Starting /dee2/code/volunteer_pipeline.sh SRR12690116 current disk space = 3058742579200 free memory = 1099962836 SRR12690116 SRAfilesize d690aa8444b5372375c686d796115b12 SRR12690116.sra SRR12690116.sra file validated SRR12690116 is paired end SRR12690116 is conventional basespace SRR12690116 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690116_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.487 37.0 37.0 37.0 37.0 37.0 2 36.3685 37.0 37.0 37.0 37.0 37.0 3 36.5465 37.0 37.0 37.0 37.0 37.0 4 36.594 37.0 37.0 37.0 37.0 37.0 5 36.656 37.0 37.0 37.0 37.0 37.0 6 36.6565 37.0 37.0 37.0 37.0 37.0 7 36.4695 37.0 37.0 37.0 37.0 37.0 8 36.604 37.0 37.0 37.0 37.0 37.0 9 36.628 37.0 37.0 37.0 37.0 37.0 10-14 36.5965 37.0 37.0 37.0 37.0 37.0 15-19 36.556000000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.5481 37.0 37.0 37.0 37.0 37.0 25-29 36.4961 37.0 37.0 37.0 37.0 37.0 30-34 36.4599 37.0 37.0 37.0 37.0 37.0 35-39 36.4855 37.0 37.0 37.0 37.0 37.0 40-44 36.4336 37.0 37.0 37.0 37.0 37.0 45-49 36.443400000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.4035 37.0 37.0 37.0 37.0 37.0 55-59 36.3486 37.0 37.0 37.0 37.0 37.0 60-64 36.3344 37.0 37.0 37.0 37.0 37.0 65-69 36.3177 37.0 37.0 37.0 37.0 37.0 70-74 36.3053 37.0 37.0 37.0 37.0 37.0 75-79 36.2688 37.0 37.0 37.0 37.0 37.0 80-84 36.1882 37.0 37.0 37.0 37.0 37.0 85-89 36.231500000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.2291 37.0 37.0 37.0 37.0 37.0 95-99 36.1687 37.0 37.0 37.0 37.0 37.0 100-104 36.1623 37.0 37.0 37.0 37.0 37.0 105-109 36.136700000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.1238 37.0 37.0 37.0 37.0 37.0 115-119 36.0073 37.0 37.0 37.0 37.0 37.0 120-124 35.983799999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.92139999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.9257 37.0 37.0 37.0 37.0 37.0 135-139 35.915800000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.7371 37.0 37.0 37.0 37.0 37.0 145-149 35.7551 37.0 37.0 37.0 37.0 37.0 150-151 35.58825 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 1.0 25 2.0 26 1.0 27 9.0 28 8.0 29 24.0 30 25.0 31 33.0 32 42.0 33 73.0 34 120.0 35 359.0 36 2983.0 37 318.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.825 12.35 6.8500000000000005 37.974999999999994 2 20.521826392373306 12.242849974912193 34.92222779729052 32.31309583542398 3 17.125 15.55 28.475 38.85 4 22.175 22.875 24.8 30.15 5 23.075000000000003 30.15 24.825 21.95 6 22.125 33.925 23.5 20.45 7 15.5 27.575 39.825 17.1 8 18.75 26.625 31.075000000000003 23.549999999999997 9 17.95 24.325 34.699999999999996 23.025000000000002 10-14 19.515 29.54 27.779999999999998 23.165 15-19 20.305 28.265 27.589999999999996 23.84 20-24 20.345 28.525 27.67 23.46 25-29 20.080000000000002 28.07 27.639999999999997 24.21 30-34 19.665 28.860000000000003 28.035 23.44 35-39 20.47 28.315 27.425 23.79 40-44 19.96 28.194999999999997 27.884999999999998 23.96 45-49 20.025000000000002 28.265 27.860000000000003 23.849999999999998 50-54 19.975 28.675 27.365000000000002 23.985 55-59 20.515 28.185 28.02 23.28 60-64 19.55 29.125 27.445000000000004 23.880000000000003 65-69 19.735 28.03 28.02 24.215 70-74 20.41 27.625 27.87 24.095 75-79 20.044999999999998 28.74 27.825 23.39 80-84 19.895 28.449999999999996 28.095 23.56 85-89 19.97 28.17 28.244999999999997 23.615 90-94 20.3 28.485 27.055 24.16 95-99 20.150000000000002 28.34 27.634999999999998 23.875 100-104 20.419999999999998 28.46 27.815 23.305 105-109 19.91 27.544999999999998 28.26 24.285 110-114 19.985 28.895 27.534999999999997 23.585 115-119 20.8 28.294999999999998 27.665 23.24 120-124 20.880000000000003 28.249999999999996 27.200000000000003 23.669999999999998 125-129 20.575 28.725 27.384999999999998 23.315 130-134 20.77 28.62 27.694999999999997 22.915 135-139 21.59 28.09 26.919999999999998 23.400000000000002 140-144 20.855 28.185 27.400000000000002 23.56 145-149 21.025 28.1 27.439999999999998 23.435 150-151 21.0625 28.512500000000003 26.487500000000004 23.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.5 21 1.0 22 1.0 23 2.5 24 5.0 25 6.5 26 4.5 27 3.0 28 5.0 29 9.5 30 14.5 31 24.0 32 29.5 33 32.0 34 43.0 35 69.5 36 90.5 37 109.0 38 140.0 39 153.5 40 176.0 41 205.0 42 231.5 43 247.0 44 266.0 45 284.0 46 269.5 47 267.5 48 245.5 49 204.0 50 177.0 51 146.0 52 115.5 53 104.5 54 80.5 55 60.0 56 51.0 57 35.0 58 27.0 59 20.5 60 15.0 61 9.0 62 6.0 63 1.0 64 1.0 65 1.0 66 1.5 67 1.5 68 0.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.775 #Duplication Level Percentage of deduplicated Percentage of total 1 90.36480089111669 81.125 2 8.047897521581731 14.45 3 1.4202172096908938 3.8249999999999997 4 0.1670843776106934 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0125 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.025 0.0 0.0 0.025 0.0 68-69 0.025 0.0 0.0 0.025 0.0 70-71 0.037500000000000006 0.0 0.0 0.025 0.0 72-73 0.05 0.0 0.0 0.025 0.0 74-75 0.05 0.0 0.0 0.025 0.0 76-77 0.0625 0.0 0.0 0.025 0.0 78-79 0.125 0.0 0.0 0.025 0.0 80-81 0.15 0.0 0.0 0.025 0.0 82-83 0.21250000000000002 0.0 0.0 0.025 0.0 84-85 0.25 0.0 0.0 0.025 0.0 86-87 0.275 0.0 0.0 0.025 0.0 88-89 0.3375 0.0 0.0 0.025 0.0 90-91 0.4 0.0 0.0 0.025 0.0 92-93 0.4875 0.0 0.0 0.025 0.0 94-95 0.5 0.0 0.0 0.025 0.0 96-97 0.5 0.0 0.0 0.025 0.0 98-99 0.55 0.0 0.0 0.025 0.0 100-101 0.65 0.0 0.0 0.025 0.0 102-103 0.7375 0.0 0.0 0.025 0.0 104-105 0.85 0.0 0.0 0.025 0.0 106-107 0.95 0.0 0.0 0.025 0.0 108-109 1.0499999999999998 0.0 0.0 0.025 0.0 110-111 1.1 0.0 0.0 0.025 0.0 112-113 1.2125 0.0 0.0 0.025 0.0 114-115 1.3624999999999998 0.0 0.0 0.025 0.0 116-117 1.5750000000000002 0.0 0.0 0.025 0.0 118-119 1.8375 0.0 0.0 0.025 0.0 120-121 2.15 0.0 0.0 0.025 0.0 122-123 2.2875 0.0 0.0 0.025 0.0 124-125 2.4625 0.0 0.0 0.025 0.0 126-127 2.7125 0.0 0.0 0.025 0.0 128-129 2.8875 0.0 0.0 0.025 0.0 130-131 3.3375 0.0 0.0 0.025 0.0 132-133 3.8 0.0 0.0 0.025 0.0 134-135 4.2125 0.0 0.0 0.025 0.0 136-137 4.6875 0.0 0.0 0.025 0.0 138-139 5.05 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTATGA 10 0.006830828 145.0 5 >>END_MODULE SRR12690116 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690116_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3695 37.0 37.0 37.0 37.0 37.0 2 36.031 37.0 37.0 37.0 37.0 37.0 3 36.0395 37.0 37.0 37.0 37.0 37.0 4 36.1335 37.0 37.0 37.0 37.0 37.0 5 36.2295 37.0 37.0 37.0 37.0 37.0 6 36.1085 37.0 37.0 37.0 37.0 37.0 7 36.0955 37.0 37.0 37.0 37.0 37.0 8 36.2295 37.0 37.0 37.0 37.0 37.0 9 36.194 37.0 37.0 37.0 37.0 37.0 10-14 36.1357 37.0 37.0 37.0 37.0 37.0 15-19 36.17 37.0 37.0 37.0 37.0 37.0 20-24 36.1981 37.0 37.0 37.0 37.0 37.0 25-29 36.0794 37.0 37.0 37.0 37.0 37.0 30-34 36.0762 37.0 37.0 37.0 37.0 37.0 35-39 36.043000000000006 37.0 37.0 37.0 37.0 37.0 40-44 35.9741 37.0 37.0 37.0 37.0 37.0 45-49 36.0483 37.0 37.0 37.0 37.0 37.0 50-54 35.952 37.0 37.0 37.0 37.0 37.0 55-59 35.988 37.0 37.0 37.0 37.0 37.0 60-64 35.8854 37.0 37.0 37.0 37.0 37.0 65-69 35.876900000000006 37.0 37.0 37.0 37.0 37.0 70-74 35.8592 37.0 37.0 37.0 37.0 37.0 75-79 35.8326 37.0 37.0 37.0 37.0 37.0 80-84 35.9134 37.0 37.0 37.0 37.0 37.0 85-89 35.796299999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.718599999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.7517 37.0 37.0 37.0 37.0 37.0 100-104 35.7663 37.0 37.0 37.0 37.0 37.0 105-109 35.7744 37.0 37.0 37.0 37.0 37.0 110-114 35.6847 37.0 37.0 37.0 37.0 37.0 115-119 35.6057 37.0 37.0 37.0 37.0 37.0 120-124 35.5674 37.0 37.0 37.0 37.0 37.0 125-129 35.469899999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.4259 37.0 37.0 37.0 34.6 37.0 135-139 35.3695 37.0 37.0 37.0 37.0 37.0 140-144 35.320499999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.1822 37.0 37.0 37.0 29.8 37.0 150-151 34.70825 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 1.0 15 3.0 16 0.0 17 1.0 18 1.0 19 4.0 20 0.0 21 8.0 22 3.0 23 6.0 24 5.0 25 6.0 26 10.0 27 5.0 28 17.0 29 33.0 30 25.0 31 54.0 32 67.0 33 128.0 34 200.0 35 568.0 36 2599.0 37 252.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.95 24.75 10.725 26.575 2 28.525 26.275 30.175 15.024999999999999 3 20.349999999999998 28.125 32.324999999999996 19.2 4 23.549999999999997 33.15 24.4 18.9 5 26.224999999999998 35.675000000000004 22.7 15.4 6 19.475 40.575 22.125 17.825 7 20.525 22.900000000000002 38.425 18.15 8 20.25 24.2 29.049999999999997 26.5 9 21.725 25.3 29.849999999999998 23.125 10-14 23.494999999999997 28.93 26.295 21.279999999999998 15-19 22.365 27.97 28.7 20.965 20-24 23.115 28.299999999999997 27.71 20.875 25-29 22.68 28.144999999999996 28.28 20.895 30-34 21.95 28.07 29.01 20.97 35-39 21.83 28.265 28.255000000000003 21.65 40-44 22.475 28.439999999999998 28.349999999999998 20.735 45-49 22.439999999999998 28.265 27.96 21.335 50-54 22.64 28.694999999999997 28.060000000000002 20.605 55-59 22.845 27.555000000000003 28.925 20.674999999999997 60-64 22.515 27.91 28.485 21.09 65-69 23.395 27.534999999999997 27.85 21.22 70-74 22.795 28.12 27.925 21.16 75-79 23.015 28.485 27.665 20.835 80-84 23.29 27.83 27.339999999999996 21.54 85-89 23.26 27.950000000000003 27.875 20.915 90-94 23.915 27.224999999999998 27.560000000000002 21.3 95-99 23.285 28.439999999999998 27.450000000000003 20.825 100-104 23.724999999999998 28.025 27.18 21.07 105-109 23.585 27.97 27.985 20.46 110-114 23.78 28.565 27.529999999999998 20.125 115-119 23.865 28.67 27.36 20.105 120-124 23.965 28.294999999999998 27.389999999999997 20.349999999999998 125-129 24.154999999999998 27.975 28.025 19.845 130-134 24.7 28.16 26.325 20.815 135-139 24.865000000000002 27.51 27.689999999999998 19.935 140-144 25.05 28.005000000000003 26.82 20.125 145-149 25.805 27.63 26.505000000000003 20.06 150-151 25.85 28.012500000000003 26.5625 19.575 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 3.0 9 2.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 1.0 18 0.5 19 1.0 20 3.0 21 3.5 22 1.5 23 3.5 24 4.5 25 4.0 26 4.5 27 4.5 28 8.0 29 11.0 30 16.5 31 25.0 32 37.0 33 45.5 34 59.5 35 74.0 36 83.5 37 108.0 38 145.0 39 182.5 40 195.5 41 202.5 42 234.5 43 266.0 44 287.5 45 273.0 46 250.0 47 248.5 48 234.0 49 198.0 50 156.0 51 124.5 52 96.5 53 76.5 54 68.5 55 63.0 56 50.0 57 40.0 58 25.5 59 15.5 60 15.5 61 11.0 62 8.5 63 5.0 64 1.5 65 1.5 66 0.5 67 0.5 68 2.0 69 2.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 1.0 86 1.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.5 98 0.5 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.275 #Duplication Level Percentage of deduplicated Percentage of total 1 90.42285074208905 80.72500000000001 2 8.00896107532904 14.299999999999999 3 1.1481377765331842 3.075 4 0.2520302436292355 0.8999999999999999 5 0.02800336040324839 0.125 6 0.05600672080649678 0.3 7 0.02800336040324839 0.17500000000000002 8 0.05600672080649678 0.4 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 8 0.2 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 6 0.15 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 6 0.15 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 0.975 0.0 0.0 0.0 0.0 108-109 1.0750000000000002 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.2125 0.0 0.0 0.0 0.0 114-115 1.3624999999999998 0.0 0.0 0.0 0.0 116-117 1.5750000000000002 0.0 0.0 0.0 0.0 118-119 1.7999999999999998 0.0 0.0 0.0 0.0 120-121 2.1 0.0 0.0 0.0 0.0 122-123 2.225 0.0 0.0 0.0 0.0 124-125 2.4125 0.0 0.0 0.0 0.0 126-127 2.6625 0.0 0.0 0.0 0.0 128-129 2.8375 0.0 0.0 0.0 0.0 130-131 3.2875 0.0 0.0 0.0 0.0 132-133 3.75 0.0 0.0 0.0 0.0 134-135 4.1625 0.0 0.0 0.0 0.0 136-137 4.6625 0.0 0.0 0.0 0.0 138-139 5.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGAAG 10 0.006830828 145.0 5 >>END_MODULE Read 802347 spots for SRR12690116.sra Written 802347 spots for SRR12690116.sra Read 802347 spots for SRR12690116.sra Written 802347 spots for SRR12690116.sra Read 802347 spots for SRR12690116.sra Written 802347 spots for SRR12690116.sra Read 802347 spots for SRR12690116.sra Written 802347 spots for SRR12690116.sra Read 802347 spots for SRR12690116.sra Written 802347 spots for SRR12690116.sra Read 802347 spots for SRR12690116.sra Written 802347 spots for SRR12690116.sra Read 802347 spots for SRR12690116.sra Written 802347 spots for SRR12690116.sra Read 802347 spots for SRR12690116.sra Written 802347 spots for SRR12690116.sra Read 802347 spots for SRR12690116.sra Written 802347 spots for SRR12690116.sra Read 802347 spots for SRR12690116.sra Written 802347 spots for SRR12690116.sra Read 802347 spots for SRR12690116.sra Written 802347 spots for SRR12690116.sra Read 802347 spots for SRR12690116.sra Written 802347 spots for SRR12690116.sra Read 802347 spots for SRR12690116.sra Written 802347 spots for SRR12690116.sra Read 802347 spots for SRR12690116.sra Written 802347 spots for SRR12690116.sra Read 802347 spots for SRR12690116.sra Written 802347 spots for SRR12690116.sra Read 802347 spots for SRR12690116.sra Written 802347 spots for SRR12690116.sra Read 802347 spots for SRR12690116.sra Written 802347 spots for SRR12690116.sra Read 802347 spots for SRR12690116.sra Written 802347 spots for SRR12690116.sra Read 802347 spots for SRR12690116.sra Written 802347 spots for SRR12690116.sra Read 802348 spots for SRR12690116.sra Written 802348 spots for SRR12690116.sra SRR ids: ['SRR12690116.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tzc3e63e SRR12690116.sra spots: 16046941 blocks: [[1, 802347], [802348, 1604694], [1604695, 2407041], [2407042, 3209388], [3209389, 4011735], [4011736, 4814082], [4814083, 5616429], [5616430, 6418776], [6418777, 7221123], [7221124, 8023470], [8023471, 8825817], [8825818, 9628164], [9628165, 10430511], [10430512, 11232858], [11232859, 12035205], [12035206, 12837552], [12837553, 13639899], [13639900, 14442246], [14442247, 15244593], [15244594, 16046941]] SRR12690116 file size 5431752 SRR12690116 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690116 SRR12690116_1.fastq SRR12690116_2.fastq Input file: SRR12690116_1.fastq Paired file: SRR12690116_2.fastq trimmed: SRR12690116-trimmed-pair1.fastq, SRR12690116-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:53:13 2025 >> started Mon Feb 10 15:53:31 2025 >> done (17.481s) 16046941 read pairs processed; of these: 23 ( 0.00%) short read pairs filtered out after trimming by size control 1801 ( 0.01%) empty read pairs filtered out after trimming by size control 16045117 (99.99%) read pairs available; of these: 1336805 ( 8.33%) trimmed read pairs available after processing 14708312 (91.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 6 0.00% 21 3 0.00% 22 4 0.00% 23 11 0.00% 24 15 0.00% 25 12 0.00% 26 8 0.00% 27 3 0.00% 28 12 0.00% 29 10 0.00% 30 15 0.00% 31 9 0.00% 32 19 0.00% 33 17 0.00% 34 21 0.00% 35 26 0.00% 36 22 0.00% 37 19 0.00% 38 24 0.00% 39 22 0.00% 40 28 0.00% 41 26 0.00% 42 26 0.00% 43 33 0.00% 44 11 0.00% 45 21 0.00% 46 33 0.00% 47 37 0.00% 48 38 0.00% 49 55 0.00% 50 39 0.00% 51 42 0.00% 52 52 0.00% 53 78 0.00% 54 77 0.00% 55 60 0.00% 56 78 0.00% 57 80 0.00% 58 83 0.00% 59 125 0.00% 60 128 0.00% 61 166 0.00% 62 158 0.00% 63 185 0.00% 64 204 0.00% 65 210 0.00% 66 256 0.00% 67 310 0.00% 68 347 0.00% 69 394 0.00% 70 413 0.00% 71 459 0.00% 72 481 0.00% 73 615 0.00% 74 689 0.00% 75 722 0.00% 76 902 0.01% 77 916 0.01% 78 1091 0.01% 79 1188 0.01% 80 1311 0.01% 81 1476 0.01% 82 1713 0.01% 83 1805 0.01% 84 2112 0.01% 85 2311 0.01% 86 2476 0.02% 87 2768 0.02% 88 3016 0.02% 89 3223 0.02% 90 3573 0.02% 91 3974 0.02% 92 4124 0.03% 93 4637 0.03% 94 4978 0.03% 95 5442 0.03% 96 5794 0.04% 97 6293 0.04% 98 6648 0.04% 99 7176 0.04% 100 7636 0.05% 101 7846 0.05% 102 8569 0.05% 103 9313 0.06% 104 9806 0.06% 105 9973 0.06% 106 10817 0.07% 107 11389 0.07% 108 11638 0.07% 109 12255 0.08% 110 12865 0.08% 111 13415 0.08% 112 13993 0.09% 113 14745 0.09% 114 15594 0.10% 115 16319 0.10% 116 16772 0.10% 117 17634 0.11% 118 18476 0.12% 119 18961 0.12% 120 19960 0.12% 121 20384 0.13% 122 21186 0.13% 123 22316 0.14% 124 22870 0.14% 125 23583 0.15% 126 24600 0.15% 127 25300 0.16% 128 25895 0.16% 129 26773 0.17% 130 27692 0.17% 131 27858 0.17% 132 29180 0.18% 133 29902 0.19% 134 30545 0.19% 135 31790 0.20% 136 32292 0.20% 137 33353 0.21% 138 34190 0.21% 139 35014 0.22% 140 35535 0.22% 141 36822 0.23% 142 38326 0.24% 143 38573 0.24% 144 40141 0.25% 145 41072 0.26% 146 41958 0.26% 147 42879 0.27% 148 43809 0.27% 149 43790 0.27% 150 45211 0.28% 151 14708312 91.67% 16045117 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=24 prefix-density=0.35 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=29 fanout-score=11.92 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=2.6 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=30 prefix-density=0.62 prefix-fanout=2.2 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.14 sequence-density-rank=26 fanout-score=38.44 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=13.3 sequence=AAAGAAAAGAAAA SRR12690116 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:54:15 Started mapping on | Feb 10 15:54:15 Finished on | Feb 10 15:56:10 Mapping speed, Million of reads per hour | 502.28 Number of input reads | 16045117 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 15073335 Uniquely mapped reads % | 93.94% Average mapped length | 297.02 Number of splices: Total | 15257540 Number of splices: Annotated (sjdb) | 14846608 Number of splices: GT/AG | 14954720 Number of splices: GC/AG | 232870 Number of splices: AT/AC | 10104 Number of splices: Non-canonical | 59846 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 426744 % of reads mapped to multiple loci | 2.66% Number of reads mapped to too many loci | 64793 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.87% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 545038 545038 545038 N_multimapping 426744 426744 426744 N_noFeature 598112 14859404 656778 N_ambiguous 277940 947 122168 UnstrandedReadsAssigned:14197283 PositiveStrandReadsAssigned:212984 NegativeStrandReadsAssigned:14294389 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690116 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690116-trimmed-pair1.fastq SRR12690116-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,045,117 reads, 14,247,802 reads pseudoaligned [quant] estimated average fragment length: 267.691 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,065 rounds 52401 SRR12690116.ke.tsv 34699 SRR12690116.se.tsv 87100 total ==> SRR12690116.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1751.31 535 17.8088 Potri.005G024800.1.v4.1 1035 768.309 124 9.40868 Potri.004G059700.1.v4.1 961 694.52 1 0.0839379 Potri.007G009000.2.v4.1 1416 1149.31 0 0 Potri.003G141000.2.v4.1 2943 2676.31 941.553 20.5093 Potri.016G087400.1.v4.1 270 79.4224 683 501.326 Potri.015G069301.1.v4.1 564 313.676 0 0 Potri.010G195200.1.v4.1 1773 1506.31 31 1.19975 Potri.012G127500.1.v4.1 977 710.401 165 13.5401 ==> SRR12690116.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 113 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 189 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR12690116 completed mapping pipeline successfully