Starting /dee2/code/volunteer_pipeline.sh SRR12671714 current disk space = 3049632624640 free memory = 1579220740 SRR12671714 SRAfilesize 68e7f1549b2f89d1d706498d40b9c9a3 SRR12671714.sra SRR12671714.sra file validated SRR12671714 is paired end SRR12671714 is conventional basespace SRR12671714 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671714_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.389 37.0 37.0 37.0 37.0 37.0 2 36.2325 37.0 37.0 37.0 37.0 37.0 3 36.478 37.0 37.0 37.0 37.0 37.0 4 36.5815 37.0 37.0 37.0 37.0 37.0 5 36.556 37.0 37.0 37.0 37.0 37.0 6 36.463 37.0 37.0 37.0 37.0 37.0 7 36.5235 37.0 37.0 37.0 37.0 37.0 8 36.585 37.0 37.0 37.0 37.0 37.0 9 36.56 37.0 37.0 37.0 37.0 37.0 10-14 36.562799999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.57610000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.539699999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.4919 37.0 37.0 37.0 37.0 37.0 30-34 36.485400000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.4733 37.0 37.0 37.0 37.0 37.0 40-44 36.481399999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.429100000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.446 37.0 37.0 37.0 37.0 37.0 55-59 36.428700000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.4317 37.0 37.0 37.0 37.0 37.0 65-69 36.3827 37.0 37.0 37.0 37.0 37.0 70-74 36.372699999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.3526 37.0 37.0 37.0 37.0 37.0 80-84 36.2839 37.0 37.0 37.0 37.0 37.0 85-89 36.3504 37.0 37.0 37.0 37.0 37.0 90-94 36.334199999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.2164 37.0 37.0 37.0 37.0 37.0 100-104 36.2466 37.0 37.0 37.0 37.0 37.0 105-109 36.2421 37.0 37.0 37.0 37.0 37.0 110-114 36.1565 37.0 37.0 37.0 37.0 37.0 115-119 36.198899999999995 37.0 37.0 37.0 37.0 37.0 120-124 36.1661 37.0 37.0 37.0 37.0 37.0 125-129 36.13719999999999 37.0 37.0 37.0 37.0 37.0 130-134 36.08219999999999 37.0 37.0 37.0 37.0 37.0 135-139 36.0193 37.0 37.0 37.0 37.0 37.0 140-144 35.9656 37.0 37.0 37.0 37.0 37.0 145-149 35.974799999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.452 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 0.0 26 6.0 27 6.0 28 8.0 29 12.0 30 22.0 31 29.0 32 53.0 33 61.0 34 107.0 35 304.0 36 2992.0 37 398.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.75 12.225 11.1 43.925 2 19.252008032128515 19.854417670682732 38.278112449799195 22.615461847389557 3 18.65 24.95 27.375 29.025000000000002 4 22.825 33.050000000000004 20.7 23.425 5 21.875 34.849999999999994 25.174999999999997 18.099999999999998 6 18.4 35.675000000000004 25.45 20.474999999999998 7 14.475 21.525 45.175 18.825 8 16.650000000000002 22.7 30.525000000000002 30.125 9 17.375 23.674999999999997 32.75 26.200000000000003 10-14 19.56 29.325000000000003 26.405 24.709999999999997 15-19 19.91 27.815 27.58 24.695 20-24 20.515 28.485 27.01 23.990000000000002 25-29 19.91 28.725 27.57 23.794999999999998 30-34 20.445 28.105000000000004 27.275 24.175 35-39 20.085 28.525 27.229999999999997 24.16 40-44 20.06 29.015 27.275 23.65 45-49 20.044999999999998 28.165000000000003 27.445000000000004 24.345 50-54 20.36 27.79 28.035 23.815 55-59 20.369999999999997 28.82 27.060000000000002 23.75 60-64 20.285 28.315 27.41 23.990000000000002 65-69 20.630000000000003 28.050000000000004 27.544999999999998 23.775 70-74 20.265 27.82 27.894999999999996 24.02 75-79 20.69 28.015 27.175 24.12 80-84 20.005 28.084999999999997 27.450000000000003 24.46 85-89 20.385 28.499999999999996 27.465 23.65 90-94 20.225 28.365000000000002 27.205000000000002 24.205 95-99 20.835 27.74 27.755000000000003 23.669999999999998 100-104 20.76 27.735 27.325 24.18 105-109 20.45 27.500000000000004 28.27 23.78 110-114 20.630000000000003 28.18 27.345000000000002 23.845 115-119 20.68 27.99 27.455000000000002 23.875 120-124 21.04 28.225 27.55 23.185 125-129 20.65 28.110000000000003 27.36 23.880000000000003 130-134 20.830000000000002 28.265 27.415 23.49 135-139 21.060000000000002 27.825 27.355 23.76 140-144 20.625 27.584999999999997 27.72 24.07 145-149 21.46 28.060000000000002 27.24 23.24 150-151 20.825 28.749999999999996 26.737499999999997 23.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 1.5 23 1.5 24 2.0 25 4.5 26 5.5 27 6.0 28 6.0 29 6.5 30 16.5 31 32.5 32 41.5 33 42.5 34 44.5 35 62.5 36 81.0 37 113.0 38 142.0 39 151.5 40 184.5 41 209.0 42 210.5 43 235.5 44 252.5 45 257.5 46 265.5 47 251.5 48 224.0 49 211.5 50 187.0 51 152.5 52 135.5 53 110.5 54 86.0 55 58.5 56 46.0 57 40.0 58 27.0 59 23.0 60 20.0 61 15.0 62 11.5 63 8.5 64 5.5 65 3.5 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.4 #Duplication Level Percentage of deduplicated Percentage of total 1 92.34307359307358 85.32499999999999 2 7.088744588744589 13.100000000000001 3 0.5681818181818182 1.575 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.07500000000000001 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.6 0.0 0.0 0.0 0.0 118-119 0.6875 0.0 0.0 0.0 0.0 120-121 0.7625 0.0 0.0 0.0 0.0 122-123 0.8375 0.0 0.0 0.0 0.0 124-125 1.0875 0.0 0.0 0.0 0.0 126-127 1.2125 0.0 0.0 0.0 0.0 128-129 1.3250000000000002 0.0 0.0 0.0 0.0 130-131 1.4249999999999998 0.0 0.0 0.0 0.0 132-133 1.5499999999999998 0.0 0.0 0.0 0.0 134-135 1.6375 0.0 0.0 0.0 0.0 136-137 1.775 0.0 0.0 0.0 0.0 138-139 1.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCTCTT 10 0.006830828 145.0 4 >>END_MODULE SRR12671714 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671714_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1595 37.0 37.0 37.0 37.0 37.0 2 36.0045 37.0 37.0 37.0 37.0 37.0 3 36.068 37.0 37.0 37.0 37.0 37.0 4 36.1475 37.0 37.0 37.0 37.0 37.0 5 36.245 37.0 37.0 37.0 37.0 37.0 6 36.096 37.0 37.0 37.0 37.0 37.0 7 36.223 37.0 37.0 37.0 37.0 37.0 8 36.304 37.0 37.0 37.0 37.0 37.0 9 36.231 37.0 37.0 37.0 37.0 37.0 10-14 36.2236 37.0 37.0 37.0 37.0 37.0 15-19 36.1884 37.0 37.0 37.0 37.0 37.0 20-24 36.1703 37.0 37.0 37.0 37.0 37.0 25-29 36.093900000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.0637 37.0 37.0 37.0 37.0 37.0 35-39 36.0328 37.0 37.0 37.0 37.0 37.0 40-44 36.066500000000005 37.0 37.0 37.0 37.0 37.0 45-49 35.9632 37.0 37.0 37.0 37.0 37.0 50-54 35.9808 37.0 37.0 37.0 37.0 37.0 55-59 35.9545 37.0 37.0 37.0 37.0 37.0 60-64 35.921800000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.8084 37.0 37.0 37.0 37.0 37.0 70-74 35.8463 37.0 37.0 37.0 37.0 37.0 75-79 35.7985 37.0 37.0 37.0 37.0 37.0 80-84 35.7481 37.0 37.0 37.0 37.0 37.0 85-89 35.6863 37.0 37.0 37.0 37.0 37.0 90-94 35.6817 37.0 37.0 37.0 37.0 37.0 95-99 35.74929999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.7102 37.0 37.0 37.0 37.0 37.0 105-109 35.710300000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.5865 37.0 37.0 37.0 37.0 37.0 115-119 35.534200000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.5903 37.0 37.0 37.0 37.0 37.0 125-129 35.5056 37.0 37.0 37.0 37.0 37.0 130-134 35.56230000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.472 37.0 37.0 37.0 37.0 37.0 140-144 35.2308 37.0 37.0 37.0 32.2 37.0 145-149 35.3271 37.0 37.0 37.0 34.6 37.0 150-151 34.92425 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 1.0 15 0.0 16 2.0 17 0.0 18 3.0 19 0.0 20 0.0 21 1.0 22 2.0 23 6.0 24 5.0 25 6.0 26 7.0 27 11.0 28 17.0 29 17.0 30 36.0 31 54.0 32 75.0 33 128.0 34 232.0 35 607.0 36 2583.0 37 201.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.55 17.849999999999998 15.45 31.15 2 26.0 23.375 33.875 16.75 3 20.075000000000003 26.224999999999998 32.324999999999996 21.375 4 23.1 37.475 20.925 18.5 5 23.849999999999998 37.7 21.575 16.875 6 17.775 38.4 24.45 19.375 7 18.15 17.7 42.225 21.925 8 20.0 23.200000000000003 28.4 28.4 9 22.125 24.175 29.15 24.55 10-14 22.75 28.675 26.790000000000003 21.785 15-19 22.73 26.919999999999998 28.53 21.82 20-24 22.795 28.125 27.61 21.47 25-29 22.62 28.345 28.075 20.96 30-34 22.015 27.21 28.405 22.37 35-39 22.975 27.675 27.834999999999997 21.515 40-44 23.13 27.685 28.1 21.085 45-49 22.41 28.04 27.584999999999997 21.965 50-54 23.265 27.275 27.894999999999996 21.565 55-59 22.900000000000002 26.895000000000003 28.439999999999998 21.765 60-64 22.82 27.384999999999998 27.950000000000003 21.845 65-69 22.905 27.91 27.08 22.105 70-74 22.88 27.834999999999997 27.505000000000003 21.78 75-79 23.09 27.245 27.975 21.69 80-84 23.18 27.495000000000005 27.255000000000003 22.07 85-89 24.05 26.955000000000002 27.515 21.48 90-94 22.74 27.73 28.34 21.19 95-99 23.27 28.084999999999997 27.485 21.16 100-104 23.395 27.32 27.565 21.72 105-109 23.400000000000002 26.895000000000003 27.839999999999996 21.865000000000002 110-114 23.119999999999997 27.889999999999997 27.415 21.575 115-119 24.315 27.35 27.365000000000002 20.97 120-124 23.935000000000002 27.975 26.924999999999997 21.165 125-129 23.93 28.134999999999998 26.825 21.11 130-134 23.665 27.24 27.98 21.115000000000002 135-139 23.810000000000002 27.71 27.46 21.02 140-144 24.09 27.42 27.555000000000003 20.935000000000002 145-149 24.39 27.775 27.13 20.705000000000002 150-151 25.087500000000002 27.825 26.6625 20.424999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.0 22 1.0 23 1.5 24 1.0 25 3.0 26 4.0 27 5.5 28 12.0 29 16.5 30 18.5 31 24.5 32 26.5 33 29.0 34 47.5 35 64.0 36 78.5 37 100.5 38 120.5 39 151.0 40 188.0 41 224.5 42 225.0 43 240.0 44 264.0 45 269.0 46 269.0 47 251.5 48 236.5 49 204.5 50 178.0 51 152.5 52 114.5 53 96.0 54 92.5 55 74.5 56 53.5 57 40.5 58 26.5 59 19.5 60 17.5 61 12.5 62 15.0 63 11.5 64 4.5 65 2.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.5 96 1.0 97 0.5 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.975 #Duplication Level Percentage of deduplicated Percentage of total 1 92.226148409894 84.82499999999999 2 7.012775210655069 12.9 3 0.6795324816526229 1.875 4 0.0 0.0 5 0.05436259853220984 0.25 6 0.02718129926610492 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 6 0.15 No Hit CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCA 5 0.125 No Hit GGGAGCACTGCATAGCTTACAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.07500000000000001 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.6 0.0 0.0 0.0 0.0 118-119 0.6875 0.0 0.0 0.0 0.0 120-121 0.7875000000000001 0.0 0.0 0.0 0.0 122-123 0.8625 0.0 0.0 0.0 0.0 124-125 1.1 0.0 0.0 0.0 0.0 126-127 1.2125 0.0 0.0 0.0 0.0 128-129 1.3250000000000002 0.0 0.0 0.0 0.0 130-131 1.4249999999999998 0.0 0.0 0.0 0.0 132-133 1.5499999999999998 0.0 0.0 0.0 0.0 134-135 1.6375 0.0 0.0 0.0 0.0 136-137 1.775 0.0 0.0 0.0 0.0 138-139 1.9749999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTGAG 10 0.006830828 145.0 145 TTTGATC 10 0.006830828 145.0 2 >>END_MODULE Read 1280143 spots for SRR12671714.sra Written 1280143 spots for SRR12671714.sra Read 1280143 spots for SRR12671714.sra Written 1280143 spots for SRR12671714.sra Read 1280143 spots for SRR12671714.sra Written 1280143 spots for SRR12671714.sra Read 1280143 spots for SRR12671714.sra Written 1280143 spots for SRR12671714.sra Read 1280143 spots for SRR12671714.sra Written 1280143 spots for SRR12671714.sra Read 1280143 spots for SRR12671714.sra Written 1280143 spots for SRR12671714.sra Read 1280143 spots for SRR12671714.sra Written 1280143 spots for SRR12671714.sra Read 1280143 spots for SRR12671714.sra Written 1280143 spots for SRR12671714.sra Read 1280143 spots for SRR12671714.sra Written 1280143 spots for SRR12671714.sra Read 1280162 spots for SRR12671714.sra Written 1280162 spots for SRR12671714.sra Read 1280143 spots for SRR12671714.sra Written 1280143 spots for SRR12671714.sra Read 1280143 spots for SRR12671714.sra Written 1280143 spots for SRR12671714.sra Read 1280143 spots for SRR12671714.sra Written 1280143 spots for SRR12671714.sra Read 1280143 spots for SRR12671714.sra Written 1280143 spots for SRR12671714.sra Read 1280143 spots for SRR12671714.sra Written 1280143 spots for SRR12671714.sra Read 1280143 spots for SRR12671714.sra Written 1280143 spots for SRR12671714.sra Read 1280143 spots for SRR12671714.sra Written 1280143 spots for SRR12671714.sra Read 1280143 spots for SRR12671714.sra Written 1280143 spots for SRR12671714.sra Read 1280143 spots for SRR12671714.sra Written 1280143 spots for SRR12671714.sra Read 1280143 spots for SRR12671714.sra Written 1280143 spots for SRR12671714.sra SRR ids: ['SRR12671714.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ku8_ajhw SRR12671714.sra spots: 25602879 blocks: [[1, 1280143], [1280144, 2560286], [2560287, 3840429], [3840430, 5120572], [5120573, 6400715], [6400716, 7680858], [7680859, 8961001], [8961002, 10241144], [10241145, 11521287], [11521288, 12801430], [12801431, 14081573], [14081574, 15361716], [15361717, 16641859], [16641860, 17922002], [17922003, 19202145], [19202146, 20482288], [20482289, 21762431], [21762432, 23042574], [23042575, 24322717], [24322718, 25602879]] SRR12671714 file size 8679278 SRR12671714 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671714 SRR12671714_1.fastq SRR12671714_2.fastq Input file: SRR12671714_1.fastq Paired file: SRR12671714_2.fastq trimmed: SRR12671714-trimmed-pair1.fastq, SRR12671714-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:48:15 2025 >> started Wed Feb 12 05:48:43 2025 >> done (28.472s) 25602879 read pairs processed; of these: 13 ( 0.00%) short read pairs filtered out after trimming by size control 1655 ( 0.01%) empty read pairs filtered out after trimming by size control 25601211 (99.99%) read pairs available; of these: 905287 ( 3.54%) trimmed read pairs available after processing 24695924 (96.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 2 0.00% 21 4 0.00% 22 5 0.00% 23 2 0.00% 24 7 0.00% 25 5 0.00% 26 2 0.00% 27 12 0.00% 28 7 0.00% 29 9 0.00% 30 5 0.00% 31 8 0.00% 32 7 0.00% 33 14 0.00% 34 13 0.00% 35 14 0.00% 36 18 0.00% 37 16 0.00% 38 25 0.00% 39 20 0.00% 40 28 0.00% 41 19 0.00% 42 25 0.00% 43 22 0.00% 44 29 0.00% 45 33 0.00% 46 44 0.00% 47 26 0.00% 48 37 0.00% 49 35 0.00% 50 54 0.00% 51 49 0.00% 52 42 0.00% 53 59 0.00% 54 49 0.00% 55 62 0.00% 56 78 0.00% 57 72 0.00% 58 92 0.00% 59 86 0.00% 60 104 0.00% 61 108 0.00% 62 116 0.00% 63 115 0.00% 64 153 0.00% 65 161 0.00% 66 151 0.00% 67 204 0.00% 68 210 0.00% 69 222 0.00% 70 210 0.00% 71 310 0.00% 72 314 0.00% 73 331 0.00% 74 367 0.00% 75 437 0.00% 76 502 0.00% 77 470 0.00% 78 546 0.00% 79 649 0.00% 80 698 0.00% 81 748 0.00% 82 940 0.00% 83 934 0.00% 84 1118 0.00% 85 1239 0.00% 86 1376 0.01% 87 1438 0.01% 88 1573 0.01% 89 1751 0.01% 90 1935 0.01% 91 2029 0.01% 92 2245 0.01% 93 2546 0.01% 94 2836 0.01% 95 3004 0.01% 96 3193 0.01% 97 3407 0.01% 98 3637 0.01% 99 3885 0.02% 100 4205 0.02% 101 4421 0.02% 102 4807 0.02% 103 5322 0.02% 104 5409 0.02% 105 5702 0.02% 106 6287 0.02% 107 6473 0.03% 108 6963 0.03% 109 7255 0.03% 110 7675 0.03% 111 8206 0.03% 112 8419 0.03% 113 8772 0.03% 114 9526 0.04% 115 10030 0.04% 116 10336 0.04% 117 10793 0.04% 118 11360 0.04% 119 11553 0.05% 120 12314 0.05% 121 12912 0.05% 122 13202 0.05% 123 14019 0.05% 124 14783 0.06% 125 15368 0.06% 126 15891 0.06% 127 16466 0.06% 128 16993 0.07% 129 17473 0.07% 130 18273 0.07% 131 18903 0.07% 132 19539 0.08% 133 20955 0.08% 134 21384 0.08% 135 22408 0.09% 136 23214 0.09% 137 23744 0.09% 138 24219 0.09% 139 25102 0.10% 140 25667 0.10% 141 26748 0.10% 142 27439 0.11% 143 28491 0.11% 144 30551 0.12% 145 30668 0.12% 146 32318 0.13% 147 32819 0.13% 148 33357 0.13% 149 34289 0.13% 150 34912 0.14% 151 24695924 96.46% 25601211 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=25 prefix-density=0.57 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=97.81 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.5 sequence=CAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.94 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=32 prefix-density=0.95 prefix-fanout=2.0 sequence=AACCGCACCCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=65.80 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=2.9 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT SRR12671714 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:49:24 Started mapping on | Feb 12 05:49:24 Finished on | Feb 12 05:52:00 Mapping speed, Million of reads per hour | 590.80 Number of input reads | 25601211 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 24183660 Uniquely mapped reads % | 94.46% Average mapped length | 299.30 Number of splices: Total | 24776842 Number of splices: Annotated (sjdb) | 24305661 Number of splices: GT/AG | 24284610 Number of splices: GC/AG | 409532 Number of splices: AT/AC | 15248 Number of splices: Non-canonical | 67452 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 607469 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 155656 % of reads mapped to too many loci | 0.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.42% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 810082 810082 810082 N_multimapping 607469 607469 607469 N_noFeature 816265 23803006 926504 N_ambiguous 439486 1718 168176 UnstrandedReadsAssigned:22927909 PositiveStrandReadsAssigned:378936 NegativeStrandReadsAssigned:23088980 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671714 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671714-trimmed-pair1.fastq SRR12671714-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,601,211 reads, 23,038,198 reads pseudoaligned [quant] estimated average fragment length: 308.498 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,145 rounds 52401 SRR12671714.ke.tsv 34699 SRR12671714.se.tsv 87100 total ==> SRR12671714.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1710.5 1144 25.039 Potri.005G024800.1.v4.1 1035 727.502 514 26.4511 Potri.004G059700.1.v4.1 961 654.133 0 0 Potri.007G009000.2.v4.1 1416 1108.5 0 0 Potri.003G141000.2.v4.1 2943 2635.5 1401 19.9017 Potri.016G087400.1.v4.1 270 67.4399 1298 720.564 Potri.015G069301.1.v4.1 564 283.953 0 0 Potri.010G195200.1.v4.1 1773 1465.5 124 3.16775 Potri.012G127500.1.v4.1 977 669.841 135 7.54531 ==> SRR12671714.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 107 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 251 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR12671714 completed mapping pipeline successfully