Starting /dee2/code/volunteer_pipeline.sh SRR12671715 current disk space = 3048913149952 free memory = 1480724992 SRR12671715 SRAfilesize 885f2fea992902787669f4e46964ad11 SRR12671715.sra SRR12671715.sra file validated SRR12671715 is paired end SRR12671715 is conventional basespace SRR12671715 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671715_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.386 37.0 37.0 37.0 37.0 37.0 2 36.124 37.0 37.0 37.0 37.0 37.0 3 36.48 37.0 37.0 37.0 37.0 37.0 4 36.5145 37.0 37.0 37.0 37.0 37.0 5 36.5255 37.0 37.0 37.0 37.0 37.0 6 36.534 37.0 37.0 37.0 37.0 37.0 7 36.5055 37.0 37.0 37.0 37.0 37.0 8 36.492 37.0 37.0 37.0 37.0 37.0 9 36.4955 37.0 37.0 37.0 37.0 37.0 10-14 36.5185 37.0 37.0 37.0 37.0 37.0 15-19 36.488800000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.541599999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.4698 37.0 37.0 37.0 37.0 37.0 30-34 36.5021 37.0 37.0 37.0 37.0 37.0 35-39 36.466899999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.4203 37.0 37.0 37.0 37.0 37.0 45-49 36.3866 37.0 37.0 37.0 37.0 37.0 50-54 36.398900000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.3453 37.0 37.0 37.0 37.0 37.0 60-64 36.3181 37.0 37.0 37.0 37.0 37.0 65-69 36.3178 37.0 37.0 37.0 37.0 37.0 70-74 36.3152 37.0 37.0 37.0 37.0 37.0 75-79 36.2169 37.0 37.0 37.0 37.0 37.0 80-84 36.264399999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.214999999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.2269 37.0 37.0 37.0 37.0 37.0 95-99 36.1059 37.0 37.0 37.0 37.0 37.0 100-104 36.212300000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.1297 37.0 37.0 37.0 37.0 37.0 110-114 36.1071 37.0 37.0 37.0 37.0 37.0 115-119 36.115899999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.069100000000006 37.0 37.0 37.0 37.0 37.0 125-129 36.0418 37.0 37.0 37.0 37.0 37.0 130-134 35.96079999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.884100000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.8046 37.0 37.0 37.0 37.0 37.0 145-149 35.7694 37.0 37.0 37.0 37.0 37.0 150-151 35.30275 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 3.0 26 3.0 27 11.0 28 13.0 29 14.0 30 25.0 31 38.0 32 51.0 33 77.0 34 131.0 35 331.0 36 2917.0 37 383.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.625 16.725 9.975000000000001 38.675 2 20.291310899045705 22.953289804118533 39.07584128578604 17.67955801104972 3 17.275 27.950000000000003 28.1 26.674999999999997 4 22.225 33.85 22.675 21.25 5 20.3 36.449999999999996 24.725 18.525 6 17.299999999999997 36.675000000000004 24.575 21.45 7 14.7 21.349999999999998 44.5 19.45 8 18.65 22.6 29.45 29.299999999999997 9 17.5 21.3 33.15 28.050000000000004 10-14 19.470000000000002 29.565 26.295 24.67 15-19 20.25 28.015 27.689999999999998 24.044999999999998 20-24 19.7 29.060000000000002 27.265 23.974999999999998 25-29 19.98 28.74 27.894999999999996 23.385 30-34 19.845 28.08 28.155 23.919999999999998 35-39 19.939999999999998 28.735 27.625 23.7 40-44 20.035 28.660000000000004 27.785 23.52 45-49 20.3 28.694999999999997 27.529999999999998 23.474999999999998 50-54 19.755 28.365000000000002 27.765 24.115000000000002 55-59 19.634999999999998 28.345 28.225 23.794999999999998 60-64 19.78 28.38 28.09 23.75 65-69 20.200000000000003 28.71 27.189999999999998 23.9 70-74 20.165 28.58 27.939999999999998 23.315 75-79 19.994999999999997 28.52 27.93 23.555 80-84 20.06 28.189999999999998 28.065 23.685000000000002 85-89 19.98 28.74 27.495000000000005 23.785 90-94 20.93 27.97 27.815 23.285 95-99 20.34 28.310000000000002 27.43 23.919999999999998 100-104 20.169999999999998 28.67 28.084999999999997 23.075000000000003 105-109 20.599999999999998 28.060000000000002 27.345000000000002 23.995 110-114 20.235 28.110000000000003 28.115000000000002 23.54 115-119 21.3 27.900000000000002 27.384999999999998 23.415 120-124 20.845 28.365000000000002 26.634999999999998 24.154999999999998 125-129 20.65 28.475 27.400000000000002 23.474999999999998 130-134 20.65 29.145 26.435 23.77 135-139 21.175 28.65 26.77 23.405 140-144 21.075 28.235 26.72 23.97 145-149 20.93 29.205 26.005 23.86 150-151 21.375 27.725 26.5375 24.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 1.0 15 1.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.0 21 0.5 22 2.0 23 2.5 24 3.0 25 3.5 26 5.0 27 8.0 28 10.0 29 15.0 30 22.0 31 30.5 32 41.5 33 47.0 34 60.0 35 79.0 36 89.5 37 110.5 38 140.5 39 170.5 40 186.5 41 210.0 42 230.0 43 236.0 44 262.5 45 272.5 46 263.0 47 254.0 48 231.5 49 203.0 50 174.5 51 147.0 52 118.5 53 81.0 54 63.0 55 53.0 56 43.0 57 42.5 58 28.0 59 14.5 60 11.0 61 9.0 62 7.0 63 4.0 64 1.5 65 1.5 66 2.5 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.44999999999999996 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.525 #Duplication Level Percentage of deduplicated Percentage of total 1 93.45094894413258 87.4 2 6.2015503875969 11.600000000000001 3 0.32076984763432237 0.8999999999999999 4 0.02673082063619353 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.36250000000000004 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.6625000000000001 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.05 0.0 0.0 0.0 0.0 100-101 1.2000000000000002 0.0 0.0 0.0 0.0 102-103 1.35 0.0 0.0 0.0 0.0 104-105 1.5875 0.0 0.0 0.0 0.0 106-107 1.9125 0.0 0.0 0.0 0.0 108-109 2.175 0.0 0.0 0.0 0.0 110-111 2.375 0.0 0.0 0.0 0.0 112-113 2.625 0.0 0.0 0.0 0.0 114-115 2.8875 0.0 0.0 0.0 0.0 116-117 3.2 0.0 0.0 0.0 0.0 118-119 3.45 0.0 0.0 0.0 0.0 120-121 3.8875 0.0 0.0 0.0 0.0 122-123 4.3375 0.0 0.0 0.0 0.0 124-125 4.8625 0.0 0.0 0.0 0.0 126-127 5.3125 0.0 0.0 0.0 0.0 128-129 5.85 0.0 0.0 0.0 0.0 130-131 6.4375 0.0 0.0 0.0 0.0 132-133 6.7875 0.0 0.0 0.0 0.0 134-135 7.4125 0.0 0.0 0.0 0.0 136-137 8.0875 0.0 0.0 0.0 0.0 138-139 8.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGATA 10 0.006830828 145.0 8 GTGCTGC 10 0.006830828 145.0 6 >>END_MODULE SRR12671715 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671715_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.189 37.0 37.0 37.0 37.0 37.0 2 36.0265 37.0 37.0 37.0 37.0 37.0 3 36.141 37.0 37.0 37.0 37.0 37.0 4 36.0445 37.0 37.0 37.0 37.0 37.0 5 36.282 37.0 37.0 37.0 37.0 37.0 6 36.231 37.0 37.0 37.0 37.0 37.0 7 36.272 37.0 37.0 37.0 37.0 37.0 8 36.263 37.0 37.0 37.0 37.0 37.0 9 36.2645 37.0 37.0 37.0 37.0 37.0 10-14 36.311899999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.272499999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.2271 37.0 37.0 37.0 37.0 37.0 25-29 36.1736 37.0 37.0 37.0 37.0 37.0 30-34 36.1511 37.0 37.0 37.0 37.0 37.0 35-39 36.152300000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.1158 37.0 37.0 37.0 37.0 37.0 45-49 36.0912 37.0 37.0 37.0 37.0 37.0 50-54 36.07000000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.0232 37.0 37.0 37.0 37.0 37.0 60-64 36.0076 37.0 37.0 37.0 37.0 37.0 65-69 35.9781 37.0 37.0 37.0 37.0 37.0 70-74 35.999399999999994 37.0 37.0 37.0 37.0 37.0 75-79 35.87949999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.9465 37.0 37.0 37.0 37.0 37.0 85-89 35.8594 37.0 37.0 37.0 37.0 37.0 90-94 35.8023 37.0 37.0 37.0 37.0 37.0 95-99 35.875800000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.8261 37.0 37.0 37.0 37.0 37.0 105-109 35.79899999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.673899999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.65689999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.6631 37.0 37.0 37.0 37.0 37.0 125-129 35.524499999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.4791 37.0 37.0 37.0 37.0 37.0 135-139 35.36540000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.2004 37.0 37.0 37.0 29.8 37.0 145-149 35.223 37.0 37.0 37.0 32.2 37.0 150-151 34.775000000000006 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 1.0 20 0.0 21 2.0 22 2.0 23 0.0 24 8.0 25 8.0 26 11.0 27 8.0 28 20.0 29 18.0 30 38.0 31 57.0 32 65.0 33 134.0 34 230.0 35 515.0 36 2632.0 37 247.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.375 18.625 12.125 30.875000000000004 2 25.5 24.2 35.725 14.575 3 18.925 29.4 31.125000000000004 20.549999999999997 4 21.65 37.6 22.0 18.75 5 24.025 37.0 21.55 17.424999999999997 6 18.525 37.574999999999996 25.1 18.8 7 17.45 17.424999999999997 42.05 23.075000000000003 8 20.0 23.925 27.200000000000003 28.875 9 21.475 23.7 29.549999999999997 25.275 10-14 22.605 28.815 26.69 21.89 15-19 22.93 28.345 27.650000000000002 21.075 20-24 22.495 28.405 28.07 21.029999999999998 25-29 22.73 28.43 27.834999999999997 21.005 30-34 22.275 28.24 28.09 21.395 35-39 22.095000000000002 28.34 28.139999999999997 21.425 40-44 23.095 27.450000000000003 28.345 21.11 45-49 23.105 27.825 28.155 20.915 50-54 23.25 27.55 28.105000000000004 21.095 55-59 22.95 28.015 27.755000000000003 21.279999999999998 60-64 23.68 27.62 27.495000000000005 21.205 65-69 22.63 28.17 28.455000000000002 20.745 70-74 23.16 27.72 27.83 21.29 75-79 23.32 27.755000000000003 27.915 21.01 80-84 23.13 27.889999999999997 27.92 21.060000000000002 85-89 23.64 27.66 27.555000000000003 21.145 90-94 23.435 28.23 27.505000000000003 20.830000000000002 95-99 23.425 28.815 27.305 20.455000000000002 100-104 23.815 27.875 27.74 20.57 105-109 23.9 28.044999999999998 27.185 20.87 110-114 23.48 28.904999999999998 27.1 20.515 115-119 24.2 27.634999999999998 27.615000000000002 20.549999999999997 120-124 24.255 27.625 26.87 21.25 125-129 24.515 27.43 27.965 20.09 130-134 24.84 28.025 27.07 20.064999999999998 135-139 25.814999999999998 27.589999999999996 27.02 19.575 140-144 25.645 27.915 26.810000000000002 19.63 145-149 26.484999999999996 27.355 26.505000000000003 19.655 150-151 26.474999999999998 27.175 26.787499999999998 19.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 1.0 22 1.5 23 1.5 24 2.0 25 2.5 26 5.0 27 7.0 28 9.0 29 14.0 30 18.0 31 22.0 32 34.0 33 47.5 34 52.0 35 58.5 36 72.0 37 100.0 38 132.0 39 156.0 40 194.0 41 235.0 42 259.0 43 270.5 44 273.0 45 291.5 46 275.0 47 229.0 48 211.0 49 192.0 50 159.0 51 127.0 52 108.5 53 93.0 54 87.5 55 71.0 56 50.0 57 42.5 58 29.5 59 18.5 60 11.0 61 6.5 62 6.5 63 6.0 64 5.0 65 3.5 66 3.0 67 1.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 93.46019833824711 87.175 2 5.976949879388903 11.15 3 0.5092468507102653 1.425 4 0.0 0.0 5 0.05360493165371214 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit CATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.36250000000000004 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.6625000000000001 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.05 0.0 0.0 0.0 0.0 100-101 1.2000000000000002 0.0 0.0 0.0 0.0 102-103 1.35 0.0 0.0 0.0 0.0 104-105 1.6 0.0 0.0 0.0 0.0 106-107 1.9375 0.0 0.0 0.0 0.0 108-109 2.2 0.0 0.0 0.0 0.0 110-111 2.4 0.0 0.0 0.0 0.0 112-113 2.6500000000000004 0.0 0.0 0.0 0.0 114-115 2.8875 0.0 0.0 0.0 0.0 116-117 3.1625 0.0 0.0 0.0 0.0 118-119 3.375 0.0 0.0 0.0 0.0 120-121 3.8125 0.0 0.0 0.0 0.0 122-123 4.2875 0.0 0.0 0.0 0.0 124-125 4.8125 0.0 0.0 0.0 0.0 126-127 5.275 0.0 0.0 0.0 0.0 128-129 5.8375 0.0 0.0 0.0 0.0 130-131 6.4375 0.0 0.0 0.0 0.0 132-133 6.7875 0.0 0.0 0.0 0.0 134-135 7.425 0.0 0.0 0.0 0.0 136-137 8.1375 0.0 0.0 0.0 0.0 138-139 8.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGATG 10 0.006830828 145.0 2 CTTATCA 10 0.006830828 145.0 145 GACCCAC 10 0.006830828 145.0 5 GGGGGGG 30 0.0014437955 24.166668 140-144 >>END_MODULE Read 1165452 spots for SRR12671715.sra Written 1165452 spots for SRR12671715.sra Read 1165452 spots for SRR12671715.sra Written 1165452 spots for SRR12671715.sra Read 1165452 spots for SRR12671715.sra Written 1165452 spots for SRR12671715.sra Read 1165452 spots for SRR12671715.sra Written 1165452 spots for SRR12671715.sra Read 1165452 spots for SRR12671715.sra Written 1165452 spots for SRR12671715.sra Read 1165452 spots for SRR12671715.sra Written 1165452 spots for SRR12671715.sra Read 1165452 spots for SRR12671715.sra Written 1165452 spots for SRR12671715.sra Read 1165452 spots for SRR12671715.sra Written 1165452 spots for SRR12671715.sra Read 1165452 spots for SRR12671715.sra Written 1165452 spots for SRR12671715.sra Read 1165452 spots for SRR12671715.sra Written 1165452 spots for SRR12671715.sra Read 1165452 spots for SRR12671715.sra Written 1165452 spots for SRR12671715.sra Read 1165452 spots for SRR12671715.sra Written 1165452 spots for SRR12671715.sra Read 1165455 spots for SRR12671715.sra Written 1165455 spots for SRR12671715.sra Read 1165452 spots for SRR12671715.sra Written 1165452 spots for SRR12671715.sra Read 1165452 spots for SRR12671715.sra Written 1165452 spots for SRR12671715.sra Read 1165452 spots for SRR12671715.sra Written 1165452 spots for SRR12671715.sra Read 1165452 spots for SRR12671715.sra Written 1165452 spots for SRR12671715.sra Read 1165452 spots for SRR12671715.sra Written 1165452 spots for SRR12671715.sra Read 1165452 spots for SRR12671715.sra Written 1165452 spots for SRR12671715.sra Read 1165452 spots for SRR12671715.sra Written 1165452 spots for SRR12671715.sra SRR ids: ['SRR12671715.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ft2l4cg3 SRR12671715.sra spots: 23309043 blocks: [[1, 1165452], [1165453, 2330904], [2330905, 3496356], [3496357, 4661808], [4661809, 5827260], [5827261, 6992712], [6992713, 8158164], [8158165, 9323616], [9323617, 10489068], [10489069, 11654520], [11654521, 12819972], [12819973, 13985424], [13985425, 15150876], [15150877, 16316328], [16316329, 17481780], [17481781, 18647232], [18647233, 19812684], [19812685, 20978136], [20978137, 22143588], [22143589, 23309043]] SRR12671715 file size 7899732 SRR12671715 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671715 SRR12671715_1.fastq SRR12671715_2.fastq Input file: SRR12671715_1.fastq Paired file: SRR12671715_2.fastq trimmed: SRR12671715-trimmed-pair1.fastq, SRR12671715-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:29:38 2025 >> started Wed Feb 12 05:30:05 2025 >> done (26.931s) 23309043 read pairs processed; of these: 31 ( 0.00%) short read pairs filtered out after trimming by size control 2651 ( 0.01%) empty read pairs filtered out after trimming by size control 23306361 (99.99%) read pairs available; of these: 2988317 (12.82%) trimmed read pairs available after processing 20318044 (87.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 3 0.00% 21 3 0.00% 22 6 0.00% 23 4 0.00% 24 4 0.00% 25 8 0.00% 26 3 0.00% 27 7 0.00% 28 12 0.00% 29 7 0.00% 30 12 0.00% 31 15 0.00% 32 21 0.00% 33 15 0.00% 34 22 0.00% 35 28 0.00% 36 30 0.00% 37 19 0.00% 38 39 0.00% 39 34 0.00% 40 45 0.00% 41 62 0.00% 42 42 0.00% 43 69 0.00% 44 59 0.00% 45 77 0.00% 46 93 0.00% 47 86 0.00% 48 110 0.00% 49 100 0.00% 50 122 0.00% 51 162 0.00% 52 179 0.00% 53 159 0.00% 54 167 0.00% 55 188 0.00% 56 189 0.00% 57 227 0.00% 58 254 0.00% 59 311 0.00% 60 385 0.00% 61 414 0.00% 62 491 0.00% 63 541 0.00% 64 579 0.00% 65 653 0.00% 66 657 0.00% 67 749 0.00% 68 817 0.00% 69 921 0.00% 70 1095 0.00% 71 1223 0.01% 72 1476 0.01% 73 1695 0.01% 74 1883 0.01% 75 2127 0.01% 76 2281 0.01% 77 2501 0.01% 78 2576 0.01% 79 3004 0.01% 80 3312 0.01% 81 3943 0.02% 82 4478 0.02% 83 5128 0.02% 84 5941 0.03% 85 6337 0.03% 86 6841 0.03% 87 7261 0.03% 88 7649 0.03% 89 8689 0.04% 90 9373 0.04% 91 10451 0.04% 92 11411 0.05% 93 13024 0.06% 94 14429 0.06% 95 15450 0.07% 96 16323 0.07% 97 17108 0.07% 98 17687 0.08% 99 18327 0.08% 100 19989 0.09% 101 21302 0.09% 102 23210 0.10% 103 25508 0.11% 104 27009 0.12% 105 28658 0.12% 106 29854 0.13% 107 30818 0.13% 108 31269 0.13% 109 32692 0.14% 110 33840 0.15% 111 35120 0.15% 112 37204 0.16% 113 39493 0.17% 114 41686 0.18% 115 43559 0.19% 116 44596 0.19% 117 45754 0.20% 118 46124 0.20% 119 46653 0.20% 120 47637 0.20% 121 49509 0.21% 122 51097 0.22% 123 53885 0.23% 124 56035 0.24% 125 57092 0.24% 126 59169 0.25% 127 59429 0.25% 128 59750 0.26% 129 60237 0.26% 130 60640 0.26% 131 61309 0.26% 132 63780 0.27% 133 66013 0.28% 134 68137 0.29% 135 69705 0.30% 136 70178 0.30% 137 70910 0.30% 138 71746 0.31% 139 71207 0.31% 140 70957 0.30% 141 71895 0.31% 142 73330 0.31% 143 74953 0.32% 144 77537 0.33% 145 78638 0.34% 146 80216 0.34% 147 79407 0.34% 148 79671 0.34% 149 78948 0.34% 150 78733 0.34% 151 20318044 87.18% 23306361 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=29 prefix-density=0.30 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=473.19 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=18.1 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=31 prefix-density=0.38 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=10 fanout-score=35.60 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=13.4 sequence=AAGAAAAGAAAA SRR12671715 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:30:55 Started mapping on | Feb 12 05:30:56 Finished on | Feb 12 05:33:26 Mapping speed, Million of reads per hour | 559.35 Number of input reads | 23306361 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 21803922 Uniquely mapped reads % | 93.55% Average mapped length | 294.35 Number of splices: Total | 21867851 Number of splices: Annotated (sjdb) | 21352865 Number of splices: GT/AG | 21439669 Number of splices: GC/AG | 330814 Number of splices: AT/AC | 13996 Number of splices: Non-canonical | 83372 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 564375 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 68349 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.63% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 938064 938064 938064 N_multimapping 564375 564375 564375 N_noFeature 867676 21441844 1010313 N_ambiguous 366374 1695 146034 UnstrandedReadsAssigned:20569872 PositiveStrandReadsAssigned:360383 NegativeStrandReadsAssigned:20647575 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671715 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671715-trimmed-pair1.fastq SRR12671715-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,306,361 reads, 20,566,004 reads pseudoaligned [quant] estimated average fragment length: 263.27 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,173 rounds 52401 SRR12671715.ke.tsv 34699 SRR12671715.se.tsv 87100 total ==> SRR12671715.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.73 1354.58 36.4648 Potri.005G024800.1.v4.1 1035 772.73 551 33.7016 Potri.004G059700.1.v4.1 961 699.199 0 0 Potri.007G009000.2.v4.1 1416 1153.73 0 0 Potri.003G141000.2.v4.1 2943 2680.73 1193.4 21.0407 Potri.016G087400.1.v4.1 270 90.8196 1354 704.637 Potri.015G069301.1.v4.1 564 324.576 0 0 Potri.010G195200.1.v4.1 1773 1510.73 736.824 23.0517 Potri.012G127500.1.v4.1 977 714.968 169 11.1719 ==> SRR12671715.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 105 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 304 Potri.001G212900.v4.1 11 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 31 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR12671715 completed mapping pipeline successfully