 31 29.0 32 31.0 33 44.0 34 67.5 35 76.5 36 97.0 37 138.5 38 156.5 39 165.5 40 198.5 41 246.0 42 263.5 43 256.0 44 258.5 45 253.5 46 250.5 47 241.5 48 223.0 49 206.5 50 165.0 51 119.5 52 94.0 53 79.0 54 67.0 55 53.5 56 43.5 57 31.5 58 22.0 59 14.5 60 7.5 61 7.0 62 7.5 63 4.5 64 2.0 65 2.0 66 2.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.475 #Duplication Level Percentage of deduplicated Percentage of total 1 93.63466167424444 87.52499999999999 2 5.830435945439957 10.9 3 0.4546670232682536 1.275 4 0.08023535704733886 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.7125 0.0 0.0 0.0 0.0 108-109 0.8 0.0 0.0 0.0 0.0 110-111 0.8999999999999999 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.2000000000000002 0.0 0.0 0.0 0.0 116-117 1.3375 0.0 0.0 0.0 0.0 118-119 1.4875 0.0 0.0 0.0 0.0 120-121 1.7374999999999998 0.0 0.0 0.0 0.0 122-123 1.85 0.0 0.0 0.0 0.0 124-125 1.925 0.0 0.0 0.0 0.0 126-127 2.0125 0.0 0.0 0.0 0.0 128-129 2.1375 0.0 0.0 0.0 0.0 130-131 2.375 0.0 0.0 0.0 0.0 132-133 2.55 0.0 0.0 0.0 0.0 134-135 2.825 0.0 0.0 0.0 0.0 136-137 2.9875 0.0 0.0 0.0 0.0 138-139 3.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671712 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671712_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9865 37.0 37.0 37.0 37.0 37.0 2 35.985 37.0 37.0 37.0 37.0 37.0 3 35.973 37.0 37.0 37.0 37.0 37.0 4 36.0185 37.0 37.0 37.0 37.0 37.0 5 36.1795 37.0 37.0 37.0 37.0 37.0 6 36.2465 37.0 37.0 37.0 37.0 37.0 7 36.1655 37.0 37.0 37.0 37.0 37.0 8 36.268 37.0 37.0 37.0 37.0 37.0 9 36.1875 37.0 37.0 37.0 37.0 37.0 10-14 36.2386 37.0 37.0 37.0 37.0 37.0 15-19 36.1947 37.0 37.0 37.0 37.0 37.0 20-24 36.1365 37.0 37.0 37.0 37.0 37.0 25-29 36.0917 37.0 37.0 37.0 37.0 37.0 30-34 36.0443 37.0 37.0 37.0 37.0 37.0 35-39 36.035900000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.025400000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.0236 37.0 37.0 37.0 37.0 37.0 50-54 36.0293 37.0 37.0 37.0 37.0 37.0 55-59 35.985800000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.9114 37.0 37.0 37.0 37.0 37.0 65-69 35.8418 37.0 37.0 37.0 37.0 37.0 70-74 35.9434 37.0 37.0 37.0 37.0 37.0 75-79 35.8906 37.0 37.0 37.0 37.0 37.0 80-84 35.813199999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.7213 37.0 37.0 37.0 37.0 37.0 90-94 35.69160000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.7534 37.0 37.0 37.0 37.0 37.0 100-104 35.638 37.0 37.0 37.0 37.0 37.0 105-109 35.7046 37.0 37.0 37.0 37.0 37.0 110-114 35.5984 37.0 37.0 37.0 37.0 37.0 115-119 35.5736 37.0 37.0 37.0 37.0 37.0 120-124 35.5854 37.0 37.0 37.0 37.0 37.0 125-129 35.47 37.0 37.0 37.0 37.0 37.0 130-134 35.4896 37.0 37.0 37.0 37.0 37.0 135-139 35.4279 37.0 37.0 37.0 34.6 37.0 140-144 35.222500000000004 37.0 37.0 37.0 29.8 37.0 145-149 35.3256 37.0 37.0 37.0 32.2 37.0 150-151 34.91025 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 3.0 13 3.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.0 22 2.0 23 1.0 24 5.0 25 13.0 26 12.0 27 9.0 28 25.0 29 28.0 30 36.0 31 44.0 32 53.0 33 105.0 34 233.0 35 615.0 36 2628.0 37 180.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.0 18.675 13.4 31.924999999999997 2 24.125 24.85 35.75 15.275 3 18.95 28.425 32.300000000000004 20.325 4 21.25 38.1 22.425 18.224999999999998 5 24.375 37.875 21.525 16.225 6 18.45 37.125 24.425 20.0 7 17.7 18.55 42.05 21.7 8 20.474999999999998 23.25 27.625 28.65 9 20.424999999999997 24.474999999999998 29.849999999999998 25.25 10-14 22.009999999999998 28.505000000000003 27.025 22.46 15-19 22.185 27.93 28.055000000000003 21.83 20-24 21.615000000000002 27.755000000000003 28.694999999999997 21.935 25-29 22.075 28.389999999999997 28.215 21.32 30-34 22.259999999999998 28.03 28.134999999999998 21.575 35-39 22.585 27.345000000000002 28.525 21.545 40-44 22.345000000000002 28.015 27.97 21.67 45-49 21.709999999999997 28.384999999999998 28.225 21.68 50-54 22.705000000000002 27.905 28.189999999999998 21.2 55-59 22.865 27.450000000000003 28.28 21.404999999999998 60-64 22.994999999999997 26.945000000000004 28.410000000000004 21.65 65-69 22.355 28.29 27.584999999999997 21.77 70-74 23.105 27.07 28.03 21.795 75-79 23.150000000000002 27.435 27.875 21.54 80-84 23.080000000000002 28.48 27.455000000000002 20.985 85-89 23.0 28.050000000000004 27.62 21.33 90-94 22.994999999999997 27.68 28.17 21.154999999999998 95-99 22.900000000000002 28.15 28.13 20.82 100-104 23.345 27.675 27.865000000000002 21.115000000000002 105-109 23.91 27.275 27.76 21.055 110-114 23.330000000000002 27.744999999999997 27.965 20.96 115-119 23.255 28.02 28.075 20.65 120-124 23.24 28.595 27.27 20.895 125-129 23.945 27.68 27.834999999999997 20.54 130-134 23.555 28.285 27.544999999999998 20.615 135-139 23.95 27.860000000000003 27.439999999999998 20.75 140-144 24.445 28.144999999999996 27.474999999999998 19.935 145-149 24.6 27.96 28.04 19.400000000000002 150-151 25.6125 26.787499999999998 27.224999999999998 20.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.5 14 1.0 15 0.0 16 0.5 17 2.0 18 2.0 19 0.5 20 0.0 21 0.0 22 0.5 23 2.0 24 3.0 25 3.5 26 6.0 27 7.0 28 11.0 29 15.5 30 16.0 31 22.5 32 31.0 33 43.0 34 57.5 35 59.5 36 78.0 37 109.0 38 143.5 39 178.0 40 187.0 41 209.5 42 241.5 43 258.0 44 264.5 45 277.0 46 277.0 47 253.5 48 231.5 49 198.5 50 161.5 51 142.5 52 115.0 53 85.5 54 64.0 55 49.5 56 50.5 57 41.0 58 26.0 59 18.0 60 16.5 61 11.5 62 7.0 63 7.5 64 5.0 65 1.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.825 #Duplication Level Percentage of deduplicated Percentage of total 1 94.13802291500133 88.325 2 5.3024247268851585 9.950000000000001 3 0.4263256061817213 1.2 4 0.10658140154543032 0.4 5 0.02664535038635758 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.3875 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.7875 0.0 0.0 0.0 0.0 122-123 1.9 0.0 0.0 0.0 0.0 124-125 2.0 0.0 0.0 0.0 0.0 126-127 2.0875000000000004 0.0 0.0 0.0 0.0 128-129 2.2125 0.0 0.0 0.0 0.0 130-131 2.45 0.0 0.0 0.0 0.0 132-133 2.625 0.0 0.0 0.0 0.0 134-135 2.9125 0.0 0.0 0.0 0.0 136-137 3.0625 0.0 0.0 0.0 0.0 138-139 3.2750000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAACATC 10 0.006830828 145.0 1 CTGCCAA 10 0.006830828 145.0 8 >>END_MODULE Read 1049114 spots for SRR12671712.sra Written 1049114 spots for SRR12671712.sra Read 1049114 spots for SRR12671712.sra Written 1049114 spots for SRR12671712.sra Read 1049114 spots for SRR12671712.sra Written 1049114 spots for SRR12671712.sra Read 1049114 spots for SRR12671712.sra Written 1049114 spots for SRR12671712.sra Read 1049114 spots for SRR12671712.sra Written 1049114 spots for SRR12671712.sra Read 1049114 spots for SRR12671712.sra Written 1049114 spots for SRR12671712.sra Read 1049114 spots for SRR12671712.sra Written 1049114 spots for SRR12671712.sra Read 1049114 spots for SRR12671712.sra Written 1049114 spots for SRR12671712.sra Read 1049114 spots for SRR12671712.sra Written 1049114 spots for SRR12671712.sra Read 1049114 spots for SRR12671712.sra Written 1049114 spots for SRR12671712.sra Read 1049123 spots for SRR12671712.sra Written 1049123 spots for SRR12671712.sra Read 1049114 spots for SRR12671712.sra Written 1049114 spots for SRR12671712.sra Read 1049114 spots for SRR12671712.sra Written 1049114 spots for SRR12671712.sra Read 1049114 spots for SRR12671712.sra Written 1049114 spots for SRR12671712.sra Read 1049114 spots for SRR12671712.sra Written 1049114 spots for SRR12671712.sra Read 1049114 spots for SRR12671712.sra Written 1049114 spots for SRR12671712.sra Read 1049114 spots for SRR12671712.sra Written 1049114 spots for SRR12671712.sra Read 1049114 spots for SRR12671712.sra Written 1049114 spots for SRR12671712.sra Read 1049114 spots for SRR12671712.sra Written 1049114 spots for SRR12671712.sra Read 1049114 spots for SRR12671712.sra Written 1049114 spots for SRR12671712.sra SRR ids: ['SRR12671712.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9pvcos9s SRR12671712.sra spots: 20982289 blocks: [[1, 1049114], [1049115, 2098228], [2098229, 3147342], [3147343, 4196456], [4196457, 5245570], [5245571, 6294684], [6294685, 7343798], [7343799, 8392912], [8392913, 9442026], [9442027, 10491140], [10491141, 11540254], [11540255, 12589368], [12589369, 13638482], [13638483, 14687596], [14687597, 15736710], [15736711, 16785824], [16785825, 17834938], [17834939, 18884052], [18884053, 19933166], [19933167, 20982289]] SRR12671712 file size 7108999 SRR12671712 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671712 SRR12671712_1.fastq SRR12671712_2.fastq Input file: SRR12671712_1.fastq Paired file: SRR12671712_2.fastq trimmed: SRR12671712-trimmed-pair1.fastq, SRR12671712-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:41:47 2025 >> started Wed Feb 12 05:42:11 2025 >> done (23.579s) 20982289 read pairs processed; of these: 21 ( 0.00%) short read pairs filtered out after trimming by size control 1415 ( 0.01%) empty read pairs filtered out after trimming by size control 20980853 (99.99%) read pairs available; of these: 958809 ( 4.57%) trimmed read pairs available after processing 20022044 (95.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 2 0.00% 22 3 0.00% 23 7 0.00% 24 2 0.00% 25 3 0.00% 26 4 0.00% 27 7 0.00% 28 13 0.00% 29 3 0.00% 30 10 0.00% 31 6 0.00% 32 10 0.00% 33 9 0.00% 34 15 0.00% 35 13 0.00% 36 20 0.00% 37 22 0.00% 38 25 0.00% 39 15 0.00% 40 18 0.00% 41 19 0.00% 42 19 0.00% 43 26 0.00% 44 27 0.00% 45 33 0.00% 46 35 0.00% 47 37 0.00% 48 43 0.00% 49 34 0.00% 50 41 0.00% 51 69 0.00% 52 70 0.00% 53 69 0.00% 54 80 0.00% 55 61 0.00% 56 75 0.00% 57 77 0.00% 58 102 0.00% 59 111 0.00% 60 129 0.00% 61 128 0.00% 62 134 0.00% 63 185 0.00% 64 199 0.00% 65 190 0.00% 66 204 0.00% 67 238 0.00% 68 240 0.00% 69 284 0.00% 70 295 0.00% 71 349 0.00% 72 413 0.00% 73 456 0.00% 74 498 0.00% 75 544 0.00% 76 619 0.00% 77 630 0.00% 78 718 0.00% 79 795 0.00% 80 844 0.00% 81 1044 0.00% 82 1115 0.01% 83 1345 0.01% 84 1535 0.01% 85 1734 0.01% 86 1674 0.01% 87 1875 0.01% 88 1970 0.01% 89 2041 0.01% 90 2321 0.01% 91 2486 0.01% 92 2928 0.01% 93 3284 0.02% 94 3576 0.02% 95 3844 0.02% 96 3980 0.02% 97 4113 0.02% 98 4454 0.02% 99 4748 0.02% 100 4918 0.02% 101 5114 0.02% 102 5598 0.03% 103 6179 0.03% 104 6625 0.03% 105 7269 0.03% 106 7307 0.03% 107 7587 0.04% 108 7868 0.04% 109 8156 0.04% 110 8556 0.04% 111 8937 0.04% 112 9650 0.05% 113 10094 0.05% 114 10824 0.05% 115 11470 0.05% 116 11789 0.06% 117 12226 0.06% 118 12794 0.06% 119 12828 0.06% 120 13468 0.06% 121 13908 0.07% 122 14452 0.07% 123 15227 0.07% 124 16135 0.08% 125 16974 0.08% 126 17560 0.08% 127 17945 0.09% 128 18370 0.09% 129 18913 0.09% 130 19297 0.09% 131 19662 0.09% 132 20612 0.10% 133 21788 0.10% 134 22365 0.11% 135 23567 0.11% 136 24614 0.12% 137 24735 0.12% 138 25118 0.12% 139 25613 0.12% 140 25839 0.12% 141 26522 0.13% 142 27426 0.13% 143 28580 0.14% 144 30565 0.15% 145 30980 0.15% 146 31979 0.15% 147 32523 0.16% 148 32873 0.16% 149 32858 0.16% 150 33155 0.16% 151 20022044 95.43% 20980853 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=31 prefix-density=0.34 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=88.70 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=4.2 sequence=ATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=38 prefix-density=0.43 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=22 fanout-score=47.88 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=14.1 sequence=AAAGAAAAGAAAA SRR12671712 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:42:55 Started mapping on | Feb 12 05:42:55 Finished on | Feb 12 05:45:06 Mapping speed, Million of reads per hour | 576.57 Number of input reads | 20980853 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 19615506 Uniquely mapped reads % | 93.49% Average mapped length | 298.60 Number of splices: Total | 19905463 Number of splices: Annotated (sjdb) | 19453258 Number of splices: GT/AG | 19515447 Number of splices: GC/AG | 310589 Number of splices: AT/AC | 13102 Number of splices: Non-canonical | 66325 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.97 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 501912 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 90949 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.55% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 863435 863435 863435 N_multimapping 501912 501912 501912 N_noFeature 770988 19308208 874130 N_ambiguous 339791 1731 134529 UnstrandedReadsAssigned:18504727 PositiveStrandReadsAssigned:305567 NegativeStrandReadsAssigned:18606847 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671712 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671712-trimmed-pair1.fastq SRR12671712-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,980,853 reads, 18,538,603 reads pseudoaligned [quant] estimated average fragment length: 310.507 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52401 SRR12671712.ke.tsv 34699 SRR12671712.se.tsv 87100 total ==> SRR12671712.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1708.49 1807 54.2364 Potri.005G024800.1.v4.1 1035 725.493 440 31.1004 Potri.004G059700.1.v4.1 961 652.122 2 0.157271 Potri.007G009000.2.v4.1 1416 1106.49 0 0 Potri.003G141000.2.v4.1 2943 2633.49 1058.1 20.6035 Potri.016G087400.1.v4.1 270 72.4831 737.718 521.915 Potri.015G069301.1.v4.1 564 285.735 0 0 Potri.010G195200.1.v4.1 1773 1463.49 247.921 8.68697 Potri.012G127500.1.v4.1 977 667.827 109 8.36967 ==> SRR12671712.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 94 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 214 Potri.001G212900.v4.1 30 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 14 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671712 completed mapping pipeline successfully