Starting /dee2/code/volunteer_pipeline.sh SRR12671713 current disk space = 3049675956224 free memory = 1580540660 SRR12671713 SRAfilesize 3fb5bdaaffd8fb2d8cee93c6344ff4f7 SRR12671713.sra SRR12671713.sra file validated SRR12671713 is paired end SRR12671713 is conventional basespace SRR12671713 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671713_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.403 37.0 37.0 37.0 37.0 37.0 2 36.26725 37.0 37.0 37.0 37.0 37.0 3 36.4715 37.0 37.0 37.0 37.0 37.0 4 36.461 37.0 37.0 37.0 37.0 37.0 5 36.62 37.0 37.0 37.0 37.0 37.0 6 36.536 37.0 37.0 37.0 37.0 37.0 7 36.524 37.0 37.0 37.0 37.0 37.0 8 36.514 37.0 37.0 37.0 37.0 37.0 9 36.544 37.0 37.0 37.0 37.0 37.0 10-14 36.5496 37.0 37.0 37.0 37.0 37.0 15-19 36.5383 37.0 37.0 37.0 37.0 37.0 20-24 36.5372 37.0 37.0 37.0 37.0 37.0 25-29 36.4884 37.0 37.0 37.0 37.0 37.0 30-34 36.48980000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.4307 37.0 37.0 37.0 37.0 37.0 40-44 36.4423 37.0 37.0 37.0 37.0 37.0 45-49 36.4099 37.0 37.0 37.0 37.0 37.0 50-54 36.4094 37.0 37.0 37.0 37.0 37.0 55-59 36.3793 37.0 37.0 37.0 37.0 37.0 60-64 36.338300000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.362300000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.325 37.0 37.0 37.0 37.0 37.0 75-79 36.290099999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.2969 37.0 37.0 37.0 37.0 37.0 85-89 36.2507 37.0 37.0 37.0 37.0 37.0 90-94 36.2505 37.0 37.0 37.0 37.0 37.0 95-99 36.1361 37.0 37.0 37.0 37.0 37.0 100-104 36.2186 37.0 37.0 37.0 37.0 37.0 105-109 36.1315 37.0 37.0 37.0 37.0 37.0 110-114 36.1245 37.0 37.0 37.0 37.0 37.0 115-119 36.1518 37.0 37.0 37.0 37.0 37.0 120-124 36.1132 37.0 37.0 37.0 37.0 37.0 125-129 36.039699999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.9524 37.0 37.0 37.0 37.0 37.0 135-139 35.9963 37.0 37.0 37.0 37.0 37.0 140-144 35.901500000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.8781 37.0 37.0 37.0 37.0 37.0 150-151 35.43 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 0.0 25 1.0 26 7.0 27 10.0 28 9.0 29 15.0 30 29.0 31 23.0 32 47.0 33 83.0 34 116.0 35 311.0 36 2975.0 37 372.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.15 17.825 11.15 38.875 2 20.39127163280662 22.824178580386256 38.04865813895159 18.735891647855528 3 18.224999999999998 28.225 28.9 24.65 4 19.900000000000002 35.625 23.875 20.599999999999998 5 21.0 37.675 23.724999999999998 17.599999999999998 6 17.375 37.125 24.925 20.575 7 12.950000000000001 21.725 45.975 19.35 8 18.55 21.05 29.625 30.775000000000002 9 17.4 21.775 33.4 27.425 10-14 19.765 28.384999999999998 27.150000000000002 24.7 15-19 19.275000000000002 28.34 28.27 24.115000000000002 20-24 19.81 28.110000000000003 28.025 24.055 25-29 20.155 28.7 27.334999999999997 23.810000000000002 30-34 19.54 28.77 27.529999999999998 24.16 35-39 19.744999999999997 27.97 28.335 23.95 40-44 19.775000000000002 28.63 27.54 24.055 45-49 20.315 28.625 26.965 24.095 50-54 19.68 29.2 27.810000000000002 23.31 55-59 20.005 28.68 26.97 24.345 60-64 20.335 28.355000000000004 28.444999999999997 22.865 65-69 20.23 28.33 28.02 23.419999999999998 70-74 19.84 28.775000000000002 28.000000000000004 23.385 75-79 20.01 28.74 27.565 23.685000000000002 80-84 20.4 28.235 27.845 23.52 85-89 20.57 28.205000000000002 27.565 23.66 90-94 20.395 28.27 27.68 23.655 95-99 20.365 28.48 27.675 23.48 100-104 20.36 28.615000000000002 27.61 23.415 105-109 19.975 27.965 27.965 24.095 110-114 20.03 28.799999999999997 27.33 23.84 115-119 20.345 28.82 27.389999999999997 23.445 120-124 20.91 27.794999999999998 27.694999999999997 23.599999999999998 125-129 20.46 28.09 27.900000000000002 23.549999999999997 130-134 20.8 28.365000000000002 27.73 23.105 135-139 21.529999999999998 28.044999999999998 27.279999999999998 23.145 140-144 20.65 27.77 28.015 23.565 145-149 21.115000000000002 28.48 27.32 23.085 150-151 20.599999999999998 29.075 26.237500000000004 24.087500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 2.5 22 2.0 23 1.0 24 1.5 25 3.0 26 5.0 27 11.5 28 12.0 29 13.0 30 23.0 31 28.5 32 35.0 33 42.0 34 63.0 35 90.0 36 100.5 37 113.5 38 136.5 39 158.0 40 177.5 41 210.5 42 250.5 43 270.0 44 260.5 45 255.0 46 254.0 47 254.5 48 249.0 49 202.5 50 158.0 51 137.0 52 114.5 53 85.5 54 74.0 55 61.5 56 42.5 57 31.0 58 19.0 59 16.5 60 13.5 61 8.5 62 4.0 63 2.5 64 2.0 65 1.0 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.575 #Duplication Level Percentage of deduplicated Percentage of total 1 93.58803099118354 87.575 2 6.011220945765429 11.25 3 0.3473149879775581 0.975 4 0.05343307507347048 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.23750000000000002 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.425 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.7124999999999999 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.925 0.0 0.0 0.0 0.0 118-119 0.975 0.0 0.0 0.0 0.0 120-121 1.0375 0.0 0.0 0.0 0.0 122-123 1.0875 0.0 0.0 0.0 0.0 124-125 1.3125 0.0 0.0 0.0 0.0 126-127 1.45 0.0 0.0 0.0 0.0 128-129 1.6375 0.0 0.0 0.0 0.0 130-131 1.8125 0.0 0.0 0.0 0.0 132-133 2.0625 0.0 0.0 0.0 0.0 134-135 2.2125 0.0 0.0 0.0 0.0 136-137 2.5375 0.0 0.0 0.0 0.0 138-139 2.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTAAGGA 10 0.006830828 145.0 7 AAAGTCA 10 0.006830828 145.0 4 >>END_MODULE SRR12671713 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671713_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2295 37.0 37.0 37.0 37.0 37.0 2 35.978 37.0 37.0 37.0 37.0 37.0 3 36.0935 37.0 37.0 37.0 37.0 37.0 4 36.0325 37.0 37.0 37.0 37.0 37.0 5 36.2475 37.0 37.0 37.0 37.0 37.0 6 36.2265 37.0 37.0 37.0 37.0 37.0 7 36.1945 37.0 37.0 37.0 37.0 37.0 8 36.231 37.0 37.0 37.0 37.0 37.0 9 36.179 37.0 37.0 37.0 37.0 37.0 10-14 36.234 37.0 37.0 37.0 37.0 37.0 15-19 36.1912 37.0 37.0 37.0 37.0 37.0 20-24 36.1547 37.0 37.0 37.0 37.0 37.0 25-29 36.1314 37.0 37.0 37.0 37.0 37.0 30-34 36.10359999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.042199999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.004900000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.0231 37.0 37.0 37.0 37.0 37.0 50-54 35.9937 37.0 37.0 37.0 37.0 37.0 55-59 35.9677 37.0 37.0 37.0 37.0 37.0 60-64 35.9197 37.0 37.0 37.0 37.0 37.0 65-69 35.864200000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.885000000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.7925 37.0 37.0 37.0 37.0 37.0 80-84 35.87650000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.735 37.0 37.0 37.0 37.0 37.0 90-94 35.7547 37.0 37.0 37.0 37.0 37.0 95-99 35.745999999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.7055 37.0 37.0 37.0 37.0 37.0 105-109 35.6583 37.0 37.0 37.0 37.0 37.0 110-114 35.590999999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.601 37.0 37.0 37.0 37.0 37.0 120-124 35.5795 37.0 37.0 37.0 37.0 37.0 125-129 35.4916 37.0 37.0 37.0 34.6 37.0 130-134 35.527699999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.53830000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.200199999999995 37.0 37.0 37.0 32.2 37.0 145-149 35.32899999999999 37.0 37.0 37.0 34.6 37.0 150-151 34.922 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 1.0 15 1.0 16 0.0 17 0.0 18 2.0 19 1.0 20 1.0 21 1.0 22 3.0 23 5.0 24 8.0 25 8.0 26 12.0 27 20.0 28 20.0 29 18.0 30 35.0 31 44.0 32 82.0 33 133.0 34 199.0 35 539.0 36 2638.0 37 227.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.849999999999994 19.55 14.35 31.25 2 26.75 23.549999999999997 35.0 14.7 3 19.075 27.725 31.95 21.25 4 21.475 37.15 22.625 18.75 5 22.900000000000002 37.35 22.325 17.424999999999997 6 19.275000000000002 38.05 23.375 19.3 7 16.825000000000003 18.475 43.575 21.125 8 20.625 24.3 26.1 28.975 9 21.675 24.175 28.999999999999996 25.15 10-14 22.650000000000002 28.835 26.884999999999998 21.63 15-19 22.435 27.83 28.125 21.61 20-24 22.515 28.665000000000003 27.615000000000002 21.205 25-29 22.25 28.485 28.08 21.185000000000002 30-34 22.125 28.305000000000003 28.205000000000002 21.365000000000002 35-39 22.33 28.575 27.51 21.584999999999997 40-44 22.175 27.694999999999997 28.294999999999998 21.834999999999997 45-49 21.73 28.275 28.51 21.485000000000003 50-54 22.814999999999998 27.33 28.349999999999998 21.505 55-59 22.945 27.755000000000003 28.075 21.224999999999998 60-64 23.044999999999998 27.265 28.060000000000002 21.63 65-69 22.36 27.105 28.794999999999998 21.740000000000002 70-74 22.939999999999998 28.33 27.11 21.62 75-79 22.62 28.075 27.74 21.565 80-84 22.939999999999998 27.884999999999998 27.775 21.4 85-89 22.8 27.845 28.16 21.195 90-94 22.905 27.905 27.955000000000002 21.235 95-99 22.665 27.810000000000002 27.779999999999998 21.745 100-104 23.13 27.694999999999997 28.185 20.990000000000002 105-109 23.26 27.565 27.985 21.19 110-114 23.385 27.1 28.360000000000003 21.154999999999998 115-119 23.91 27.355 28.060000000000002 20.674999999999997 120-124 23.585 27.305 28.189999999999998 20.919999999999998 125-129 24.055 27.24 28.04 20.665 130-134 23.13 27.529999999999998 28.439999999999998 20.9 135-139 24.224999999999998 27.46 27.884999999999998 20.43 140-144 23.995 27.525 27.32 21.16 145-149 24.125 27.73 27.295 20.849999999999998 150-151 24.275 27.1625 27.474999999999998 21.087500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 3.0 21 2.5 22 2.0 23 2.5 24 2.5 25 5.0 26 9.0 27 10.5 28 11.5 29 13.5 30 18.5 31 23.0 32 30.0 33 40.5 34 50.5 35 66.0 36 86.5 37 112.5 38 140.0 39 177.0 40 209.5 41 228.5 42 243.0 43 242.0 44 254.5 45 253.0 46 250.5 47 247.5 48 233.5 49 193.0 50 143.5 51 126.5 52 104.0 53 94.5 54 87.0 55 68.5 56 55.0 57 48.5 58 32.0 59 18.5 60 17.5 61 14.5 62 12.5 63 8.0 64 1.0 65 0.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.5 #Duplication Level Percentage of deduplicated Percentage of total 1 93.68983957219251 87.6 2 5.802139037433155 10.85 3 0.4010695187165776 1.125 4 0.08021390374331551 0.3 5 0.026737967914438502 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.23750000000000002 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.45 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.7375 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 0.95 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.0625 0.0 0.0 0.0 0.0 122-123 1.1124999999999998 0.0 0.0 0.0 0.0 124-125 1.3375 0.0 0.0 0.0 0.0 126-127 1.475 0.0 0.0 0.0 0.0 128-129 1.6625 0.0 0.0 0.0 0.0 130-131 1.8375 0.0 0.0 0.0 0.0 132-133 2.0875 0.0 0.0 0.0 0.0 134-135 2.2375 0.0 0.0 0.0 0.0 136-137 2.5875 0.0 0.0 0.0 0.0 138-139 2.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTCTT 10 0.006830828 145.0 4 ATAATGA 10 0.006830828 145.0 3 >>END_MODULE Read 973947 spots for SRR12671713.sra Written 973947 spots for SRR12671713.sra Read 973947 spots for SRR12671713.sra Written 973947 spots for SRR12671713.sra Read 973947 spots for SRR12671713.sra Written 973947 spots for SRR12671713.sra Read 973947 spots for SRR12671713.sra Written 973947 spots for SRR12671713.sra Read 973947 spots for SRR12671713.sra Written 973947 spots for SRR12671713.sra Read 973947 spots for SRR12671713.sra Written 973947 spots for SRR12671713.sra Read 973947 spots for SRR12671713.sra Written 973947 spots for SRR12671713.sra Read 973947 spots for SRR12671713.sra Written 973947 spots for SRR12671713.sra Read 973947 spots for SRR12671713.sra Written 973947 spots for SRR12671713.sra Read 973947 spots for SRR12671713.sra Written 973947 spots for SRR12671713.sra Read 973947 spots for SRR12671713.sra Written 973947 spots for SRR12671713.sra Read 973947 spots for SRR12671713.sra Written 973947 spots for SRR12671713.sra Read 973949 spots for SRR12671713.sra Written 973949 spots for SRR12671713.sra Read 973947 spots for SRR12671713.sra Written 973947 spots for SRR12671713.sra Read 973947 spots for SRR12671713.sra Written 973947 spots for SRR12671713.sra Read 973947 spots for SRR12671713.sra Written 973947 spots for SRR12671713.sra Read 973947 spots for SRR12671713.sra Written 973947 spots for SRR12671713.sra Read 973947 spots for SRR12671713.sra Written 973947 spots for SRR12671713.sra Read 973947 spots for SRR12671713.sra Written 973947 spots for SRR12671713.sra Read 973947 spots for SRR12671713.sra Written 973947 spots for SRR12671713.sra SRR ids: ['SRR12671713.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lyy0t456 SRR12671713.sra spots: 19478942 blocks: [[1, 973947], [973948, 1947894], [1947895, 2921841], [2921842, 3895788], [3895789, 4869735], [4869736, 5843682], [5843683, 6817629], [6817630, 7791576], [7791577, 8765523], [8765524, 9739470], [9739471, 10713417], [10713418, 11687364], [11687365, 12661311], [12661312, 13635258], [13635259, 14609205], [14609206, 15583152], [15583153, 16557099], [16557100, 17531046], [17531047, 18504993], [18504994, 19478942]] SRR12671713 file size 6598096 SRR12671713 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671713 SRR12671713_1.fastq SRR12671713_2.fastq Input file: SRR12671713_1.fastq Paired file: SRR12671713_2.fastq trimmed: SRR12671713-trimmed-pair1.fastq, SRR12671713-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:49:51 2025 >> started Wed Feb 12 05:50:11 2025 >> done (20.254s) 19478942 read pairs processed; of these: 18 ( 0.00%) short read pairs filtered out after trimming by size control 1247 ( 0.01%) empty read pairs filtered out after trimming by size control 19477677 (99.99%) read pairs available; of these: 984728 ( 5.06%) trimmed read pairs available after processing 18492949 (94.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 0 0.00% 21 3 0.00% 22 5 0.00% 23 3 0.00% 24 5 0.00% 25 1 0.00% 26 5 0.00% 27 6 0.00% 28 4 0.00% 29 9 0.00% 30 9 0.00% 31 8 0.00% 32 9 0.00% 33 12 0.00% 34 7 0.00% 35 8 0.00% 36 8 0.00% 37 15 0.00% 38 12 0.00% 39 18 0.00% 40 16 0.00% 41 26 0.00% 42 17 0.00% 43 29 0.00% 44 23 0.00% 45 30 0.00% 46 21 0.00% 47 36 0.00% 48 33 0.00% 49 41 0.00% 50 35 0.00% 51 51 0.00% 52 55 0.00% 53 53 0.00% 54 57 0.00% 55 66 0.00% 56 65 0.00% 57 78 0.00% 58 68 0.00% 59 94 0.00% 60 98 0.00% 61 112 0.00% 62 151 0.00% 63 147 0.00% 64 177 0.00% 65 166 0.00% 66 169 0.00% 67 192 0.00% 68 220 0.00% 69 237 0.00% 70 288 0.00% 71 323 0.00% 72 397 0.00% 73 440 0.00% 74 471 0.00% 75 497 0.00% 76 587 0.00% 77 578 0.00% 78 602 0.00% 79 766 0.00% 80 833 0.00% 81 952 0.00% 82 1117 0.01% 83 1315 0.01% 84 1433 0.01% 85 1626 0.01% 86 1714 0.01% 87 1780 0.01% 88 1884 0.01% 89 1973 0.01% 90 2262 0.01% 91 2583 0.01% 92 2895 0.01% 93 3343 0.02% 94 3590 0.02% 95 3878 0.02% 96 3886 0.02% 97 4180 0.02% 98 4337 0.02% 99 4537 0.02% 100 4795 0.02% 101 5437 0.03% 102 5991 0.03% 103 6517 0.03% 104 6954 0.04% 105 7456 0.04% 106 7672 0.04% 107 7975 0.04% 108 8103 0.04% 109 8353 0.04% 110 8724 0.04% 111 9503 0.05% 112 10082 0.05% 113 10768 0.06% 114 11504 0.06% 115 12342 0.06% 116 12414 0.06% 117 12713 0.07% 118 13050 0.07% 119 13287 0.07% 120 13845 0.07% 121 14184 0.07% 122 15029 0.08% 123 16188 0.08% 124 17049 0.09% 125 17862 0.09% 126 18715 0.10% 127 18819 0.10% 128 18720 0.10% 129 19104 0.10% 130 19386 0.10% 131 20021 0.10% 132 21143 0.11% 133 22647 0.12% 134 23314 0.12% 135 24878 0.13% 136 25339 0.13% 137 25768 0.13% 138 25842 0.13% 139 26097 0.13% 140 26465 0.14% 141 26925 0.14% 142 27626 0.14% 143 28949 0.15% 144 30456 0.16% 145 32068 0.16% 146 32811 0.17% 147 33291 0.17% 148 33752 0.17% 149 33485 0.17% 150 33529 0.17% 151 18492949 94.94% 19477677 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=20 prefix-density=0.54 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=76.19 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=4.6 sequence=AAAGCAGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCA criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=28 prefix-density=0.76 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=32 fanout-score=20.72 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=7.3 sequence=AAGGCCAAGATCCAGGACAAGGA SRR12671713 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:50:51 Started mapping on | Feb 12 05:50:52 Finished on | Feb 12 05:52:49 Mapping speed, Million of reads per hour | 599.31 Number of input reads | 19477677 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 18243122 Uniquely mapped reads % | 93.66% Average mapped length | 298.46 Number of splices: Total | 18558103 Number of splices: Annotated (sjdb) | 18171730 Number of splices: GT/AG | 18185457 Number of splices: GC/AG | 311124 Number of splices: AT/AC | 10967 Number of splices: Non-canonical | 50555 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 440275 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 60455 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.67% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 794280 794280 794280 N_multimapping 440275 440275 440275 N_noFeature 692826 17985117 782422 N_ambiguous 293607 1066 124655 UnstrandedReadsAssigned:17256689 PositiveStrandReadsAssigned:256939 NegativeStrandReadsAssigned:17336045 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671713 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671713-trimmed-pair1.fastq SRR12671713-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,477,677 reads, 17,344,330 reads pseudoaligned [quant] estimated average fragment length: 309.905 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR12671713.ke.tsv 34699 SRR12671713.se.tsv 87100 total ==> SRR12671713.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1709.09 865 28.5788 Potri.005G024800.1.v4.1 1035 726.095 298 23.1748 Potri.004G059700.1.v4.1 961 652.922 16 1.38373 Potri.007G009000.2.v4.1 1416 1107.09 0 0 Potri.003G141000.2.v4.1 2943 2634.09 777 16.6565 Potri.016G087400.1.v4.1 270 74.5344 659 499.254 Potri.015G069301.1.v4.1 564 287.312 0 0 Potri.010G195200.1.v4.1 1773 1464.09 119 4.58956 Potri.012G127500.1.v4.1 977 668.563 199 16.8075 ==> SRR12671713.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 299 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 265 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 40 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR12671713 completed mapping pipeline successfully