Starting /dee2/code/volunteer_pipeline.sh SRR12690113 current disk space = 3059095736320 free memory = 1225385400 SRR12690113 SRAfilesize 6b27f6f3b1c2e19dd2dbf81aac4eae32 SRR12690113.sra SRR12690113.sra file validated SRR12690113 is paired end SRR12690113 is conventional basespace SRR12690113 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690113_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.651 37.0 37.0 37.0 37.0 37.0 2 36.33475 37.0 37.0 37.0 37.0 37.0 3 36.58 37.0 37.0 37.0 37.0 37.0 4 36.6225 37.0 37.0 37.0 37.0 37.0 5 36.6395 37.0 37.0 37.0 37.0 37.0 6 36.5935 37.0 37.0 37.0 37.0 37.0 7 36.518 37.0 37.0 37.0 37.0 37.0 8 36.613 37.0 37.0 37.0 37.0 37.0 9 36.6645 37.0 37.0 37.0 37.0 37.0 10-14 36.566700000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.6066 37.0 37.0 37.0 37.0 37.0 20-24 36.5983 37.0 37.0 37.0 37.0 37.0 25-29 36.5134 37.0 37.0 37.0 37.0 37.0 30-34 36.510400000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.530300000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.4667 37.0 37.0 37.0 37.0 37.0 45-49 36.448 37.0 37.0 37.0 37.0 37.0 50-54 36.39480000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.3916 37.0 37.0 37.0 37.0 37.0 60-64 36.3668 37.0 37.0 37.0 37.0 37.0 65-69 36.357600000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.354099999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.3552 37.0 37.0 37.0 37.0 37.0 80-84 36.2794 37.0 37.0 37.0 37.0 37.0 85-89 36.2459 37.0 37.0 37.0 37.0 37.0 90-94 36.2262 37.0 37.0 37.0 37.0 37.0 95-99 36.204699999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.1764 37.0 37.0 37.0 37.0 37.0 105-109 36.187 37.0 37.0 37.0 37.0 37.0 110-114 36.1068 37.0 37.0 37.0 37.0 37.0 115-119 36.043099999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.9674 37.0 37.0 37.0 37.0 37.0 125-129 36.0238 37.0 37.0 37.0 37.0 37.0 130-134 35.965700000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.9379 37.0 37.0 37.0 37.0 37.0 140-144 35.8312 37.0 37.0 37.0 37.0 37.0 145-149 35.792500000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.620000000000005 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 0.0 24 1.0 25 2.0 26 4.0 27 3.0 28 9.0 29 13.0 30 24.0 31 28.0 32 41.0 33 65.0 34 114.0 35 363.0 36 3013.0 37 318.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.824999999999996 10.775 6.4750000000000005 44.925 2 17.565872020075282 12.471769134253451 39.34755332496863 30.61480552070264 3 16.8 14.75 28.225 40.225 4 21.5 23.275000000000002 24.325 30.9 5 23.05 30.15 24.6 22.2 6 19.5 34.125 24.15 22.225 7 16.725 26.900000000000002 39.775 16.6 8 17.45 25.4 32.725 24.425 9 16.825000000000003 24.3 35.325 23.549999999999997 10-14 19.31 29.94 27.900000000000002 22.85 15-19 20.16 27.48 27.74 24.62 20-24 19.744999999999997 27.139999999999997 28.685 24.43 25-29 19.27 28.65 27.66 24.42 30-34 20.244999999999997 27.92 27.500000000000004 24.335 35-39 20.335 27.794999999999998 27.875 23.995 40-44 20.22 27.700000000000003 27.935 24.145 45-49 19.830000000000002 28.144999999999996 27.925 24.099999999999998 50-54 20.419999999999998 27.655 27.71 24.215 55-59 19.869999999999997 28.050000000000004 28.28 23.799999999999997 60-64 20.03 28.395 27.43 24.145 65-69 20.669999999999998 27.83 27.705000000000002 23.794999999999998 70-74 20.68 27.79 27.71 23.82 75-79 20.36 28.04 28.07 23.53 80-84 20.84 27.52 27.57 24.07 85-89 20.405 28.29 27.175 24.13 90-94 20.225 28.055000000000003 27.975 23.745 95-99 20.32 27.935 27.500000000000004 24.245 100-104 20.275000000000002 28.804999999999996 27.224999999999998 23.695 105-109 20.645 28.015 27.855 23.485 110-114 20.875 27.495000000000005 27.900000000000002 23.73 115-119 21.215 28.32 27.015 23.45 120-124 20.465 27.73 27.825 23.98 125-129 20.669999999999998 28.02 27.52 23.79 130-134 21.33 28.235 27.134999999999998 23.3 135-139 21.279999999999998 27.765 26.924999999999997 24.03 140-144 21.265 28.305000000000003 26.619999999999997 23.810000000000002 145-149 20.465 28.49 27.075 23.97 150-151 21.025 28.025 26.700000000000003 24.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.5 24 2.5 25 4.0 26 5.5 27 7.0 28 8.0 29 8.0 30 12.5 31 24.0 32 28.5 33 32.0 34 48.5 35 62.0 36 71.5 37 95.5 38 119.0 39 146.5 40 188.0 41 210.5 42 239.5 43 251.0 44 266.0 45 274.0 46 269.0 47 262.0 48 242.0 49 218.0 50 172.0 51 143.5 52 124.0 53 107.0 54 82.0 55 63.0 56 55.5 57 42.0 58 29.5 59 25.0 60 20.5 61 12.0 62 6.5 63 3.0 64 4.0 65 6.5 66 4.0 67 0.5 68 0.0 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.325 #Duplication Level Percentage of deduplicated Percentage of total 1 89.53260565351245 79.975 2 9.263923873495662 16.55 3 1.063532045899804 2.85 4 0.055975370836831795 0.2 5 0.027987685418415897 0.125 6 0.055975370836831795 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGTAATGTCA 6 0.15 No Hit CAGAGGATTTTTTAAGCCTCTTGTAATCATCCTCGTATGGAACAGCCACC 6 0.15 No Hit GCACTAACAACCATCGCTACAAGCATGGCACAGGCCAGCTTCAAGCTCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.44999999999999996 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.7125 0.0 0.0 0.0 0.0 110-111 0.9 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.35 0.0 0.0 0.0 0.0 116-117 1.55 0.0 0.0 0.0 0.0 118-119 1.7374999999999998 0.0 0.0 0.0 0.0 120-121 1.9375 0.0 0.0 0.0 0.0 122-123 2.0875 0.0 0.0 0.0 0.0 124-125 2.3499999999999996 0.0 0.0 0.0 0.0 126-127 2.7625 0.0 0.0 0.0 0.0 128-129 3.075 0.0 0.0 0.0 0.0 130-131 3.45 0.0 0.0 0.0 0.0 132-133 3.9625 0.0 0.0 0.0 0.0 134-135 4.300000000000001 0.0 0.0 0.0 0.0 136-137 4.7875 0.0 0.0 0.0 0.0 138-139 5.199999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTCATA 10 0.006830828 145.0 7 CACCGTC 10 0.006830828 145.0 4 ACCGTCA 10 0.006830828 145.0 5 CCGTCAT 10 0.006830828 145.0 6 CCACCGT 10 0.006830828 145.0 3 CATAGCA 10 0.006830828 145.0 7 CTGAACT 30 0.0017973486 72.5 145 >>END_MODULE SRR12690113 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690113_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2605 37.0 37.0 37.0 37.0 37.0 2 36.065 37.0 37.0 37.0 37.0 37.0 3 36.249 37.0 37.0 37.0 37.0 37.0 4 36.1915 37.0 37.0 37.0 37.0 37.0 5 36.253 37.0 37.0 37.0 37.0 37.0 6 36.1945 37.0 37.0 37.0 37.0 37.0 7 36.2535 37.0 37.0 37.0 37.0 37.0 8 36.2785 37.0 37.0 37.0 37.0 37.0 9 36.359 37.0 37.0 37.0 37.0 37.0 10-14 36.2555 37.0 37.0 37.0 37.0 37.0 15-19 36.2721 37.0 37.0 37.0 37.0 37.0 20-24 36.255500000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.2504 37.0 37.0 37.0 37.0 37.0 30-34 36.1622 37.0 37.0 37.0 37.0 37.0 35-39 36.14450000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.12220000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.098699999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.0136 37.0 37.0 37.0 37.0 37.0 55-59 36.079600000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.0504 37.0 37.0 37.0 37.0 37.0 65-69 36.0317 37.0 37.0 37.0 37.0 37.0 70-74 35.978699999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.9653 37.0 37.0 37.0 37.0 37.0 80-84 35.9784 37.0 37.0 37.0 37.0 37.0 85-89 35.931599999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.8662 37.0 37.0 37.0 37.0 37.0 95-99 35.8318 37.0 37.0 37.0 37.0 37.0 100-104 35.89889999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.8707 37.0 37.0 37.0 37.0 37.0 110-114 35.770799999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.7134 37.0 37.0 37.0 37.0 37.0 120-124 35.6305 37.0 37.0 37.0 37.0 37.0 125-129 35.5099 37.0 37.0 37.0 37.0 37.0 130-134 35.4519 37.0 37.0 37.0 37.0 37.0 135-139 35.4833 37.0 37.0 37.0 37.0 37.0 140-144 35.481899999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.32469999999999 37.0 37.0 37.0 32.2 37.0 150-151 34.9055 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 1.0 16 0.0 17 0.0 18 2.0 19 0.0 20 1.0 21 0.0 22 4.0 23 4.0 24 7.0 25 6.0 26 6.0 27 10.0 28 12.0 29 22.0 30 33.0 31 43.0 32 79.0 33 106.0 34 196.0 35 566.0 36 2645.0 37 255.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.675000000000004 22.025 11.5 30.8 2 25.0 27.825 32.125 15.049999999999999 3 19.575 29.799999999999997 30.4 20.225 4 23.45 35.125 22.8 18.625 5 24.224999999999998 36.05 22.05 17.675 6 18.0 40.75 22.575 18.675 7 20.525 21.85 37.5 20.125 8 20.474999999999998 26.924999999999997 28.249999999999996 24.349999999999998 9 21.425 24.85 30.8 22.925 10-14 22.405 30.095 26.165 21.335 15-19 22.74 28.15 27.755000000000003 21.355 20-24 22.235 28.205000000000002 27.905 21.654999999999998 25-29 22.055 28.965000000000003 27.665 21.315 30-34 22.564999999999998 27.755000000000003 28.48 21.2 35-39 21.735 27.955000000000002 28.985 21.325 40-44 23.02 27.560000000000002 28.035 21.385 45-49 22.384999999999998 28.134999999999998 28.165000000000003 21.315 50-54 23.05 27.725 27.615000000000002 21.61 55-59 22.830000000000002 27.544999999999998 28.22 21.404999999999998 60-64 22.29 28.405 27.88 21.425 65-69 22.785 27.229999999999997 28.4 21.584999999999997 70-74 23.48 28.425 26.889999999999997 21.205 75-79 22.68 28.33 27.779999999999998 21.21 80-84 23.515 27.834999999999997 27.515 21.135 85-89 23.400000000000002 27.815 27.500000000000004 21.285 90-94 24.14 27.32 27.62 20.919999999999998 95-99 23.01 27.67 28.470000000000002 20.849999999999998 100-104 23.255 27.889999999999997 27.735 21.12 105-109 23.45 27.46 28.389999999999997 20.7 110-114 24.12 28.235 27.195000000000004 20.45 115-119 23.76 27.67 27.750000000000004 20.82 120-124 23.845 27.88 27.615000000000002 20.66 125-129 23.51 28.025 27.63 20.835 130-134 24.375 27.534999999999997 27.485 20.605 135-139 24.325 27.965 27.045 20.665 140-144 23.91 28.01 27.245 20.835 145-149 24.805 27.765 26.365 21.065 150-151 24.7375 27.4125 27.8375 20.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.5 22 2.5 23 2.0 24 1.5 25 1.5 26 2.5 27 5.5 28 10.0 29 10.5 30 15.5 31 21.5 32 26.5 33 40.5 34 46.5 35 66.0 36 97.5 37 129.0 38 155.5 39 178.0 40 201.0 41 224.0 42 252.5 43 262.5 44 247.5 45 250.5 46 255.0 47 236.5 48 234.0 49 206.5 50 162.0 51 146.5 52 115.5 53 78.0 54 73.0 55 63.0 56 43.0 57 32.0 58 21.0 59 16.0 60 12.5 61 12.0 62 12.5 63 7.5 64 4.5 65 3.5 66 4.0 67 2.5 68 1.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 89.89955357142857 80.55 2 8.816964285714286 15.8 3 1.1160714285714286 3.0 4 0.13950892857142858 0.5 5 0.0 0.0 6 0.027901785714285712 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0125 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.44999999999999996 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.7375 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 1.1125 0.0 0.0 0.0 0.0 114-115 1.425 0.0 0.0 0.0 0.0 116-117 1.6375 0.0 0.0 0.0 0.0 118-119 1.8624999999999998 0.0 0.0 0.0 0.0 120-121 2.0625 0.0 0.0 0.0 0.0 122-123 2.2 0.0 0.0 0.0 0.0 124-125 2.45 0.0 0.0 0.0 0.0 126-127 2.8375000000000004 0.0 0.0 0.0 0.0 128-129 3.1500000000000004 0.0 0.0 0.0 0.0 130-131 3.525 0.0 0.0 0.0 0.0 132-133 4.0375 0.0 0.0 0.0 0.0 134-135 4.375 0.0 0.0 0.0 0.0 136-137 4.8375 0.0 0.0 0.0 0.0 138-139 5.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGAGT 10 0.006830828 145.0 2 GTATGAT 10 0.006830828 145.0 7 TATGATG 10 0.006830828 145.0 8 AGAGTAT 10 0.006830828 145.0 4 TAGGGAA 35 0.0033124194 62.14286 145 >>END_MODULE Read 706886 spots for SRR12690113.sra Written 706886 spots for SRR12690113.sra Read 706886 spots for SRR12690113.sra Written 706886 spots for SRR12690113.sra Read 706886 spots for SRR12690113.sra Written 706886 spots for SRR12690113.sra Read 706886 spots for SRR12690113.sra Written 706886 spots for SRR12690113.sra Read 706886 spots for SRR12690113.sra Written 706886 spots for SRR12690113.sra Read 706886 spots for SRR12690113.sra Written 706886 spots for SRR12690113.sra Read 706886 spots for SRR12690113.sra Written 706886 spots for SRR12690113.sra Read 706886 spots for SRR12690113.sra Written 706886 spots for SRR12690113.sra Read 706886 spots for SRR12690113.sra Written 706886 spots for SRR12690113.sra Read 706886 spots for SRR12690113.sra Written 706886 spots for SRR12690113.sra Read 706886 spots for SRR12690113.sra Written 706886 spots for SRR12690113.sra Read 706886 spots for SRR12690113.sra Written 706886 spots for SRR12690113.sra Read 706886 spots for SRR12690113.sra Written 706886 spots for SRR12690113.sra Read 706886 spots for SRR12690113.sra Written 706886 spots for SRR12690113.sra Read 706886 spots for SRR12690113.sra Written 706886 spots for SRR12690113.sra Read 706886 spots for SRR12690113.sra Written 706886 spots for SRR12690113.sra Read 706886 spots for SRR12690113.sra Written 706886 spots for SRR12690113.sra Read 706886 spots for SRR12690113.sra Written 706886 spots for SRR12690113.sra Read 706897 spots for SRR12690113.sra Written 706897 spots for SRR12690113.sra Read 706886 spots for SRR12690113.sra Written 706886 spots for SRR12690113.sra SRR ids: ['SRR12690113.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q2idafl0 SRR12690113.sra spots: 14137731 blocks: [[1, 706886], [706887, 1413772], [1413773, 2120658], [2120659, 2827544], [2827545, 3534430], [3534431, 4241316], [4241317, 4948202], [4948203, 5655088], [5655089, 6361974], [6361975, 7068860], [7068861, 7775746], [7775747, 8482632], [8482633, 9189518], [9189519, 9896404], [9896405, 10603290], [10603291, 11310176], [11310177, 12017062], [12017063, 12723948], [12723949, 13430834], [13430835, 14137731]] SRR12690113 file size 4782919 SRR12690113 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690113 SRR12690113_1.fastq SRR12690113_2.fastq Input file: SRR12690113_1.fastq Paired file: SRR12690113_2.fastq trimmed: SRR12690113-trimmed-pair1.fastq, SRR12690113-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:24:06 2025 >> started Mon Feb 10 15:24:22 2025 >> done (16.133s) 14137731 read pairs processed; of these: 35 ( 0.00%) short read pairs filtered out after trimming by size control 579 ( 0.00%) empty read pairs filtered out after trimming by size control 14137117 (100.00%) read pairs available; of these: 1022375 ( 7.23%) trimmed read pairs available after processing 13114742 (92.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 8 0.00% 21 7 0.00% 22 3 0.00% 23 8 0.00% 24 8 0.00% 25 3 0.00% 26 11 0.00% 27 6 0.00% 28 8 0.00% 29 12 0.00% 30 10 0.00% 31 12 0.00% 32 13 0.00% 33 8 0.00% 34 13 0.00% 35 12 0.00% 36 18 0.00% 37 24 0.00% 38 20 0.00% 39 24 0.00% 40 25 0.00% 41 25 0.00% 42 22 0.00% 43 26 0.00% 44 33 0.00% 45 27 0.00% 46 36 0.00% 47 31 0.00% 48 25 0.00% 49 40 0.00% 50 56 0.00% 51 64 0.00% 52 51 0.00% 53 78 0.00% 54 76 0.00% 55 60 0.00% 56 65 0.00% 57 84 0.00% 58 92 0.00% 59 121 0.00% 60 136 0.00% 61 156 0.00% 62 190 0.00% 63 199 0.00% 64 180 0.00% 65 208 0.00% 66 228 0.00% 67 261 0.00% 68 347 0.00% 69 396 0.00% 70 403 0.00% 71 439 0.00% 72 498 0.00% 73 558 0.00% 74 614 0.00% 75 719 0.01% 76 806 0.01% 77 872 0.01% 78 984 0.01% 79 1141 0.01% 80 1220 0.01% 81 1262 0.01% 82 1478 0.01% 83 1696 0.01% 84 1777 0.01% 85 1947 0.01% 86 2077 0.01% 87 2361 0.02% 88 2547 0.02% 89 2762 0.02% 90 2939 0.02% 91 3308 0.02% 92 3530 0.02% 93 3863 0.03% 94 4036 0.03% 95 4394 0.03% 96 4668 0.03% 97 4951 0.04% 98 5097 0.04% 99 5569 0.04% 100 5832 0.04% 101 6358 0.04% 102 6525 0.05% 103 6997 0.05% 104 7353 0.05% 105 7731 0.05% 106 8094 0.06% 107 8526 0.06% 108 8924 0.06% 109 9424 0.07% 110 9523 0.07% 111 10161 0.07% 112 10707 0.08% 113 10815 0.08% 114 11317 0.08% 115 12177 0.09% 116 12302 0.09% 117 12865 0.09% 118 13679 0.10% 119 14066 0.10% 120 14509 0.10% 121 15188 0.11% 122 15497 0.11% 123 16514 0.12% 124 17110 0.12% 125 17294 0.12% 126 18267 0.13% 127 18464 0.13% 128 18995 0.13% 129 19972 0.14% 130 20663 0.15% 131 21125 0.15% 132 22050 0.16% 133 22671 0.16% 134 23225 0.16% 135 23731 0.17% 136 24566 0.17% 137 25404 0.18% 138 26097 0.18% 139 27325 0.19% 140 27417 0.19% 141 28818 0.20% 142 29546 0.21% 143 29680 0.21% 144 31058 0.22% 145 32155 0.23% 146 32182 0.23% 147 33256 0.24% 148 33839 0.24% 149 34672 0.25% 150 35620 0.25% 151 13114742 92.77% 14137117 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=21 prefix-density=0.50 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=20 fanout-score=10.08 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=4.3 sequence=TTCCATCATCAC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=24 prefix-density=0.71 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=34.18 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.0 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR12690113 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:25:02 Started mapping on | Feb 10 15:25:02 Finished on | Feb 10 15:26:22 Mapping speed, Million of reads per hour | 636.17 Number of input reads | 14137117 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 13368283 Uniquely mapped reads % | 94.56% Average mapped length | 297.66 Number of splices: Total | 13104276 Number of splices: Annotated (sjdb) | 12834917 Number of splices: GT/AG | 12839407 Number of splices: GC/AG | 223895 Number of splices: AT/AC | 8713 Number of splices: Non-canonical | 32261 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 3.05 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 418208 % of reads mapped to multiple loci | 2.96% Number of reads mapped to too many loci | 77472 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.79% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 350626 350626 350626 N_multimapping 418208 418208 418208 N_noFeature 450298 13248789 489266 N_ambiguous 168409 684 87518 UnstrandedReadsAssigned:12749576 PositiveStrandReadsAssigned:118810 NegativeStrandReadsAssigned:12791499 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690113 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690113-trimmed-pair1.fastq SRR12690113-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,137,117 reads, 12,916,247 reads pseudoaligned [quant] estimated average fragment length: 266.67 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52401 SRR12690113.ke.tsv 34699 SRR12690113.se.tsv 87100 total ==> SRR12690113.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.33 393 17.4548 Potri.005G024800.1.v4.1 1035 769.33 114 11.5327 Potri.004G059700.1.v4.1 961 695.69 52 5.81735 Potri.007G009000.2.v4.1 1416 1150.33 0 0 Potri.003G141000.2.v4.1 2943 2677.33 369 10.7266 Potri.016G087400.1.v4.1 270 76.5141 768 781.191 Potri.015G069301.1.v4.1 564 314.795 0 0 Potri.010G195200.1.v4.1 1773 1507.33 6 0.309799 Potri.012G127500.1.v4.1 977 711.523 626 68.4736 ==> SRR12690113.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 30 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 164 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12690113 completed mapping pipeline successfully