Starting /dee2/code/volunteer_pipeline.sh SRR12690118 current disk space = 3058633502720 free memory = 1290759040 SRR12690118 SRAfilesize 1fe2d571157763d330ecda4a9e189d87 SRR12690118.sra SRR12690118.sra file validated SRR12690118 is paired end SRR12690118 is conventional basespace SRR12690118 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690118_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5805 37.0 37.0 37.0 37.0 37.0 2 36.401 37.0 37.0 37.0 37.0 37.0 3 36.6665 37.0 37.0 37.0 37.0 37.0 4 36.657 37.0 37.0 37.0 37.0 37.0 5 36.6605 37.0 37.0 37.0 37.0 37.0 6 36.528 37.0 37.0 37.0 37.0 37.0 7 36.5465 37.0 37.0 37.0 37.0 37.0 8 36.6225 37.0 37.0 37.0 37.0 37.0 9 36.6215 37.0 37.0 37.0 37.0 37.0 10-14 36.655 37.0 37.0 37.0 37.0 37.0 15-19 36.6397 37.0 37.0 37.0 37.0 37.0 20-24 36.594100000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.555800000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.5008 37.0 37.0 37.0 37.0 37.0 35-39 36.478899999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.4901 37.0 37.0 37.0 37.0 37.0 45-49 36.456 37.0 37.0 37.0 37.0 37.0 50-54 36.494600000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.3937 37.0 37.0 37.0 37.0 37.0 60-64 36.425599999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.398199999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.3253 37.0 37.0 37.0 37.0 37.0 75-79 36.3529 37.0 37.0 37.0 37.0 37.0 80-84 36.263799999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.3052 37.0 37.0 37.0 37.0 37.0 90-94 36.2937 37.0 37.0 37.0 37.0 37.0 95-99 36.206999999999994 37.0 37.0 37.0 37.0 37.0 100-104 36.2116 37.0 37.0 37.0 37.0 37.0 105-109 36.138400000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.1263 37.0 37.0 37.0 37.0 37.0 115-119 36.09929999999999 37.0 37.0 37.0 37.0 37.0 120-124 36.0777 37.0 37.0 37.0 37.0 37.0 125-129 36.0407 37.0 37.0 37.0 37.0 37.0 130-134 35.9519 37.0 37.0 37.0 37.0 37.0 135-139 36.0173 37.0 37.0 37.0 37.0 37.0 140-144 35.8019 37.0 37.0 37.0 37.0 37.0 145-149 35.873900000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.66775 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 1.0 25 4.0 26 4.0 27 5.0 28 6.0 29 17.0 30 14.0 31 35.0 32 36.0 33 68.0 34 126.0 35 316.0 36 2992.0 37 374.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.325 11.575000000000001 7.8 46.300000000000004 2 19.06312625250501 14.203406813627254 36.397795591182366 30.335671342685373 3 17.474999999999998 15.475 27.375 39.675 4 22.575 22.175 23.549999999999997 31.7 5 22.5 31.55 24.525 21.425 6 20.625 34.925 23.45 21.0 7 15.825 26.05 40.575 17.549999999999997 8 18.975 24.85 32.025 24.15 9 17.95 23.674999999999997 34.825 23.549999999999997 10-14 19.455 30.135 27.73 22.68 15-19 19.81 27.73 27.965 24.495 20-24 19.84 28.73 27.76 23.669999999999998 25-29 20.145 28.02 27.634999999999998 24.2 30-34 19.78 28.315 27.689999999999998 24.215 35-39 20.325 28.110000000000003 27.474999999999998 24.09 40-44 20.330000000000002 28.785 27.155 23.73 45-49 20.225 28.58 27.389999999999997 23.805 50-54 19.81 28.299999999999997 27.605 24.285 55-59 20.315 28.544999999999998 27.215 23.925 60-64 19.98 27.855 27.915 24.25 65-69 19.759999999999998 28.785 27.339999999999996 24.115000000000002 70-74 20.195 28.575 27.575 23.655 75-79 19.59 28.310000000000002 27.74 24.36 80-84 20.28 28.375 27.665 23.68 85-89 20.244999999999997 28.749999999999996 27.68 23.325000000000003 90-94 20.330000000000002 27.955000000000002 28.110000000000003 23.605 95-99 20.62 28.28 27.155 23.945 100-104 20.64 28.000000000000004 28.349999999999998 23.01 105-109 20.244999999999997 27.975 27.765 24.015 110-114 20.705000000000002 28.52 27.694999999999997 23.080000000000002 115-119 20.7 28.610000000000003 27.439999999999998 23.25 120-124 20.84 28.035 27.62 23.505000000000003 125-129 20.880000000000003 28.199999999999996 27.075 23.845 130-134 20.78 27.54 27.74 23.94 135-139 21.02 27.73 27.32 23.93 140-144 20.745 28.03 27.08 24.145 145-149 21.224999999999998 27.74 27.38 23.655 150-151 20.575 28.075 27.1 24.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 0.5 23 1.5 24 2.5 25 2.0 26 2.0 27 5.0 28 9.5 29 12.0 30 16.0 31 24.5 32 30.0 33 34.0 34 45.5 35 70.5 36 88.0 37 97.5 38 119.5 39 148.5 40 188.0 41 210.0 42 240.0 43 263.0 44 271.5 45 282.0 46 269.0 47 248.5 48 226.0 49 207.5 50 185.5 51 162.5 52 126.0 53 91.0 54 73.5 55 59.0 56 53.0 57 37.5 58 18.5 59 17.5 60 18.5 61 11.5 62 5.5 63 4.5 64 4.5 65 4.5 66 4.0 67 3.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.525 #Duplication Level Percentage of deduplicated Percentage of total 1 89.94694219491763 80.525 2 8.768500418877409 15.7 3 1.0332309410779112 2.775 4 0.16755096341803966 0.6 5 0.05585032113934655 0.25 6 0.027925160569673275 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCCGACGAACCACGAGACTCCACCGTTAGATATCTGAGAAAAAAGGTC 6 0.15 No Hit CTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATC 5 0.125 No Hit ATAAGATCAATAATTTTCACCTCTTTAGATCGGAAACACATCGCTACCAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.6625 0.0 0.0 0.0 0.0 106-107 0.7875 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 0.95 0.0 0.0 0.0 0.0 112-113 1.1 0.0 0.0 0.0 0.0 114-115 1.2125 0.0 0.0 0.0 0.0 116-117 1.3250000000000002 0.0 0.0 0.0 0.0 118-119 1.4 0.0 0.0 0.0 0.0 120-121 1.5625 0.0 0.0 0.0 0.0 122-123 1.7999999999999998 0.0 0.0 0.0 0.0 124-125 2.075 0.0 0.0 0.0 0.0 126-127 2.5625 0.0 0.0 0.0 0.0 128-129 2.7375 0.0 0.0 0.0 0.0 130-131 2.9875 0.0 0.0 0.0 0.0 132-133 3.25 0.0 0.0 0.0 0.0 134-135 3.525 0.0 0.0 0.0 0.0 136-137 3.775 0.0 0.0 0.0 0.0 138-139 4.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAATAT 10 0.006830828 145.0 3 TTCAAGT 10 0.006830828 145.0 7 TAATTCA 10 0.006830828 145.0 4 TGAAATA 10 0.006830828 145.0 2 ATTCAAG 10 0.006830828 145.0 6 TAGACCA 10 0.006830828 145.0 9 >>END_MODULE SRR12690118 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690118_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.31325 37.0 37.0 37.0 37.0 37.0 2 36.2945 37.0 37.0 37.0 37.0 37.0 3 36.248 37.0 37.0 37.0 37.0 37.0 4 36.325 37.0 37.0 37.0 37.0 37.0 5 36.342 37.0 37.0 37.0 37.0 37.0 6 36.3995 37.0 37.0 37.0 37.0 37.0 7 36.3915 37.0 37.0 37.0 37.0 37.0 8 36.375 37.0 37.0 37.0 37.0 37.0 9 36.4265 37.0 37.0 37.0 37.0 37.0 10-14 36.3467 37.0 37.0 37.0 37.0 37.0 15-19 36.337 37.0 37.0 37.0 37.0 37.0 20-24 36.340799999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.291999999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.298700000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.2386 37.0 37.0 37.0 37.0 37.0 40-44 36.2273 37.0 37.0 37.0 37.0 37.0 45-49 36.2381 37.0 37.0 37.0 37.0 37.0 50-54 36.2358 37.0 37.0 37.0 37.0 37.0 55-59 36.2046 37.0 37.0 37.0 37.0 37.0 60-64 36.1485 37.0 37.0 37.0 37.0 37.0 65-69 36.1065 37.0 37.0 37.0 37.0 37.0 70-74 36.072500000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.08709999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.103100000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.0298 37.0 37.0 37.0 37.0 37.0 90-94 35.9644 37.0 37.0 37.0 37.0 37.0 95-99 35.996300000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.0663 37.0 37.0 37.0 37.0 37.0 105-109 36.027499999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.9204 37.0 37.0 37.0 37.0 37.0 115-119 35.9021 37.0 37.0 37.0 37.0 37.0 120-124 35.7903 37.0 37.0 37.0 37.0 37.0 125-129 35.7282 37.0 37.0 37.0 37.0 37.0 130-134 35.6731 37.0 37.0 37.0 37.0 37.0 135-139 35.6706 37.0 37.0 37.0 37.0 37.0 140-144 35.5723 37.0 37.0 37.0 37.0 37.0 145-149 35.509100000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.13175 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 1.0 20 0.0 21 0.0 22 3.0 23 1.0 24 3.0 25 4.0 26 5.0 27 12.0 28 7.0 29 19.0 30 24.0 31 37.0 32 56.0 33 95.0 34 171.0 35 519.0 36 2779.0 37 260.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.15803950987747 22.58064516129032 13.578394598649663 31.682920730182545 2 26.8 28.125 30.349999999999998 14.725 3 20.8 27.875 30.225 21.099999999999998 4 22.875 34.849999999999994 23.35 18.925 5 23.9 37.4 22.875 15.825 6 19.775000000000002 39.324999999999996 23.325000000000003 17.575 7 20.025000000000002 23.225 38.425 18.325 8 21.775 25.3 28.725 24.2 9 20.7 24.825 30.55 23.925 10-14 23.035 29.799999999999997 26.14 21.025 15-19 22.615 28.77 27.665 20.95 20-24 22.56 28.255000000000003 28.255000000000003 20.93 25-29 22.515 28.449999999999996 28.015 21.02 30-34 22.395 28.37 27.92 21.315 35-39 22.12 28.43 28.294999999999998 21.154999999999998 40-44 22.6 28.249999999999996 28.4 20.75 45-49 22.825 27.295 28.49 21.39 50-54 22.830000000000002 27.68 28.144999999999996 21.345 55-59 22.869999999999997 27.779999999999998 28.51 20.84 60-64 22.515 28.005000000000003 28.09 21.39 65-69 22.515 27.93 28.425 21.13 70-74 23.175 26.674999999999997 28.74 21.41 75-79 23.43 27.435 27.62 21.515 80-84 23.22 28.189999999999998 27.24 21.349999999999998 85-89 23.305 27.16 28.134999999999998 21.4 90-94 23.23 27.97 27.634999999999998 21.165 95-99 23.075000000000003 27.865000000000002 27.725 21.335 100-104 24.185000000000002 27.845 27.46 20.51 105-109 22.97 28.575 27.810000000000002 20.645 110-114 23.82 28.535 27.205000000000002 20.44 115-119 23.5 28.549999999999997 27.395000000000003 20.555 120-124 23.905 28.244999999999997 27.310000000000002 20.54 125-129 24.055 27.800000000000004 27.455000000000002 20.69 130-134 24.32 28.07 27.375 20.235 135-139 24.65 27.235 27.67 20.445 140-144 25.019999999999996 27.605 27.310000000000002 20.064999999999998 145-149 24.745 28.005000000000003 27.11 20.14 150-151 25.662499999999998 28.000000000000004 26.224999999999998 20.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.0 4 1.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 0.5 20 1.0 21 1.5 22 1.5 23 2.0 24 1.5 25 1.5 26 7.5 27 10.5 28 8.0 29 14.0 30 17.0 31 18.0 32 29.5 33 38.0 34 56.5 35 69.0 36 75.5 37 108.0 38 144.5 39 164.5 40 199.0 41 219.0 42 235.5 43 275.0 44 288.5 45 304.5 46 286.0 47 236.5 48 212.5 49 190.5 50 168.5 51 146.0 52 100.5 53 74.5 54 70.0 55 51.5 56 43.0 57 29.0 58 18.0 59 18.5 60 16.0 61 11.0 62 5.5 63 4.0 64 3.5 65 3.0 66 2.5 67 2.5 68 1.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.4 #Duplication Level Percentage of deduplicated Percentage of total 1 89.93288590604027 80.4 2 8.724832214765101 15.6 3 1.006711409395973 2.7 4 0.25167785234899326 0.8999999999999999 5 0.05592841163310962 0.25 6 0.02796420581655481 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit CAGCTGTGTCCGAGGACGGATTCAATACGGAGAAAGTCTCGACTCTCCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.6625 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.9 0.0 0.0 0.0 0.0 110-111 1.0 0.0 0.0 0.0 0.0 112-113 1.15 0.0 0.0 0.0 0.0 114-115 1.2625 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.4500000000000002 0.0 0.0 0.0 0.0 120-121 1.6124999999999998 0.0 0.0 0.0 0.0 122-123 1.85 0.0 0.0 0.0 0.0 124-125 2.125 0.0 0.0 0.0 0.0 126-127 2.6125 0.0 0.0 0.0 0.0 128-129 2.7874999999999996 0.0 0.0 0.0 0.0 130-131 3.0375 0.0 0.0 0.0 0.0 132-133 3.3 0.0 0.0 0.0 0.0 134-135 3.575 0.0 0.0 0.0 0.0 136-137 3.85 0.0 0.0 0.0 0.0 138-139 4.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTAATT 25 8.7132835E-4 87.0 2 >>END_MODULE Read 575953 spots for SRR12690118.sra Written 575953 spots for SRR12690118.sra Read 575953 spots for SRR12690118.sra Written 575953 spots for SRR12690118.sra Read 575953 spots for SRR12690118.sra Written 575953 spots for SRR12690118.sra Read 575953 spots for SRR12690118.sra Written 575953 spots for SRR12690118.sra Read 575953 spots for SRR12690118.sra Written 575953 spots for SRR12690118.sra Read 575953 spots for SRR12690118.sra Written 575953 spots for SRR12690118.sra Read 575953 spots for SRR12690118.sra Written 575953 spots for SRR12690118.sra Read 575953 spots for SRR12690118.sra Written 575953 spots for SRR12690118.sra Read 575953 spots for SRR12690118.sra Written 575953 spots for SRR12690118.sra Read 575953 spots for SRR12690118.sra Written 575953 spots for SRR12690118.sra Read 575953 spots for SRR12690118.sra Written 575953 spots for SRR12690118.sra Read 575953 spots for SRR12690118.sra Written 575953 spots for SRR12690118.sra Read 575953 spots for SRR12690118.sra Written 575953 spots for SRR12690118.sra Read 575953 spots for SRR12690118.sra Written 575953 spots for SRR12690118.sra Read 575953 spots for SRR12690118.sra Written 575953 spots for SRR12690118.sra Read 575953 spots for SRR12690118.sra Written 575953 spots for SRR12690118.sra Read 575953 spots for SRR12690118.sra Written 575953 spots for SRR12690118.sra Read 575968 spots for SRR12690118.sra Written 575968 spots for SRR12690118.sra Read 575953 spots for SRR12690118.sra Written 575953 spots for SRR12690118.sra Read 575953 spots for SRR12690118.sra Written 575953 spots for SRR12690118.sra SRR ids: ['SRR12690118.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e0vmwh_c SRR12690118.sra spots: 11519075 blocks: [[1, 575953], [575954, 1151906], [1151907, 1727859], [1727860, 2303812], [2303813, 2879765], [2879766, 3455718], [3455719, 4031671], [4031672, 4607624], [4607625, 5183577], [5183578, 5759530], [5759531, 6335483], [6335484, 6911436], [6911437, 7487389], [7487390, 8063342], [8063343, 8639295], [8639296, 9215248], [9215249, 9791201], [9791202, 10367154], [10367155, 10943107], [10943108, 11519075]] SRR12690118 file size 3892985 SRR12690118 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690118 SRR12690118_1.fastq SRR12690118_2.fastq Input file: SRR12690118_1.fastq Paired file: SRR12690118_2.fastq trimmed: SRR12690118-trimmed-pair1.fastq, SRR12690118-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:12:10 2025 >> started Mon Feb 10 16:12:24 2025 >> done (13.080s) 11519075 read pairs processed; of these: 14 ( 0.00%) short read pairs filtered out after trimming by size control 1105 ( 0.01%) empty read pairs filtered out after trimming by size control 11517956 (99.99%) read pairs available; of these: 797582 ( 6.92%) trimmed read pairs available after processing 10720374 (93.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 2 0.00% 21 1 0.00% 22 1 0.00% 23 3 0.00% 24 4 0.00% 25 7 0.00% 26 4 0.00% 27 6 0.00% 28 6 0.00% 29 5 0.00% 30 6 0.00% 31 11 0.00% 32 10 0.00% 33 7 0.00% 34 10 0.00% 35 9 0.00% 36 13 0.00% 37 12 0.00% 38 10 0.00% 39 15 0.00% 40 8 0.00% 41 23 0.00% 42 16 0.00% 43 16 0.00% 44 29 0.00% 45 20 0.00% 46 24 0.00% 47 30 0.00% 48 19 0.00% 49 43 0.00% 50 58 0.00% 51 39 0.00% 52 56 0.00% 53 43 0.00% 54 49 0.00% 55 49 0.00% 56 61 0.00% 57 75 0.00% 58 96 0.00% 59 86 0.00% 60 110 0.00% 61 148 0.00% 62 174 0.00% 63 134 0.00% 64 159 0.00% 65 181 0.00% 66 185 0.00% 67 200 0.00% 68 261 0.00% 69 245 0.00% 70 278 0.00% 71 355 0.00% 72 423 0.00% 73 430 0.00% 74 485 0.00% 75 534 0.00% 76 598 0.01% 77 632 0.01% 78 676 0.01% 79 811 0.01% 80 909 0.01% 81 1014 0.01% 82 1072 0.01% 83 1193 0.01% 84 1371 0.01% 85 1546 0.01% 86 1705 0.01% 87 1817 0.02% 88 1954 0.02% 89 2070 0.02% 90 2219 0.02% 91 2418 0.02% 92 2683 0.02% 93 2858 0.02% 94 3058 0.03% 95 3189 0.03% 96 3603 0.03% 97 3725 0.03% 98 4160 0.04% 99 4242 0.04% 100 4529 0.04% 101 4733 0.04% 102 5119 0.04% 103 5443 0.05% 104 5520 0.05% 105 5912 0.05% 106 6360 0.06% 107 6589 0.06% 108 6988 0.06% 109 7328 0.06% 110 7429 0.06% 111 7750 0.07% 112 8043 0.07% 113 8404 0.07% 114 8749 0.08% 115 9548 0.08% 116 9709 0.08% 117 10041 0.09% 118 10544 0.09% 119 10723 0.09% 120 11599 0.10% 121 11887 0.10% 122 12368 0.11% 123 12592 0.11% 124 13030 0.11% 125 13252 0.12% 126 14052 0.12% 127 14839 0.13% 128 15071 0.13% 129 15697 0.14% 130 16226 0.14% 131 16683 0.14% 132 17059 0.15% 133 17666 0.15% 134 17987 0.16% 135 18754 0.16% 136 19146 0.17% 137 19686 0.17% 138 20156 0.17% 139 21252 0.18% 140 21614 0.19% 141 22109 0.19% 142 23387 0.20% 143 23592 0.20% 144 24271 0.21% 145 24972 0.22% 146 25551 0.22% 147 26296 0.23% 148 26779 0.23% 149 27321 0.24% 150 28414 0.25% 151 10720374 93.08% 11517956 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=16 prefix-density=0.43 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=fanout-score sequence-density=0.12 sequence-density-rank=23 fanout-score=8.67 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=5.1 sequence=CCATCCACATTAGCACCATATTTGTCGACATATTGGTACAC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=27 prefix-density=0.50 prefix-fanout=2.2 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=35.44 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=9.4 sequence=GGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCTGTCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTATCCCGGGGAGCTCTCAACCCCCATAAACCAGTGTACGGTTGCGGAAGGGGTAATCGATATTGCGTACCTAAAACACCAAGAGGTTGCCCAAATCCTTACAA SRR12690118 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:13:12 Started mapping on | Feb 10 16:13:13 Finished on | Feb 10 16:14:37 Mapping speed, Million of reads per hour | 493.63 Number of input reads | 11517956 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 10861151 Uniquely mapped reads % | 94.30% Average mapped length | 297.76 Number of splices: Total | 10977555 Number of splices: Annotated (sjdb) | 10693031 Number of splices: GT/AG | 10756925 Number of splices: GC/AG | 169058 Number of splices: AT/AC | 8291 Number of splices: Non-canonical | 43281 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 305375 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 89164 % of reads mapped to too many loci | 0.77% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.11% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 351430 351430 351430 N_multimapping 305375 305375 305375 N_noFeature 460415 10719651 504247 N_ambiguous 171583 674 73577 UnstrandedReadsAssigned:10229153 PositiveStrandReadsAssigned:140826 NegativeStrandReadsAssigned:10283327 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690118 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690118-trimmed-pair1.fastq SRR12690118-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,517,956 reads, 10,264,520 reads pseudoaligned [quant] estimated average fragment length: 263.216 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,013 rounds 52401 SRR12690118.ke.tsv 34699 SRR12690118.se.tsv 87100 total ==> SRR12690118.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.78 547 26.1314 Potri.005G024800.1.v4.1 1035 772.784 339 36.795 Potri.004G059700.1.v4.1 961 698.875 53 6.36097 Potri.007G009000.2.v4.1 1416 1153.78 0 0 Potri.003G141000.2.v4.1 2943 2680.78 567 17.7406 Potri.016G087400.1.v4.1 270 74.6209 530.57 596.389 Potri.015G069301.1.v4.1 564 313.133 0 0 Potri.010G195200.1.v4.1 1773 1510.78 95 5.27434 Potri.012G127500.1.v4.1 977 714.845 140 16.4272 ==> SRR12690118.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 64 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 161 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 22 SRR12690118 completed mapping pipeline successfully