Starting /dee2/code/volunteer_pipeline.sh SRR12690117 current disk space = 3058296238080 free memory = 1572057604 SRR12690117 SRAfilesize a9038c78f67e582700a3d4659f8fa6ea SRR12690117.sra SRR12690117.sra file validated SRR12690117 is paired end SRR12690117 is conventional basespace SRR12690117 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690117_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.633 37.0 37.0 37.0 37.0 37.0 2 36.47525 37.0 37.0 37.0 37.0 37.0 3 36.669 37.0 37.0 37.0 37.0 37.0 4 36.657 37.0 37.0 37.0 37.0 37.0 5 36.5925 37.0 37.0 37.0 37.0 37.0 6 36.617 37.0 37.0 37.0 37.0 37.0 7 36.5835 37.0 37.0 37.0 37.0 37.0 8 36.529 37.0 37.0 37.0 37.0 37.0 9 36.6395 37.0 37.0 37.0 37.0 37.0 10-14 36.6077 37.0 37.0 37.0 37.0 37.0 15-19 36.6043 37.0 37.0 37.0 37.0 37.0 20-24 36.56999999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.5293 37.0 37.0 37.0 37.0 37.0 30-34 36.5263 37.0 37.0 37.0 37.0 37.0 35-39 36.4908 37.0 37.0 37.0 37.0 37.0 40-44 36.4283 37.0 37.0 37.0 37.0 37.0 45-49 36.1512 37.0 37.0 37.0 37.0 37.0 50-54 36.1792 37.0 37.0 37.0 37.0 37.0 55-59 35.900099999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.9451 37.0 37.0 37.0 37.0 37.0 65-69 35.8333 37.0 37.0 37.0 37.0 37.0 70-74 36.0034 37.0 37.0 37.0 37.0 37.0 75-79 36.267900000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.25170000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.2872 37.0 37.0 37.0 37.0 37.0 90-94 36.2211 37.0 37.0 37.0 37.0 37.0 95-99 36.1681 37.0 37.0 37.0 37.0 37.0 100-104 36.1034 37.0 37.0 37.0 37.0 37.0 105-109 36.0957 37.0 37.0 37.0 37.0 37.0 110-114 36.057 37.0 37.0 37.0 37.0 37.0 115-119 36.0762 37.0 37.0 37.0 37.0 37.0 120-124 35.9594 37.0 37.0 37.0 37.0 37.0 125-129 35.9285 37.0 37.0 37.0 37.0 37.0 130-134 35.9148 37.0 37.0 37.0 37.0 37.0 135-139 35.9043 37.0 37.0 37.0 37.0 37.0 140-144 35.701299999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.7104 37.0 37.0 37.0 37.0 37.0 150-151 35.424 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 2.0 25 4.0 26 9.0 27 9.0 28 14.0 29 12.0 30 33.0 31 41.0 32 42.0 33 156.0 34 111.0 35 295.0 36 2906.0 37 365.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.05 13.225000000000001 8.4 34.325 2 21.133116069190272 14.514916019052393 33.0910002506894 31.260967661067934 3 16.225 15.575 32.074999999999996 36.125 4 20.125 21.25 26.6 32.025 5 24.75 28.125 25.324999999999996 21.8 6 24.05 30.8 23.200000000000003 21.95 7 16.425 28.625 38.3 16.650000000000002 8 17.5 28.375 32.275 21.85 9 19.825 23.974999999999998 32.800000000000004 23.400000000000002 10-14 20.735 29.544999999999998 26.840000000000003 22.88 15-19 20.285 27.584999999999997 27.98 24.15 20-24 20.424999999999997 28.15 27.305 24.12 25-29 20.215 28.51 27.515 23.76 30-34 19.75 27.43 27.575 25.245 35-39 20.965 27.089999999999996 28.585 23.36 40-44 19.89 27.994999999999997 27.339999999999996 24.775 45-49 20.755000000000003 27.105 28.310000000000002 23.830000000000002 50-54 21.175 26.755000000000003 27.57 24.5 55-59 20.669999999999998 26.465 28.735 24.13 60-64 21.645 27.255000000000003 28.139999999999997 22.96 65-69 21.22 27.555000000000003 27.744999999999997 23.48 70-74 22.02 27.295 26.695 23.990000000000002 75-79 22.264999999999997 27.32 26.674999999999997 23.74 80-84 22.765 26.625 27.055 23.555 85-89 22.975 27.415 26.900000000000002 22.71 90-94 23.315 26.179999999999996 27.169999999999998 23.335 95-99 23.425 26.735 27.33 22.509999999999998 100-104 23.01 26.645000000000003 26.650000000000002 23.695 105-109 23.06 26.640000000000004 27.065 23.235 110-114 23.46 27.584999999999997 26.19 22.765 115-119 23.275000000000002 26.729999999999997 26.145000000000003 23.849999999999998 120-124 22.814999999999998 27.16 26.32 23.705000000000002 125-129 23.395 26.525 26.529999999999998 23.549999999999997 130-134 23.97 26.58 26.174999999999997 23.275000000000002 135-139 23.35 27.05 26.665 22.935 140-144 23.674999999999997 26.619999999999997 26.365 23.34 145-149 23.54 27.0 25.900000000000002 23.56 150-151 23.724999999999998 26.5 25.362499999999997 24.4125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 4.0 1 2.5 2 1.0 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 1.5 23 3.0 24 4.5 25 6.0 26 5.0 27 5.5 28 7.5 29 11.5 30 17.5 31 26.0 32 29.5 33 36.0 34 52.0 35 61.0 36 64.0 37 72.0 38 94.5 39 117.5 40 149.5 41 185.0 42 218.5 43 244.0 44 251.5 45 247.0 46 248.5 47 262.0 48 248.0 49 219.5 50 194.5 51 166.5 52 134.5 53 104.0 54 86.0 55 74.0 56 56.5 57 49.0 58 44.5 59 30.5 60 18.0 61 12.5 62 12.0 63 9.0 64 6.5 65 15.5 66 27.0 67 25.5 68 15.5 69 8.0 70 5.5 71 2.5 72 1.0 73 1.0 74 1.5 75 1.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.05 #Duplication Level Percentage of deduplicated Percentage of total 1 92.8610653487095 84.55 2 6.425041186161449 11.700000000000001 3 0.5491488193300385 1.5 4 0.054914881933003847 0.2 5 0.0 0.0 6 0.0 0.0 7 0.054914881933003847 0.35000000000000003 8 0.027457440966501923 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.027457440966501923 1.5 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTGAGCCATCTCGTAT 60 1.5 TruSeq Adapter, Index 25 (97% over 38bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTGAGCCATCTCGGAT 8 0.2 TruSeq Adapter, Index 25 (97% over 38bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTGAGCCATCGCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 25 (97% over 38bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTGAGCCATCTCGTTT 7 0.17500000000000002 TruSeq Adapter, Index 25 (97% over 38bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.42500000000000004 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 0.975 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.175 0.0 0.0 0.0 0.0 100-101 1.4249999999999998 0.0 0.0 0.0 0.0 102-103 1.6 0.0 0.0 0.0 0.0 104-105 1.8375 0.0 0.0 0.0 0.0 106-107 2.0625 0.0 0.0 0.0 0.0 108-109 2.2750000000000004 0.0 0.0 0.0 0.0 110-111 2.4749999999999996 0.0 0.0 0.0 0.0 112-113 2.8625 0.0 0.0 0.0 0.0 114-115 3.2 0.0 0.0 0.0 0.0 116-117 3.525 0.0 0.0 0.0 0.0 118-119 3.9125 0.0 0.0 0.0 0.0 120-121 4.275 0.0 0.0 0.0 0.0 122-123 4.75 0.0 0.0 0.0 0.0 124-125 5.2375 0.0 0.0 0.0 0.0 126-127 5.7375 0.0 0.0 0.0 0.0 128-129 6.262499999999999 0.0 0.0 0.0 0.0 130-131 6.7125 0.0 0.0 0.0 0.0 132-133 7.1 0.0 0.0 0.0 0.0 134-135 7.775 0.0 0.0 0.0 0.0 136-137 8.4875 0.0 0.0 0.0 0.0 138-139 9.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12690117 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690117_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.538 37.0 37.0 37.0 37.0 37.0 2 36.2875 37.0 37.0 37.0 37.0 37.0 3 36.096 37.0 37.0 37.0 37.0 37.0 4 36.194 37.0 37.0 37.0 37.0 37.0 5 36.452 37.0 37.0 37.0 37.0 37.0 6 36.1925 37.0 37.0 37.0 37.0 37.0 7 36.2485 37.0 37.0 37.0 37.0 37.0 8 36.1145 37.0 37.0 37.0 37.0 37.0 9 36.207 37.0 37.0 37.0 37.0 37.0 10-14 36.0531 37.0 37.0 37.0 37.0 37.0 15-19 36.005900000000004 37.0 37.0 37.0 37.0 37.0 20-24 35.987100000000005 37.0 37.0 37.0 37.0 37.0 25-29 35.7739 37.0 37.0 37.0 37.0 37.0 30-34 35.6968 37.0 37.0 37.0 37.0 37.0 35-39 35.70700000000001 37.0 37.0 37.0 37.0 37.0 40-44 35.67960000000001 37.0 37.0 37.0 37.0 37.0 45-49 35.743700000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.7151 37.0 37.0 37.0 37.0 37.0 55-59 35.7926 37.0 37.0 37.0 37.0 37.0 60-64 35.787 37.0 37.0 37.0 37.0 37.0 65-69 35.8132 37.0 37.0 37.0 37.0 37.0 70-74 35.5846 37.0 37.0 37.0 37.0 37.0 75-79 35.5774 37.0 37.0 37.0 37.0 37.0 80-84 35.585 37.0 37.0 37.0 37.0 37.0 85-89 35.672000000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.7464 37.0 37.0 37.0 37.0 37.0 95-99 35.813 37.0 37.0 37.0 37.0 37.0 100-104 35.888400000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.83540000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.869099999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.781600000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.7534 37.0 37.0 37.0 37.0 37.0 125-129 35.682 37.0 37.0 37.0 37.0 37.0 130-134 35.604 37.0 37.0 37.0 37.0 37.0 135-139 35.583800000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.5581 37.0 37.0 37.0 37.0 37.0 145-149 35.4321 37.0 37.0 37.0 37.0 37.0 150-151 34.87325 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 4.0 15 0.0 16 5.0 17 6.0 18 4.0 19 6.0 20 4.0 21 14.0 22 9.0 23 11.0 24 16.0 25 17.0 26 21.0 27 22.0 28 16.0 29 24.0 30 24.0 31 39.0 32 42.0 33 56.0 34 125.0 35 407.0 36 2795.0 37 330.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.25 25.924999999999997 9.45 22.375 2 32.275 27.075 25.074999999999996 15.575 3 23.474999999999998 28.199999999999996 29.325000000000003 19.0 4 25.224999999999998 33.675 22.650000000000002 18.45 5 28.275 34.599999999999994 21.0 16.125 6 24.025 37.175000000000004 20.349999999999998 18.45 7 23.45 22.2 34.75 19.6 8 24.85 26.375 25.5 23.275000000000002 9 26.325 23.75 26.6 23.325000000000003 10-14 26.090000000000003 28.610000000000003 24.395 20.905 15-19 25.365 28.425 25.595000000000002 20.615 20-24 25.615 27.584999999999997 25.965 20.835 25-29 25.145 28.18 26.05 20.625 30-34 24.310000000000002 27.665 26.86 21.165 35-39 24.395 27.894999999999996 26.66 21.05 40-44 24.675 28.1 26.479999999999997 20.745 45-49 25.5 27.715 26.245 20.54 50-54 25.064999999999998 27.555000000000003 26.555 20.825 55-59 25.619999999999997 27.465 26.474999999999998 20.44 60-64 25.135 27.22 26.755000000000003 20.89 65-69 25.629999999999995 27.200000000000003 26.3 20.87 70-74 25.759999999999998 27.145000000000003 26.174999999999997 20.919999999999998 75-79 25.005 26.995 26.76 21.240000000000002 80-84 24.88 27.85 26.615 20.655 85-89 25.235000000000003 27.505000000000003 25.919999999999998 21.34 90-94 25.319999999999997 27.185 26.889999999999997 20.605 95-99 25.525 27.66 25.775 21.04 100-104 26.14 26.695 26.810000000000002 20.355 105-109 25.945 27.985 25.53 20.54 110-114 26.465 27.36 25.855 20.32 115-119 25.835 27.485 25.885 20.794999999999998 120-124 26.85 27.63 25.5 20.02 125-129 26.71 27.975 25.575 19.74 130-134 26.640000000000004 27.42 26.07 19.869999999999997 135-139 27.265 27.555000000000003 25.585 19.595000000000002 140-144 28.335 27.18 25.155 19.33 145-149 28.32 27.560000000000002 25.174999999999997 18.945 150-151 28.499999999999996 26.3 25.3 19.900000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.5 2 1.0 3 0.5 4 0.0 5 0.5 6 0.5 7 1.0 8 1.5 9 2.5 10 3.0 11 1.0 12 0.5 13 1.0 14 1.0 15 1.5 16 2.0 17 1.5 18 1.0 19 0.5 20 2.0 21 2.0 22 0.0 23 2.0 24 3.5 25 4.0 26 3.0 27 1.5 28 2.5 29 4.5 30 6.0 31 8.5 32 14.0 33 16.0 34 22.5 35 39.0 36 51.5 37 64.0 38 89.0 39 133.0 40 164.0 41 189.0 42 227.0 43 260.0 44 300.0 45 307.5 46 275.0 47 267.0 48 268.0 49 235.5 50 192.0 51 143.5 52 112.0 53 100.5 54 84.0 55 66.5 56 53.5 57 42.5 58 34.0 59 26.0 60 17.5 61 17.0 62 12.5 63 5.0 64 1.5 65 1.5 66 1.5 67 1.5 68 4.5 69 4.0 70 1.5 71 2.0 72 2.5 73 2.0 74 0.5 75 1.5 76 2.0 77 0.5 78 1.0 79 1.0 80 0.0 81 0.5 82 1.0 83 2.0 84 1.5 85 0.5 86 2.5 87 3.0 88 2.5 89 3.0 90 2.5 91 2.5 92 3.0 93 4.5 94 6.5 95 8.0 96 8.5 97 6.0 98 5.0 99 5.0 100 7.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.65 #Duplication Level Percentage of deduplicated Percentage of total 1 93.06529951430113 86.225 2 6.233135456017269 11.55 3 0.62061521856449 1.725 4 0.053966540744738264 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026983270372369132 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 12 0.3 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.44999999999999996 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.775 0.0 0.0 0.0 0.0 92-93 0.85 0.0 0.0 0.0 0.0 94-95 1.0 0.0 0.0 0.0 0.0 96-97 1.075 0.0 0.0 0.0 0.0 98-99 1.25 0.0 0.0 0.0 0.0 100-101 1.5 0.0 0.0 0.0 0.0 102-103 1.6625 0.0 0.0 0.0 0.0 104-105 1.8875000000000002 0.0 0.0 0.0 0.0 106-107 2.1125 0.0 0.0 0.0 0.0 108-109 2.325 0.0 0.0 0.0 0.0 110-111 2.5250000000000004 0.0 0.0 0.0 0.0 112-113 2.925 0.0 0.0 0.0 0.0 114-115 3.2750000000000004 0.0 0.0 0.0 0.0 116-117 3.6 0.0 0.0 0.0 0.0 118-119 4.025 0.0 0.0 0.0 0.0 120-121 4.375 0.0 0.0 0.0 0.0 122-123 4.85 0.0 0.0 0.0 0.0 124-125 5.3375 0.0 0.0 0.0 0.0 126-127 5.8625 0.0 0.0 0.0 0.0 128-129 6.387499999999999 0.0 0.0 0.0 0.0 130-131 6.8625 0.0 0.0 0.0 0.0 132-133 7.25 0.0 0.0 0.0 0.0 134-135 7.975 0.0 0.0 0.0 0.0 136-137 8.675 0.0 0.0 0.0 0.0 138-139 9.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 642819 spots for SRR12690117.sra Written 642819 spots for SRR12690117.sra Read 642819 spots for SRR12690117.sra Written 642819 spots for SRR12690117.sra Read 642819 spots for SRR12690117.sra Written 642819 spots for SRR12690117.sra Read 642819 spots for SRR12690117.sra Written 642819 spots for SRR12690117.sra Read 642819 spots for SRR12690117.sra Written 642819 spots for SRR12690117.sra Read 642819 spots for SRR12690117.sra Written 642819 spots for SRR12690117.sra Read 642819 spots for SRR12690117.sra Written 642819 spots for SRR12690117.sra Read 642819 spots for SRR12690117.sra Written 642819 spots for SRR12690117.sra Read 642819 spots for SRR12690117.sra Written 642819 spots for SRR12690117.sra Read 642819 spots for SRR12690117.sra Written 642819 spots for SRR12690117.sra Read 642819 spots for SRR12690117.sra Written 642819 spots for SRR12690117.sra Read 642819 spots for SRR12690117.sra Written 642819 spots for SRR12690117.sra Read 642819 spots for SRR12690117.sra Written 642819 spots for SRR12690117.sra Read 642819 spots for SRR12690117.sra Written 642819 spots for SRR12690117.sra Read 642819 spots for SRR12690117.sra Written 642819 spots for SRR12690117.sra Read 642819 spots for SRR12690117.sra Written 642819 spots for SRR12690117.sra Read 642819 spots for SRR12690117.sra Written 642819 spots for SRR12690117.sra Read 642825 spots for SRR12690117.sra Written 642825 spots for SRR12690117.sra Read 642819 spots for SRR12690117.sra Written 642819 spots for SRR12690117.sra Read 642819 spots for SRR12690117.sra Written 642819 spots for SRR12690117.sra SRR ids: ['SRR12690117.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cs159cqx SRR12690117.sra spots: 12856386 blocks: [[1, 642819], [642820, 1285638], [1285639, 1928457], [1928458, 2571276], [2571277, 3214095], [3214096, 3856914], [3856915, 4499733], [4499734, 5142552], [5142553, 5785371], [5785372, 6428190], [6428191, 7071009], [7071010, 7713828], [7713829, 8356647], [8356648, 8999466], [8999467, 9642285], [9642286, 10285104], [10285105, 10927923], [10927924, 11570742], [11570743, 12213561], [12213562, 12856386]] SRR12690117 file size 4347462 SRR12690117 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690117 SRR12690117_1.fastq SRR12690117_2.fastq Input file: SRR12690117_1.fastq Paired file: SRR12690117_2.fastq trimmed: SRR12690117-trimmed-pair1.fastq, SRR12690117-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:56:32 2025 >> started Mon Feb 10 16:56:48 2025 >> done (16.019s) 12856386 read pairs processed; of these: 95 ( 0.00%) short read pairs filtered out after trimming by size control 242393 ( 1.89%) empty read pairs filtered out after trimming by size control 12613898 (98.11%) read pairs available; of these: 1924169 (15.25%) trimmed read pairs available after processing 10689729 (84.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 13 0.00% 20 11 0.00% 21 14 0.00% 22 25 0.00% 23 26 0.00% 24 31 0.00% 25 45 0.00% 26 29 0.00% 27 42 0.00% 28 40 0.00% 29 41 0.00% 30 48 0.00% 31 45 0.00% 32 36 0.00% 33 64 0.00% 34 41 0.00% 35 55 0.00% 36 65 0.00% 37 59 0.00% 38 86 0.00% 39 74 0.00% 40 87 0.00% 41 74 0.00% 42 80 0.00% 43 99 0.00% 44 102 0.00% 45 129 0.00% 46 86 0.00% 47 99 0.00% 48 143 0.00% 49 152 0.00% 50 170 0.00% 51 149 0.00% 52 172 0.00% 53 191 0.00% 54 185 0.00% 55 210 0.00% 56 198 0.00% 57 251 0.00% 58 248 0.00% 59 254 0.00% 60 297 0.00% 61 341 0.00% 62 347 0.00% 63 417 0.00% 64 452 0.00% 65 512 0.00% 66 570 0.00% 67 551 0.00% 68 584 0.00% 69 714 0.01% 70 847 0.01% 71 909 0.01% 72 1036 0.01% 73 1126 0.01% 74 1155 0.01% 75 1349 0.01% 76 1456 0.01% 77 1697 0.01% 78 1778 0.01% 79 2099 0.02% 80 2259 0.02% 81 2410 0.02% 82 2752 0.02% 83 3152 0.02% 84 3423 0.03% 85 3726 0.03% 86 4020 0.03% 87 4404 0.03% 88 4701 0.04% 89 5148 0.04% 90 5532 0.04% 91 6139 0.05% 92 6562 0.05% 93 7211 0.06% 94 7740 0.06% 95 8441 0.07% 96 8883 0.07% 97 9433 0.07% 98 10087 0.08% 99 10680 0.08% 100 11517 0.09% 101 12273 0.10% 102 12895 0.10% 103 13578 0.11% 104 14612 0.12% 105 15082 0.12% 106 15851 0.13% 107 16657 0.13% 108 17298 0.14% 109 18214 0.14% 110 18825 0.15% 111 19650 0.16% 112 20885 0.17% 113 21695 0.17% 114 22365 0.18% 115 23561 0.19% 116 24810 0.20% 117 25802 0.20% 118 26196 0.21% 119 27105 0.21% 120 28042 0.22% 121 29544 0.23% 122 30470 0.24% 123 31755 0.25% 124 33413 0.26% 125 33862 0.27% 126 34997 0.28% 127 36148 0.29% 128 36871 0.29% 129 38389 0.30% 130 39472 0.31% 131 40069 0.32% 132 41698 0.33% 133 43282 0.34% 134 44170 0.35% 135 46149 0.37% 136 46984 0.37% 137 47223 0.37% 138 48486 0.38% 139 50289 0.40% 140 50154 0.40% 141 51330 0.41% 142 53467 0.42% 143 54777 0.43% 144 56455 0.45% 145 57577 0.46% 146 58770 0.47% 147 59230 0.47% 148 60375 0.48% 149 60467 0.48% 150 62471 0.50% 151 10689729 84.75% 12613898 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=14 prefix-density=0.70 prefix-fanout=2.1 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=45.76 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.8 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=9 prefix-density=0.93 prefix-fanout=1.9 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=75.07 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=5.6 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATT SRR12690117 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:57:34 Started mapping on | Feb 10 16:57:34 Finished on | Feb 10 16:59:09 Mapping speed, Million of reads per hour | 478.00 Number of input reads | 12613898 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 11837414 Uniquely mapped reads % | 93.84% Average mapped length | 294.05 Number of splices: Total | 11806131 Number of splices: Annotated (sjdb) | 11571258 Number of splices: GT/AG | 11553189 Number of splices: GC/AG | 215437 Number of splices: AT/AC | 8895 Number of splices: Non-canonical | 28610 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 3.07 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 302589 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 67762 % of reads mapped to too many loci | 0.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.98% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 473895 473895 473895 N_multimapping 302589 302589 302589 N_noFeature 290092 11696992 332836 N_ambiguous 173796 754 75694 UnstrandedReadsAssigned:11373526 PositiveStrandReadsAssigned:139668 NegativeStrandReadsAssigned:11428884 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690117 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690117-trimmed-pair1.fastq SRR12690117-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,613,898 reads, 11,515,648 reads pseudoaligned [quant] estimated average fragment length: 210.129 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52401 SRR12690117.ke.tsv 34699 SRR12690117.se.tsv 87100 total ==> SRR12690117.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1808.87 239 9.6695 Potri.005G024800.1.v4.1 1035 825.871 144 12.7604 Potri.004G059700.1.v4.1 961 751.878 44 4.28272 Potri.007G009000.2.v4.1 1416 1206.87 0 0 Potri.003G141000.2.v4.1 2943 2733.87 362 9.69046 Potri.016G087400.1.v4.1 270 86.3784 868.562 735.884 Potri.015G069301.1.v4.1 564 355.717 0 0 Potri.010G195200.1.v4.1 1773 1563.87 3 0.140389 Potri.012G127500.1.v4.1 977 767.878 901 85.871 ==> SRR12690117.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 151 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 229 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 47 SRR12690117 completed mapping pipeline successfully