Starting /dee2/code/volunteer_pipeline.sh SRR12690114 current disk space = 3059113889792 free memory = 1127636072 SRR12690114 SRAfilesize 461308619d94d35f2918c32745bbcc7f SRR12690114.sra SRR12690114.sra file validated SRR12690114 is paired end SRR12690114 is conventional basespace SRR12690114 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690114_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6425 37.0 37.0 37.0 37.0 37.0 2 36.277 37.0 37.0 37.0 37.0 37.0 3 36.711 37.0 37.0 37.0 37.0 37.0 4 36.6805 37.0 37.0 37.0 37.0 37.0 5 36.7155 37.0 37.0 37.0 37.0 37.0 6 36.6895 37.0 37.0 37.0 37.0 37.0 7 36.6445 37.0 37.0 37.0 37.0 37.0 8 36.665 37.0 37.0 37.0 37.0 37.0 9 36.6035 37.0 37.0 37.0 37.0 37.0 10-14 36.6422 37.0 37.0 37.0 37.0 37.0 15-19 36.6317 37.0 37.0 37.0 37.0 37.0 20-24 36.583 37.0 37.0 37.0 37.0 37.0 25-29 36.542699999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.564800000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.5029 37.0 37.0 37.0 37.0 37.0 40-44 36.538500000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.45870000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.45890000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.441199999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.423500000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.42 37.0 37.0 37.0 37.0 37.0 70-74 36.3699 37.0 37.0 37.0 37.0 37.0 75-79 36.3795 37.0 37.0 37.0 37.0 37.0 80-84 36.2986 37.0 37.0 37.0 37.0 37.0 85-89 36.3147 37.0 37.0 37.0 37.0 37.0 90-94 36.2405 37.0 37.0 37.0 37.0 37.0 95-99 36.206300000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.18849999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.1525 37.0 37.0 37.0 37.0 37.0 110-114 36.1697 37.0 37.0 37.0 37.0 37.0 115-119 36.1761 37.0 37.0 37.0 37.0 37.0 120-124 36.0607 37.0 37.0 37.0 37.0 37.0 125-129 36.014900000000004 37.0 37.0 37.0 37.0 37.0 130-134 36.0103 37.0 37.0 37.0 37.0 37.0 135-139 36.0377 37.0 37.0 37.0 37.0 37.0 140-144 35.83579999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.821799999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.699250000000006 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 4.0 26 4.0 27 6.0 28 5.0 29 16.0 30 20.0 31 28.0 32 46.0 33 63.0 34 114.0 35 299.0 36 3028.0 37 365.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.95 12.5 6.8500000000000005 41.699999999999996 2 18.81287726358149 12.525150905432595 39.13480885311871 29.527162977867206 3 17.775 14.7 26.025 41.5 4 21.525 23.799999999999997 24.0 30.675 5 23.7 30.95 23.599999999999998 21.75 6 20.775 34.575 24.4 20.25 7 17.525 26.950000000000003 38.25 17.275 8 16.875 27.450000000000003 32.125 23.549999999999997 9 17.65 25.15 34.050000000000004 23.150000000000002 10-14 19.82 29.294999999999998 27.500000000000004 23.385 15-19 20.29 27.455000000000002 28.53 23.724999999999998 20-24 20.41 27.915 28.12 23.555 25-29 19.725 28.395 28.060000000000002 23.82 30-34 20.175 28.07 27.99 23.765 35-39 20.165 29.020000000000003 27.250000000000004 23.565 40-44 19.89 28.549999999999997 28.050000000000004 23.51 45-49 20.385 27.544999999999998 28.375 23.695 50-54 19.56 28.29 28.095 24.055 55-59 19.665 28.610000000000003 28.095 23.630000000000003 60-64 20.265 28.549999999999997 27.834999999999997 23.35 65-69 20.345 27.700000000000003 28.54 23.415 70-74 19.97 28.794999999999998 27.345000000000002 23.89 75-79 20.26 28.515 27.96 23.265 80-84 20.5 28.02 28.275 23.205000000000002 85-89 20.505000000000003 28.4 27.465 23.630000000000003 90-94 20.244999999999997 28.299999999999997 27.58 23.875 95-99 20.46 28.435 27.765 23.34 100-104 20.97 28.63 27.860000000000003 22.54 105-109 20.26 28.125 27.860000000000003 23.755000000000003 110-114 21.195 27.665 27.815 23.325000000000003 115-119 20.585 27.860000000000003 28.249999999999996 23.305 120-124 21.195 28.199999999999996 27.134999999999998 23.47 125-129 20.62 28.025 27.794999999999998 23.56 130-134 20.635 28.439999999999998 27.615000000000002 23.31 135-139 21.32 27.200000000000003 27.744999999999997 23.735 140-144 20.995 27.865000000000002 27.58 23.56 145-149 21.255 28.575 26.889999999999997 23.28 150-151 20.3 29.1875 26.1625 24.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.5 22 2.5 23 2.0 24 1.5 25 3.5 26 6.0 27 9.0 28 15.0 29 14.5 30 17.5 31 31.5 32 36.5 33 38.5 34 45.0 35 72.5 36 95.0 37 98.0 38 110.5 39 133.0 40 175.5 41 216.5 42 231.5 43 257.5 44 289.5 45 282.5 46 258.5 47 244.0 48 230.5 49 216.5 50 191.5 51 154.5 52 121.5 53 104.0 54 88.0 55 54.5 56 32.5 57 31.0 58 24.5 59 17.5 60 17.0 61 11.0 62 5.5 63 2.5 64 1.0 65 1.5 66 2.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.6 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.55 #Duplication Level Percentage of deduplicated Percentage of total 1 90.69574820541138 82.125 2 8.393152954168967 15.2 3 0.7730535615681944 2.1 4 0.08282716731087797 0.3 5 0.02760905577029266 0.125 6 0.02760905577029266 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGTCAAGGGTTGGGCACTGGTTAGCAGTTCCAGATCCTTTTACTTCCA 6 0.15 No Hit GCCCCACGAGAGAAATCTAAGGGCTGAAGAAACCATCATGCACGCACAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.1375 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.6124999999999998 0.0 0.0 0.0 0.0 114-115 1.7875 0.0 0.0 0.0 0.0 116-117 1.9375 0.0 0.0 0.0 0.0 118-119 2.1375 0.0 0.0 0.0 0.0 120-121 2.4375 0.0 0.0 0.0 0.0 122-123 2.825 0.0 0.0 0.0 0.0 124-125 3.125 0.0 0.0 0.0 0.0 126-127 3.5250000000000004 0.0 0.0 0.0 0.0 128-129 3.85 0.0 0.0 0.0 0.0 130-131 4.275 0.0 0.0 0.0 0.0 132-133 4.575 0.0 0.0 0.0 0.0 134-135 4.887499999999999 0.0 0.0 0.0 0.0 136-137 5.2875 0.0 0.0 0.0 0.0 138-139 5.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACATTA 10 0.006830828 145.0 9 >>END_MODULE SRR12690114 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690114_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3735 37.0 37.0 37.0 37.0 37.0 2 36.0375 37.0 37.0 37.0 37.0 37.0 3 36.2605 37.0 37.0 37.0 37.0 37.0 4 36.1505 37.0 37.0 37.0 37.0 37.0 5 36.307 37.0 37.0 37.0 37.0 37.0 6 36.216 37.0 37.0 37.0 37.0 37.0 7 36.3245 37.0 37.0 37.0 37.0 37.0 8 36.336 37.0 37.0 37.0 37.0 37.0 9 36.354 37.0 37.0 37.0 37.0 37.0 10-14 36.3316 37.0 37.0 37.0 37.0 37.0 15-19 36.3313 37.0 37.0 37.0 37.0 37.0 20-24 36.3665 37.0 37.0 37.0 37.0 37.0 25-29 36.2582 37.0 37.0 37.0 37.0 37.0 30-34 36.248000000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.195100000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.1694 37.0 37.0 37.0 37.0 37.0 45-49 36.090500000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.123799999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.123000000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.03060000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.05499999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.9723 37.0 37.0 37.0 37.0 37.0 75-79 35.963499999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.0613 37.0 37.0 37.0 37.0 37.0 85-89 36.0041 37.0 37.0 37.0 37.0 37.0 90-94 35.8609 37.0 37.0 37.0 37.0 37.0 95-99 35.9131 37.0 37.0 37.0 37.0 37.0 100-104 35.8964 37.0 37.0 37.0 37.0 37.0 105-109 35.9464 37.0 37.0 37.0 37.0 37.0 110-114 35.8113 37.0 37.0 37.0 37.0 37.0 115-119 35.743199999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.695 37.0 37.0 37.0 37.0 37.0 125-129 35.6841 37.0 37.0 37.0 37.0 37.0 130-134 35.60280000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.4893 37.0 37.0 37.0 34.6 37.0 140-144 35.433 37.0 37.0 37.0 34.6 37.0 145-149 35.3229 37.0 37.0 37.0 32.2 37.0 150-151 34.89375 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 3.0 17 1.0 18 3.0 19 0.0 20 2.0 21 1.0 22 3.0 23 1.0 24 4.0 25 6.0 26 11.0 27 15.0 28 11.0 29 14.0 30 21.0 31 28.0 32 70.0 33 99.0 34 195.0 35 537.0 36 2737.0 37 237.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.35 24.6 10.825 29.225 2 25.874999999999996 27.775 31.95 14.399999999999999 3 19.8 28.599999999999998 29.175 22.425 4 22.775000000000002 34.625 24.85 17.75 5 24.5 36.199999999999996 23.3 16.0 6 18.725 40.75 22.725 17.8 7 19.8 21.275 40.65 18.275 8 21.325 25.6 28.675 24.4 9 21.425 25.3 30.95 22.325 10-14 22.96 29.494999999999997 26.375 21.17 15-19 22.065 28.99 28.144999999999996 20.8 20-24 22.705000000000002 28.59 27.639999999999997 21.065 25-29 22.465 27.779999999999998 28.58 21.175 30-34 21.795 28.785 28.345 21.075 35-39 23.025000000000002 28.065 28.050000000000004 20.86 40-44 22.5 27.875 28.525 21.099999999999998 45-49 22.275 27.87 28.74 21.115000000000002 50-54 22.82 27.694999999999997 28.845 20.64 55-59 22.465 27.63 29.04 20.865000000000002 60-64 23.02 28.21 27.43 21.34 65-69 23.18 27.975 28.34 20.505000000000003 70-74 23.150000000000002 28.63 27.384999999999998 20.835 75-79 22.564999999999998 28.18 27.735 21.52 80-84 22.759999999999998 28.389999999999997 27.735 21.115000000000002 85-89 23.335 27.615000000000002 27.965 21.085 90-94 23.695 28.215 27.339999999999996 20.75 95-99 23.31 27.889999999999997 27.965 20.835 100-104 23.68 27.79 28.035 20.495 105-109 23.799999999999997 27.87 27.505000000000003 20.825 110-114 23.385 28.439999999999998 27.515 20.66 115-119 23.695 28.005000000000003 27.755000000000003 20.544999999999998 120-124 23.885 28.804999999999996 27.12 20.19 125-129 24.16 27.495000000000005 27.994999999999997 20.349999999999998 130-134 24.03 27.88 28.025 20.064999999999998 135-139 24.295 27.79 27.375 20.54 140-144 24.365000000000002 27.735 27.715 20.185 145-149 25.44 27.589999999999996 27.08 19.89 150-151 24.962500000000002 28.449999999999996 26.6625 19.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 2.0 22 1.0 23 0.5 24 1.5 25 3.0 26 5.0 27 8.5 28 13.5 29 15.5 30 18.0 31 22.5 32 27.0 33 40.0 34 58.5 35 70.5 36 81.0 37 117.0 38 165.5 39 189.0 40 210.5 41 239.5 42 249.0 43 271.0 44 289.5 45 268.5 46 252.5 47 236.0 48 206.0 49 186.5 50 161.5 51 130.0 52 103.0 53 83.5 54 65.0 55 43.0 56 35.0 57 27.5 58 20.0 59 20.5 60 17.0 61 10.5 62 4.0 63 3.0 64 4.0 65 1.0 66 0.0 67 0.5 68 2.0 69 2.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.325 #Duplication Level Percentage of deduplicated Percentage of total 1 90.64489344035428 81.875 2 8.331026847495156 15.049999999999999 3 0.8303349017437033 2.25 4 0.11071132023249376 0.4 5 0.02767783005812344 0.125 6 0.05535566011624688 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CTCGAAAGTGTGTAGATGCTAGCAAGATCGCTGGCTTTGCTCTTGCTACT 6 0.15 No Hit GTTCACTTGGCCACCATCCCAATCACAGGAACTGGCATCAACCCTGCTAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.1125 0.0 0.0 0.0 0.0 106-107 1.2 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.6124999999999998 0.0 0.0 0.0 0.0 114-115 1.7875 0.0 0.0 0.0 0.0 116-117 1.9375 0.0 0.0 0.0 0.0 118-119 2.1375 0.0 0.0 0.0 0.0 120-121 2.4375 0.0 0.0 0.0 0.0 122-123 2.825 0.0 0.0 0.0 0.0 124-125 3.1500000000000004 0.0 0.0 0.0 0.0 126-127 3.55 0.0 0.0 0.0 0.0 128-129 3.875 0.0 0.0 0.0 0.0 130-131 4.2875 0.0 0.0 0.0 0.0 132-133 4.5625 0.0 0.0 0.0 0.0 134-135 4.862500000000001 0.0 0.0 0.0 0.0 136-137 5.2625 0.0 0.0 0.0 0.0 138-139 5.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1013048 spots for SRR12690114.sra Written 1013048 spots for SRR12690114.sra Read 1013048 spots for SRR12690114.sra Written 1013048 spots for SRR12690114.sra Read 1013048 spots for SRR12690114.sra Written 1013048 spots for SRR12690114.sra Read 1013048 spots for SRR12690114.sra Written 1013048 spots for SRR12690114.sra Read 1013048 spots for SRR12690114.sra Written 1013048 spots for SRR12690114.sra Read 1013048 spots for SRR12690114.sra Written 1013048 spots for SRR12690114.sra Read 1013048 spots for SRR12690114.sra Written 1013048 spots for SRR12690114.sra Read 1013048 spots for SRR12690114.sra Written 1013048 spots for SRR12690114.sra Read 1013048 spots for SRR12690114.sra Written 1013048 spots for SRR12690114.sra Read 1013048 spots for SRR12690114.sra Written 1013048 spots for SRR12690114.sra Read 1013048 spots for SRR12690114.sra Written 1013048 spots for SRR12690114.sra Read 1013048 spots for SRR12690114.sra Written 1013048 spots for SRR12690114.sra Read 1013048 spots for SRR12690114.sra Written 1013048 spots for SRR12690114.sra Read 1013051 spots for SRR12690114.sra Written 1013051 spots for SRR12690114.sra Read 1013048 spots for SRR12690114.sra Written 1013048 spots for SRR12690114.sra Read 1013048 spots for SRR12690114.sra Written 1013048 spots for SRR12690114.sra Read 1013048 spots for SRR12690114.sra Written 1013048 spots for SRR12690114.sra Read 1013048 spots for SRR12690114.sra Written 1013048 spots for SRR12690114.sra Read 1013048 spots for SRR12690114.sra Written 1013048 spots for SRR12690114.sra Read 1013048 spots for SRR12690114.sra Written 1013048 spots for SRR12690114.sra SRR ids: ['SRR12690114.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z_6km8rl SRR12690114.sra spots: 20260963 blocks: [[1, 1013048], [1013049, 2026096], [2026097, 3039144], [3039145, 4052192], [4052193, 5065240], [5065241, 6078288], [6078289, 7091336], [7091337, 8104384], [8104385, 9117432], [9117433, 10130480], [10130481, 11143528], [11143529, 12156576], [12156577, 13169624], [13169625, 14182672], [14182673, 15195720], [15195721, 16208768], [16208769, 17221816], [17221817, 18234864], [18234865, 19247912], [19247913, 20260963]] SRR12690114 file size 6863861 SRR12690114 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690114 SRR12690114_1.fastq SRR12690114_2.fastq Input file: SRR12690114_1.fastq Paired file: SRR12690114_2.fastq trimmed: SRR12690114-trimmed-pair1.fastq, SRR12690114-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:21:35 2025 >> started Mon Feb 10 15:22:05 2025 >> done (30.684s) 20260963 read pairs processed; of these: 39 ( 0.00%) short read pairs filtered out after trimming by size control 1284 ( 0.01%) empty read pairs filtered out after trimming by size control 20259640 (99.99%) read pairs available; of these: 1634326 ( 8.07%) trimmed read pairs available after processing 18625314 (91.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 2 0.00% 21 6 0.00% 22 5 0.00% 23 10 0.00% 24 16 0.00% 25 10 0.00% 26 18 0.00% 27 9 0.00% 28 11 0.00% 29 11 0.00% 30 18 0.00% 31 18 0.00% 32 25 0.00% 33 26 0.00% 34 24 0.00% 35 27 0.00% 36 16 0.00% 37 27 0.00% 38 26 0.00% 39 40 0.00% 40 28 0.00% 41 30 0.00% 42 30 0.00% 43 52 0.00% 44 36 0.00% 45 48 0.00% 46 37 0.00% 47 41 0.00% 48 63 0.00% 49 65 0.00% 50 62 0.00% 51 83 0.00% 52 73 0.00% 53 79 0.00% 54 93 0.00% 55 92 0.00% 56 110 0.00% 57 121 0.00% 58 157 0.00% 59 173 0.00% 60 176 0.00% 61 206 0.00% 62 260 0.00% 63 238 0.00% 64 310 0.00% 65 311 0.00% 66 328 0.00% 67 411 0.00% 68 416 0.00% 69 441 0.00% 70 585 0.00% 71 567 0.00% 72 732 0.00% 73 822 0.00% 74 855 0.00% 75 951 0.00% 76 1111 0.01% 77 1253 0.01% 78 1489 0.01% 79 1595 0.01% 80 1639 0.01% 81 1819 0.01% 82 2108 0.01% 83 2295 0.01% 84 2581 0.01% 85 2885 0.01% 86 3003 0.01% 87 3425 0.02% 88 3886 0.02% 89 4081 0.02% 90 4401 0.02% 91 4597 0.02% 92 5093 0.03% 93 5417 0.03% 94 6147 0.03% 95 6400 0.03% 96 7080 0.03% 97 7504 0.04% 98 7923 0.04% 99 8402 0.04% 100 9192 0.05% 101 9428 0.05% 102 10020 0.05% 103 10627 0.05% 104 11228 0.06% 105 12045 0.06% 106 12733 0.06% 107 13173 0.07% 108 13977 0.07% 109 14681 0.07% 110 15129 0.07% 111 15851 0.08% 112 16759 0.08% 113 17088 0.08% 114 18158 0.09% 115 19167 0.09% 116 20066 0.10% 117 20992 0.10% 118 21602 0.11% 119 22443 0.11% 120 23504 0.12% 121 24406 0.12% 122 25604 0.13% 123 26756 0.13% 124 27287 0.13% 125 27938 0.14% 126 29553 0.15% 127 30337 0.15% 128 31404 0.16% 129 32316 0.16% 130 33382 0.16% 131 34052 0.17% 132 35188 0.17% 133 36573 0.18% 134 37000 0.18% 135 39081 0.19% 136 39717 0.20% 137 41022 0.20% 138 41711 0.21% 139 43733 0.22% 140 45019 0.22% 141 46206 0.23% 142 48162 0.24% 143 48606 0.24% 144 50121 0.25% 145 51225 0.25% 146 52363 0.26% 147 52979 0.26% 148 55050 0.27% 149 56229 0.28% 150 57879 0.29% 151 18625314 91.93% 20259640 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=10 prefix-density=0.52 prefix-fanout=2.3 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=35.89 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.6 sequence=GGAAGAAAAACTTGGGACAAATTAAATTACATGCTCAGTAACAGTAGAGATAACAATCATAAAATCCACCCCCCCTGCCGGAACACCACCGACGACACAAACAGAAAGAGATCTTATTTAACCGCTAAACTCTTCCTCTTTGTGTGTCTCGATGACAACATCAGACGTAGGATAAGCAACACAGGTGAGAACCCAGCCTTCCTCTATCTGGTCATCATCAAGGAAGCTAGCATCAGACTGATCCACAGTCCCCTTCACAATCTTGCCAAGACATGAAGAGCATGAGCCAGCCCTGCATGAGTAGGGGAGGTCAATCTCTTCTGCCTCCTCAGCATGGTCAAGGATGTAGATGTCATCGGGGCATGCAAACTCCTTCTCACCATCAGGAGTGATGAGCTTCACCGTGTATGCTGCCATTGCTTTAACACGTCCTCCTCGACTGGCTTTCAAGCCAAGAAGAGACTCCCCCACGTTGGGAAGTGCCCGTAGGCTTGTCACTGGCACCCGGCGA criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=24 prefix-density=0.44 prefix-fanout=2.2 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=85.87 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.2 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR12690114 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:22:50 Started mapping on | Feb 10 15:22:50 Finished on | Feb 10 15:24:54 Mapping speed, Million of reads per hour | 588.18 Number of input reads | 20259640 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 19342203 Uniquely mapped reads % | 95.47% Average mapped length | 297.44 Number of splices: Total | 19169945 Number of splices: Annotated (sjdb) | 18779277 Number of splices: GT/AG | 18798739 Number of splices: GC/AG | 303510 Number of splices: AT/AC | 12925 Number of splices: Non-canonical | 54771 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 3.00 Insertion rate per base | 0.02% Insertion average length | 2.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 501403 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 73219 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.58% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 416034 416034 416034 N_multimapping 501403 501403 501403 N_noFeature 689562 19143528 748528 N_ambiguous 266920 854 126775 UnstrandedReadsAssigned:18385721 PositiveStrandReadsAssigned:197821 NegativeStrandReadsAssigned:18466900 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690114 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690114-trimmed-pair1.fastq SRR12690114-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,259,640 reads, 18,548,577 reads pseudoaligned [quant] estimated average fragment length: 252.26 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,074 rounds 52401 SRR12690114.ke.tsv 34699 SRR12690114.se.tsv 87100 total ==> SRR12690114.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.74 532 15.4132 Potri.005G024800.1.v4.1 1035 783.74 307 20.0502 Potri.004G059700.1.v4.1 961 709.82 50 3.60558 Potri.007G009000.2.v4.1 1416 1164.74 0 0 Potri.003G141000.2.v4.1 2943 2691.74 577 10.9722 Potri.016G087400.1.v4.1 270 77.2627 993 657.858 Potri.015G069301.1.v4.1 564 321.524 0 0 Potri.010G195200.1.v4.1 1773 1521.74 21 0.706369 Potri.012G127500.1.v4.1 977 725.788 2477 174.69 ==> SRR12690114.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 435 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 271 Potri.001G212900.v4.1 20 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 288 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 21 SRR12690114 completed mapping pipeline successfully