Starting /dee2/code/volunteer_pipeline.sh SRR12690115 current disk space = 3059084177408 free memory = 1423447816 SRR12690115 SRAfilesize 6497dd5b15c43edcd5c9fea74688b65e SRR12690115.sra SRR12690115.sra file validated SRR12690115 is paired end SRR12690115 is conventional basespace SRR12690115 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690115_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.622 37.0 37.0 37.0 37.0 37.0 2 36.4505 37.0 37.0 37.0 37.0 37.0 3 36.609 37.0 37.0 37.0 37.0 37.0 4 36.6625 37.0 37.0 37.0 37.0 37.0 5 36.609 37.0 37.0 37.0 37.0 37.0 6 36.6535 37.0 37.0 37.0 37.0 37.0 7 36.5455 37.0 37.0 37.0 37.0 37.0 8 36.559 37.0 37.0 37.0 37.0 37.0 9 36.5905 37.0 37.0 37.0 37.0 37.0 10-14 36.63440000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.585800000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.599199999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.5775 37.0 37.0 37.0 37.0 37.0 30-34 36.4809 37.0 37.0 37.0 37.0 37.0 35-39 36.5351 37.0 37.0 37.0 37.0 37.0 40-44 36.5127 37.0 37.0 37.0 37.0 37.0 45-49 36.516200000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.42960000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.4584 37.0 37.0 37.0 37.0 37.0 60-64 36.4298 37.0 37.0 37.0 37.0 37.0 65-69 36.4364 37.0 37.0 37.0 37.0 37.0 70-74 36.386 37.0 37.0 37.0 37.0 37.0 75-79 36.3471 37.0 37.0 37.0 37.0 37.0 80-84 36.30650000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.341 37.0 37.0 37.0 37.0 37.0 90-94 36.3258 37.0 37.0 37.0 37.0 37.0 95-99 36.2333 37.0 37.0 37.0 37.0 37.0 100-104 36.189400000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.1811 37.0 37.0 37.0 37.0 37.0 110-114 36.2086 37.0 37.0 37.0 37.0 37.0 115-119 36.1082 37.0 37.0 37.0 37.0 37.0 120-124 36.070299999999996 37.0 37.0 37.0 37.0 37.0 125-129 36.0577 37.0 37.0 37.0 37.0 37.0 130-134 36.016 37.0 37.0 37.0 37.0 37.0 135-139 36.0264 37.0 37.0 37.0 37.0 37.0 140-144 35.8908 37.0 37.0 37.0 37.0 37.0 145-149 35.8594 37.0 37.0 37.0 37.0 37.0 150-151 35.67175 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 1.0 25 1.0 26 3.0 27 5.0 28 7.0 29 19.0 30 20.0 31 28.0 32 40.0 33 52.0 34 114.0 35 309.0 36 3044.0 37 354.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.375 12.725 7.3999999999999995 39.5 2 20.005020080321284 12.023092369477911 35.51706827309237 32.454819277108435 3 16.325 14.374999999999998 28.025 41.275 4 21.65 22.25 25.5 30.599999999999998 5 24.4 27.6 24.65 23.35 6 21.5 32.375 23.400000000000002 22.725 7 17.075000000000003 27.775 37.95 17.2 8 17.675 27.3 31.55 23.474999999999998 9 16.45 25.074999999999996 35.375 23.1 10-14 20.185 29.165000000000003 27.61 23.04 15-19 20.21 27.584999999999997 27.735 24.47 20-24 20.150000000000002 28.015 27.68 24.154999999999998 25-29 19.705000000000002 28.265 27.544999999999998 24.485 30-34 20.205000000000002 28.305000000000003 27.700000000000003 23.79 35-39 20.68 27.334999999999997 27.894999999999996 24.09 40-44 20.810000000000002 27.310000000000002 27.725 24.154999999999998 45-49 20.275000000000002 27.560000000000002 28.144999999999996 24.02 50-54 20.595 27.855 27.639999999999997 23.91 55-59 19.84 27.79 27.96 24.41 60-64 20.669999999999998 27.99 27.265 24.075 65-69 20.095 27.785 28.08 24.04 70-74 21.07 26.985 27.67 24.275 75-79 20.585 27.534999999999997 27.6 24.279999999999998 80-84 20.794999999999998 28.12 27.48 23.605 85-89 20.72 27.74 28.044999999999998 23.494999999999997 90-94 20.915 27.994999999999997 26.93 24.16 95-99 21.09 27.639999999999997 27.250000000000004 24.02 100-104 21.255 27.860000000000003 27.384999999999998 23.5 105-109 21.279999999999998 28.139999999999997 27.589999999999996 22.99 110-114 21.285 27.889999999999997 27.0 23.825 115-119 21.224999999999998 28.499999999999996 27.185 23.09 120-124 20.845 27.650000000000002 27.36 24.145 125-129 20.77 27.85 27.525 23.855 130-134 20.84 28.345 27.175 23.64 135-139 21.815 27.72 27.22 23.244999999999997 140-144 21.11 27.915 27.48 23.494999999999997 145-149 21.23 27.744999999999997 27.105 23.919999999999998 150-151 21.2625 27.3 27.8375 23.599999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 1.0 25 1.5 26 0.5 27 4.0 28 7.0 29 9.5 30 12.0 31 14.0 32 21.5 33 37.0 34 46.0 35 49.0 36 66.5 37 87.5 38 114.0 39 139.0 40 177.0 41 202.5 42 236.5 43 281.5 44 260.0 45 249.5 46 270.5 47 272.5 48 240.5 49 221.0 50 202.5 51 159.0 52 130.5 53 105.5 54 86.5 55 70.0 56 54.5 57 39.5 58 32.0 59 29.0 60 26.0 61 19.0 62 6.5 63 3.5 64 3.5 65 3.5 66 2.5 67 1.0 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.55 #Duplication Level Percentage of deduplicated Percentage of total 1 90.86140254003313 82.27499999999999 2 8.061844284925455 14.6 3 0.8558807288790724 2.325 4 0.22087244616234128 0.8 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.8375 0.0 0.0 0.0 0.0 106-107 0.975 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.375 0.0 0.0 0.0 0.0 112-113 1.5499999999999998 0.0 0.0 0.0 0.0 114-115 1.675 0.0 0.0 0.0 0.0 116-117 1.85 0.0 0.0 0.0 0.0 118-119 2.15 0.0 0.0 0.0 0.0 120-121 2.45 0.0 0.0 0.0 0.0 122-123 2.6875 0.0 0.0 0.0 0.0 124-125 2.9375 0.0 0.0 0.0 0.0 126-127 3.35 0.0 0.0 0.0 0.0 128-129 3.7125 0.0 0.0 0.0 0.0 130-131 4.0875 0.0 0.0 0.0 0.0 132-133 4.425 0.0 0.0 0.0 0.0 134-135 4.8125 0.0 0.0 0.0 0.0 136-137 5.075 0.0 0.0 0.0 0.0 138-139 5.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCACAGA 10 0.006830828 145.0 145 >>END_MODULE SRR12690115 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690115_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3865 37.0 37.0 37.0 37.0 37.0 2 36.179 37.0 37.0 37.0 37.0 37.0 3 36.206 37.0 37.0 37.0 37.0 37.0 4 36.209 37.0 37.0 37.0 37.0 37.0 5 36.2735 37.0 37.0 37.0 37.0 37.0 6 36.2895 37.0 37.0 37.0 37.0 37.0 7 36.4065 37.0 37.0 37.0 37.0 37.0 8 36.375 37.0 37.0 37.0 37.0 37.0 9 36.358 37.0 37.0 37.0 37.0 37.0 10-14 36.2943 37.0 37.0 37.0 37.0 37.0 15-19 36.307 37.0 37.0 37.0 37.0 37.0 20-24 36.3469 37.0 37.0 37.0 37.0 37.0 25-29 36.2757 37.0 37.0 37.0 37.0 37.0 30-34 36.273199999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.2602 37.0 37.0 37.0 37.0 37.0 40-44 36.158699999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.211200000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.140100000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.135400000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.1126 37.0 37.0 37.0 37.0 37.0 65-69 36.0597 37.0 37.0 37.0 37.0 37.0 70-74 35.9687 37.0 37.0 37.0 37.0 37.0 75-79 35.992 37.0 37.0 37.0 37.0 37.0 80-84 35.9716 37.0 37.0 37.0 37.0 37.0 85-89 35.9961 37.0 37.0 37.0 37.0 37.0 90-94 35.908300000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.8875 37.0 37.0 37.0 37.0 37.0 100-104 35.915200000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.8829 37.0 37.0 37.0 37.0 37.0 110-114 35.7626 37.0 37.0 37.0 37.0 37.0 115-119 35.756600000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.67659999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.677099999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.601299999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.5216 37.0 37.0 37.0 37.0 37.0 140-144 35.488099999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.3695 37.0 37.0 37.0 34.6 37.0 150-151 35.004000000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 2.0 15 3.0 16 1.0 17 1.0 18 0.0 19 1.0 20 1.0 21 2.0 22 1.0 23 4.0 24 4.0 25 4.0 26 4.0 27 8.0 28 14.0 29 20.0 30 21.0 31 41.0 32 59.0 33 94.0 34 177.0 35 533.0 36 2746.0 37 256.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.625 25.75 11.25 27.375 2 27.650000000000002 30.15 27.950000000000003 14.249999999999998 3 21.25 29.849999999999998 28.425 20.474999999999998 4 24.349999999999998 33.550000000000004 22.975 19.125 5 25.35 36.275 22.25 16.125 6 20.75 40.1 21.05 18.099999999999998 7 19.275000000000002 24.7 36.5 19.525000000000002 8 20.0 27.825 26.924999999999997 25.25 9 22.0 26.35 28.875 22.775000000000002 10-14 23.205000000000002 29.909999999999997 25.885 21.0 15-19 22.695 28.64 27.445000000000004 21.22 20-24 23.04 28.720000000000002 26.825 21.415 25-29 22.96 28.294999999999998 26.96 21.785 30-34 22.6 28.53 26.945000000000004 21.925 35-39 22.56 28.384999999999998 27.205000000000002 21.85 40-44 22.73 28.055000000000003 27.889999999999997 21.325 45-49 23.015 27.650000000000002 27.785 21.55 50-54 22.57 27.01 28.22 22.2 55-59 22.78 27.755000000000003 27.735 21.73 60-64 22.830000000000002 27.725 27.38 22.065 65-69 23.369999999999997 27.575 27.544999999999998 21.51 70-74 23.45 28.005000000000003 26.82 21.725 75-79 22.88 28.185 27.075 21.86 80-84 23.26 28.660000000000004 26.745 21.335 85-89 23.16 27.605 27.57 21.665 90-94 23.305 27.765 27.384999999999998 21.545 95-99 23.49 27.034999999999997 27.250000000000004 22.225 100-104 23.44 28.4 27.145000000000003 21.015 105-109 24.02 28.110000000000003 27.07 20.8 110-114 23.845 28.275 26.900000000000002 20.979999999999997 115-119 23.59 28.29 26.91 21.21 120-124 24.27 27.71 27.165 20.855 125-129 24.15 28.560000000000002 26.27 21.02 130-134 24.654999999999998 27.675 26.455000000000002 21.215 135-139 24.79 27.855 26.889999999999997 20.465 140-144 24.69 27.625 27.08 20.605 145-149 24.84 27.555000000000003 26.779999999999998 20.825 150-151 25.5 27.875 26.724999999999998 19.900000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 1.0 17 0.5 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 0.5 24 1.0 25 2.0 26 3.0 27 5.5 28 7.5 29 9.5 30 11.0 31 13.5 32 21.0 33 27.0 34 40.5 35 55.0 36 64.0 37 94.0 38 132.0 39 167.0 40 190.5 41 199.0 42 247.0 43 284.5 44 292.0 45 290.0 46 275.0 47 241.5 48 234.5 49 225.0 50 174.5 51 141.5 52 109.0 53 94.0 54 84.5 55 59.0 56 46.0 57 38.5 58 28.5 59 23.5 60 15.5 61 12.5 62 7.5 63 3.5 64 1.5 65 1.5 66 2.0 67 1.0 68 1.0 69 1.0 70 0.5 71 0.5 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.375 #Duplication Level Percentage of deduplicated Percentage of total 1 90.81604426002767 82.075 2 8.022130013831259 14.499999999999998 3 0.9128630705394192 2.475 4 0.19363762102351315 0.7000000000000001 5 0.05532503457814661 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.6625000000000001 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.175 0.0 0.0 0.0 0.0 110-111 1.4 0.0 0.0 0.0 0.0 112-113 1.5750000000000002 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 1.85 0.0 0.0 0.0 0.0 118-119 2.15 0.0 0.0 0.0 0.0 120-121 2.45 0.0 0.0 0.0 0.0 122-123 2.6875 0.0 0.0 0.0 0.0 124-125 2.9625 0.0 0.0 0.0 0.0 126-127 3.375 0.0 0.0 0.0 0.0 128-129 3.7375 0.0 0.0 0.0 0.0 130-131 4.112500000000001 0.0 0.0 0.0 0.0 132-133 4.4625 0.0 0.0 0.0 0.0 134-135 4.8875 0.0 0.0 0.0 0.0 136-137 5.125 0.0 0.0 0.0 0.0 138-139 5.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 646690 spots for SRR12690115.sra Written 646690 spots for SRR12690115.sra Read 646690 spots for SRR12690115.sra Written 646690 spots for SRR12690115.sra Read 646690 spots for SRR12690115.sra Written 646690 spots for SRR12690115.sra Read 646690 spots for SRR12690115.sra Written 646690 spots for SRR12690115.sra Read 646690 spots for SRR12690115.sra Written 646690 spots for SRR12690115.sra Read 646690 spots for SRR12690115.sra Written 646690 spots for SRR12690115.sra Read 646690 spots for SRR12690115.sra Written 646690 spots for SRR12690115.sra Read 646690 spots for SRR12690115.sra Written 646690 spots for SRR12690115.sra Read 646690 spots for SRR12690115.sra Written 646690 spots for SRR12690115.sra Read 646690 spots for SRR12690115.sra Written 646690 spots for SRR12690115.sra Read 646690 spots for SRR12690115.sra Written 646690 spots for SRR12690115.sra Read 646690 spots for SRR12690115.sra Written 646690 spots for SRR12690115.sra Read 646690 spots for SRR12690115.sra Written 646690 spots for SRR12690115.sra Read 646690 spots for SRR12690115.sra Written 646690 spots for SRR12690115.sra Read 646690 spots for SRR12690115.sra Written 646690 spots for SRR12690115.sra Read 646690 spots for SRR12690115.sra Written 646690 spots for SRR12690115.sra Read 646690 spots for SRR12690115.sra Written 646690 spots for SRR12690115.sra Read 646690 spots for SRR12690115.sra Written 646690 spots for SRR12690115.sra Read 646690 spots for SRR12690115.sra Written 646690 spots for SRR12690115.sra Read 646701 spots for SRR12690115.sra Written 646701 spots for SRR12690115.sra SRR ids: ['SRR12690115.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2_nrxeme SRR12690115.sra spots: 12933811 blocks: [[1, 646690], [646691, 1293380], [1293381, 1940070], [1940071, 2586760], [2586761, 3233450], [3233451, 3880140], [3880141, 4526830], [4526831, 5173520], [5173521, 5820210], [5820211, 6466900], [6466901, 7113590], [7113591, 7760280], [7760281, 8406970], [8406971, 9053660], [9053661, 9700350], [9700351, 10347040], [10347041, 10993730], [10993731, 11640420], [11640421, 12287110], [12287111, 12933811]] SRR12690115 file size 4373774 SRR12690115 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690115 SRR12690115_1.fastq SRR12690115_2.fastq Input file: SRR12690115_1.fastq Paired file: SRR12690115_2.fastq trimmed: SRR12690115-trimmed-pair1.fastq, SRR12690115-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:30:00 2025 >> started Mon Feb 10 15:30:15 2025 >> done (14.938s) 12933811 read pairs processed; of these: 17 ( 0.00%) short read pairs filtered out after trimming by size control 2511 ( 0.02%) empty read pairs filtered out after trimming by size control 12931283 (99.98%) read pairs available; of these: 1155383 ( 8.93%) trimmed read pairs available after processing 11775900 (91.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 1 0.00% 20 5 0.00% 21 6 0.00% 22 4 0.00% 23 8 0.00% 24 8 0.00% 25 10 0.00% 26 11 0.00% 27 8 0.00% 28 12 0.00% 29 19 0.00% 30 9 0.00% 31 12 0.00% 32 19 0.00% 33 14 0.00% 34 27 0.00% 35 19 0.00% 36 26 0.00% 37 20 0.00% 38 17 0.00% 39 22 0.00% 40 26 0.00% 41 22 0.00% 42 20 0.00% 43 23 0.00% 44 27 0.00% 45 38 0.00% 46 39 0.00% 47 38 0.00% 48 35 0.00% 49 59 0.00% 50 54 0.00% 51 57 0.00% 52 43 0.00% 53 58 0.00% 54 71 0.00% 55 66 0.00% 56 86 0.00% 57 97 0.00% 58 91 0.00% 59 103 0.00% 60 128 0.00% 61 154 0.00% 62 168 0.00% 63 192 0.00% 64 203 0.00% 65 207 0.00% 66 224 0.00% 67 257 0.00% 68 319 0.00% 69 295 0.00% 70 349 0.00% 71 429 0.00% 72 449 0.00% 73 517 0.00% 74 629 0.00% 75 667 0.01% 76 719 0.01% 77 895 0.01% 78 920 0.01% 79 1064 0.01% 80 1137 0.01% 81 1319 0.01% 82 1403 0.01% 83 1620 0.01% 84 1814 0.01% 85 1972 0.02% 86 2186 0.02% 87 2352 0.02% 88 2595 0.02% 89 2852 0.02% 90 3104 0.02% 91 3304 0.03% 92 3571 0.03% 93 3884 0.03% 94 4221 0.03% 95 4516 0.03% 96 4940 0.04% 97 5188 0.04% 98 5630 0.04% 99 6041 0.05% 100 6325 0.05% 101 6613 0.05% 102 7115 0.06% 103 7510 0.06% 104 7897 0.06% 105 8436 0.07% 106 8761 0.07% 107 9440 0.07% 108 9616 0.07% 109 10242 0.08% 110 10553 0.08% 111 11279 0.09% 112 11729 0.09% 113 12186 0.09% 114 12668 0.10% 115 13301 0.10% 116 13878 0.11% 117 14967 0.12% 118 15464 0.12% 119 15999 0.12% 120 16777 0.13% 121 16980 0.13% 122 17565 0.14% 123 18623 0.14% 124 19247 0.15% 125 19610 0.15% 126 20742 0.16% 127 21595 0.17% 128 22599 0.17% 129 23222 0.18% 130 23935 0.19% 131 24507 0.19% 132 25230 0.20% 133 26364 0.20% 134 26864 0.21% 135 27869 0.22% 136 28716 0.22% 137 28635 0.22% 138 29998 0.23% 139 31221 0.24% 140 31914 0.25% 141 32623 0.25% 142 33469 0.26% 143 34403 0.27% 144 35741 0.28% 145 36125 0.28% 146 37108 0.29% 147 37228 0.29% 148 38916 0.30% 149 39418 0.30% 150 40391 0.31% 151 11775900 91.07% 12931283 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=18 prefix-density=0.78 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.10 sequence-density-rank=30 fanout-score=9.68 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=3.1 sequence=GAGCTTCACCGTGTATGCTGCCATTGCTTTAACACGTCCTCCTCGACTGGCTTTCAAGCCAAGAAGAGACTCCCCCACGTTGGGAAGTGCCCGTAGGCTTGTCACTGGCACCCGGCGAGTAAACGATGTGCTGACCATGGCGCTGGAGAGGGCTGCTGTGGTGGCCATT criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=28 prefix-density=0.61 prefix-fanout=2.2 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=32 fanout-score=93.20 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=16.6 sequence=AGAGAGAGAGACAGAGAGAATGGCCACCACAGCAGCCCTCTCCAGCGCCATGGTCAGCACATCGTTTACTCGCCGGGTGCCAGTGACAAGCCTACGGGCACTTCCCAACGTGGGGGAGTCTCTTCTTGGCTTGAAAGCCAGTCGAGGAGGACGTGTTAAAGCAATGGCA SRR12690115 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:30:58 Started mapping on | Feb 10 15:30:59 Finished on | Feb 10 15:32:32 Mapping speed, Million of reads per hour | 500.57 Number of input reads | 12931283 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 12323409 Uniquely mapped reads % | 95.30% Average mapped length | 297.09 Number of splices: Total | 12747505 Number of splices: Annotated (sjdb) | 12495923 Number of splices: GT/AG | 12492402 Number of splices: GC/AG | 215206 Number of splices: AT/AC | 7878 Number of splices: Non-canonical | 32019 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 3.10 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 288933 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 69901 % of reads mapped to too many loci | 0.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.79% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 318941 318941 318941 N_multimapping 288933 288933 288933 N_noFeature 346252 12194274 381119 N_ambiguous 171340 663 76650 UnstrandedReadsAssigned:11805817 PositiveStrandReadsAssigned:128472 NegativeStrandReadsAssigned:11865640 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690115 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690115-trimmed-pair1.fastq SRR12690115-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,931,283 reads, 11,878,759 reads pseudoaligned [quant] estimated average fragment length: 252.215 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,030 rounds 52401 SRR12690115.ke.tsv 34699 SRR12690115.se.tsv 87100 total ==> SRR12690115.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.78 244 10.4861 Potri.005G024800.1.v4.1 1035 783.785 158 15.3063 Potri.004G059700.1.v4.1 961 709.832 5 0.534839 Potri.007G009000.2.v4.1 1416 1164.78 0 0 Potri.003G141000.2.v4.1 2943 2691.78 597 16.84 Potri.016G087400.1.v4.1 270 79.1013 504.581 484.347 Potri.015G069301.1.v4.1 564 322.307 0 0 Potri.010G195200.1.v4.1 1773 1521.78 11 0.548844 Potri.012G127500.1.v4.1 977 725.809 122 12.7628 ==> SRR12690115.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 196 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 120 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR12690115 completed mapping pipeline successfully