Starting /dee2/code/volunteer_pipeline.sh SRR12690119 current disk space = 3058561105920 free memory = 1068682484 SRR12690119 SRAfilesize baee570ae01a59d331ad6157a1db3d97 SRR12690119.sra SRR12690119.sra file validated SRR12690119 is paired end SRR12690119 is conventional basespace SRR12690119 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690119_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.528 37.0 37.0 37.0 37.0 37.0 2 36.333 37.0 37.0 37.0 37.0 37.0 3 36.6685 37.0 37.0 37.0 37.0 37.0 4 36.5985 37.0 37.0 37.0 37.0 37.0 5 36.5455 37.0 37.0 37.0 37.0 37.0 6 36.5945 37.0 37.0 37.0 37.0 37.0 7 36.5175 37.0 37.0 37.0 37.0 37.0 8 36.548 37.0 37.0 37.0 37.0 37.0 9 36.529 37.0 37.0 37.0 37.0 37.0 10-14 36.615300000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.6023 37.0 37.0 37.0 37.0 37.0 20-24 36.6372 37.0 37.0 37.0 37.0 37.0 25-29 36.5696 37.0 37.0 37.0 37.0 37.0 30-34 36.5301 37.0 37.0 37.0 37.0 37.0 35-39 36.5144 37.0 37.0 37.0 37.0 37.0 40-44 36.4893 37.0 37.0 37.0 37.0 37.0 45-49 36.4842 37.0 37.0 37.0 37.0 37.0 50-54 36.4554 37.0 37.0 37.0 37.0 37.0 55-59 36.3741 37.0 37.0 37.0 37.0 37.0 60-64 36.3805 37.0 37.0 37.0 37.0 37.0 65-69 36.386 37.0 37.0 37.0 37.0 37.0 70-74 36.35 37.0 37.0 37.0 37.0 37.0 75-79 36.335699999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.268899999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.2982 37.0 37.0 37.0 37.0 37.0 90-94 36.289699999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.2211 37.0 37.0 37.0 37.0 37.0 100-104 36.1894 37.0 37.0 37.0 37.0 37.0 105-109 36.1558 37.0 37.0 37.0 37.0 37.0 110-114 36.1197 37.0 37.0 37.0 37.0 37.0 115-119 36.1394 37.0 37.0 37.0 37.0 37.0 120-124 36.0197 37.0 37.0 37.0 37.0 37.0 125-129 35.9855 37.0 37.0 37.0 37.0 37.0 130-134 36.0081 37.0 37.0 37.0 37.0 37.0 135-139 35.9823 37.0 37.0 37.0 37.0 37.0 140-144 35.8437 37.0 37.0 37.0 37.0 37.0 145-149 35.806 37.0 37.0 37.0 37.0 37.0 150-151 35.65775 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 0.0 26 3.0 27 8.0 28 10.0 29 14.0 30 23.0 31 39.0 32 45.0 33 68.0 34 114.0 35 275.0 36 3074.0 37 325.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.675 11.1 8.649999999999999 41.575 2 20.622177621675867 13.54741595584546 35.348720521826394 30.481685900652284 3 16.725 14.899999999999999 27.075 41.3 4 21.6 22.55 25.900000000000002 29.95 5 23.400000000000002 29.299999999999997 24.725 22.575 6 21.4 33.125 23.75 21.725 7 16.6 26.700000000000003 39.375 17.325 8 17.349999999999998 27.375 31.324999999999996 23.95 9 17.724999999999998 24.5 34.275 23.5 10-14 19.77 29.37 27.755000000000003 23.105 15-19 19.009999999999998 28.16 28.315 24.515 20-24 20.05 27.105 28.349999999999998 24.495 25-29 19.77 27.96 28.27 24.0 30-34 19.744999999999997 28.13 27.675 24.45 35-39 20.25 27.965 27.395000000000003 24.39 40-44 20.79 27.965 27.675 23.57 45-49 20.355 28.065 27.785 23.794999999999998 50-54 19.845 28.065 27.91 24.18 55-59 20.07 28.95 26.825 24.154999999999998 60-64 20.365 27.775 27.785 24.075 65-69 20.325 28.055000000000003 27.275 24.345 70-74 19.919999999999998 28.705000000000002 27.400000000000002 23.974999999999998 75-79 20.49 27.715 27.725 24.07 80-84 20.515 28.634999999999998 27.715 23.135 85-89 20.91 28.244999999999997 26.71 24.135 90-94 20.785 27.83 27.675 23.71 95-99 20.78 27.534999999999997 28.13 23.555 100-104 20.645 29.14 26.93 23.285 105-109 20.47 28.15 27.245 24.135 110-114 21.075 27.700000000000003 27.700000000000003 23.525 115-119 21.05 27.85 27.694999999999997 23.405 120-124 20.735 27.98 27.41 23.875 125-129 20.919999999999998 28.084999999999997 28.01 22.985 130-134 20.57 28.02 27.689999999999998 23.72 135-139 21.745 27.950000000000003 26.615 23.69 140-144 21.615000000000002 27.565 26.83 23.990000000000002 145-149 21.19 28.12 27.015 23.674999999999997 150-151 21.475 28.5875 26.3125 23.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 1.0 24 3.5 25 6.0 26 4.5 27 4.0 28 9.5 29 12.0 30 12.5 31 18.0 32 21.5 33 30.5 34 41.0 35 64.0 36 90.0 37 92.5 38 126.0 39 161.0 40 168.5 41 201.5 42 231.0 43 234.0 44 251.0 45 273.5 46 284.0 47 271.5 48 247.0 49 223.0 50 180.0 51 142.5 52 133.0 53 118.0 54 85.5 55 63.5 56 51.5 57 42.0 58 28.0 59 15.5 60 11.5 61 13.5 62 11.5 63 5.5 64 2.5 65 2.0 66 2.0 67 2.0 68 1.0 69 1.0 70 1.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.525 #Duplication Level Percentage of deduplicated Percentage of total 1 91.88746244195575 84.1 2 7.129199672220704 13.05 3 0.819448238186288 2.25 4 0.16388964763725758 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.07500000000000001 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.3 0.0 0.0 0.0 0.0 108-109 1.4875 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.8125 0.0 0.0 0.0 0.0 114-115 2.0125 0.0 0.0 0.0 0.0 116-117 2.25 0.0 0.0 0.0 0.0 118-119 2.55 0.0 0.0 0.0 0.0 120-121 2.8875 0.0 0.0 0.0 0.0 122-123 3.175 0.0 0.0 0.0 0.0 124-125 3.4625000000000004 0.0 0.0 0.0 0.0 126-127 4.2125 0.0 0.0 0.0 0.0 128-129 4.6 0.0 0.0 0.0 0.0 130-131 5.05 0.0 0.0 0.0 0.0 132-133 5.6375 0.0 0.0 0.0 0.0 134-135 6.1125 0.0 0.0 0.0 0.0 136-137 6.5875 0.0 0.0 0.0 0.0 138-139 7.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 50 5.60876E-5 20.3 70-74 >>END_MODULE SRR12690119 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690119_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.38975 37.0 37.0 37.0 37.0 37.0 2 36.1325 37.0 37.0 37.0 37.0 37.0 3 36.089 37.0 37.0 37.0 37.0 37.0 4 36.259 37.0 37.0 37.0 37.0 37.0 5 36.307 37.0 37.0 37.0 37.0 37.0 6 36.219 37.0 37.0 37.0 37.0 37.0 7 36.2495 37.0 37.0 37.0 37.0 37.0 8 36.287 37.0 37.0 37.0 37.0 37.0 9 36.353 37.0 37.0 37.0 37.0 37.0 10-14 36.2847 37.0 37.0 37.0 37.0 37.0 15-19 36.2561 37.0 37.0 37.0 37.0 37.0 20-24 36.226600000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.171299999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.160000000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.178 37.0 37.0 37.0 37.0 37.0 40-44 36.1006 37.0 37.0 37.0 37.0 37.0 45-49 36.0877 37.0 37.0 37.0 37.0 37.0 50-54 36.049800000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.0592 37.0 37.0 37.0 37.0 37.0 60-64 35.9491 37.0 37.0 37.0 37.0 37.0 65-69 35.9936 37.0 37.0 37.0 37.0 37.0 70-74 35.925 37.0 37.0 37.0 37.0 37.0 75-79 35.872 37.0 37.0 37.0 37.0 37.0 80-84 35.8728 37.0 37.0 37.0 37.0 37.0 85-89 35.8644 37.0 37.0 37.0 37.0 37.0 90-94 35.8017 37.0 37.0 37.0 37.0 37.0 95-99 35.7788 37.0 37.0 37.0 37.0 37.0 100-104 35.813300000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.785199999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.65259999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.5989 37.0 37.0 37.0 37.0 37.0 120-124 35.5868 37.0 37.0 37.0 37.0 37.0 125-129 35.5166 37.0 37.0 37.0 37.0 37.0 130-134 35.4803 37.0 37.0 37.0 37.0 37.0 135-139 35.420899999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.426 37.0 37.0 37.0 37.0 37.0 145-149 35.2336 37.0 37.0 37.0 32.2 37.0 150-151 34.77675000000001 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 5.0 14 2.0 15 7.0 16 0.0 17 4.0 18 4.0 19 2.0 20 1.0 21 1.0 22 3.0 23 3.0 24 5.0 25 9.0 26 11.0 27 9.0 28 14.0 29 18.0 30 34.0 31 36.0 32 65.0 33 80.0 34 181.0 35 505.0 36 2707.0 37 292.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.25906476619154 23.95598899724931 12.703175793948487 27.081770442610654 2 26.174999999999997 27.750000000000004 29.275000000000002 16.8 3 19.075 28.475 33.175 19.275000000000002 4 24.8 33.725 23.674999999999997 17.8 5 26.474999999999998 35.475 22.3 15.75 6 20.325 39.125 22.275 18.275 7 20.625 22.3 38.224999999999994 18.85 8 21.275 26.474999999999998 27.474999999999998 24.775 9 20.9 25.25 30.625000000000004 23.225 10-14 23.505000000000003 29.43 25.990000000000002 21.075 15-19 23.465 28.549999999999997 27.189999999999998 20.794999999999998 20-24 23.474999999999998 28.435 27.58 20.51 25-29 22.68 28.610000000000003 27.310000000000002 21.4 30-34 22.884999999999998 28.060000000000002 27.58 21.475 35-39 22.900000000000002 28.49 27.505000000000003 21.105 40-44 23.064999999999998 27.79 27.88 21.265 45-49 22.915 27.615000000000002 28.08 21.39 50-54 23.075000000000003 27.915 28.025 20.985 55-59 23.46 27.944999999999997 27.134999999999998 21.46 60-64 23.1 27.85 27.68 21.37 65-69 23.355 27.965 27.555000000000003 21.125 70-74 23.535 27.63 27.67 21.165 75-79 22.85 27.584999999999997 27.785 21.78 80-84 23.985 28.075 27.07 20.87 85-89 23.97 28.015 27.400000000000002 20.615 90-94 23.794999999999998 27.46 27.860000000000003 20.885 95-99 23.32 28.310000000000002 27.02 21.349999999999998 100-104 23.875 28.57 26.995 20.560000000000002 105-109 24.22 27.99 27.3 20.49 110-114 23.785 28.634999999999998 26.834999999999997 20.745 115-119 24.035 28.115000000000002 27.615000000000002 20.235 120-124 23.97 27.615000000000002 27.555000000000003 20.86 125-129 24.365000000000002 28.095 27.42 20.119999999999997 130-134 25.174999999999997 28.139999999999997 26.369999999999997 20.315 135-139 24.805 28.57 26.25 20.375 140-144 25.240000000000002 28.115000000000002 26.884999999999998 19.759999999999998 145-149 25.735000000000003 28.035 26.56 19.67 150-151 26.025 28.787499999999998 25.324999999999996 19.8625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 1.0 9 1.0 10 1.0 11 1.0 12 0.5 13 0.5 14 0.0 15 0.5 16 1.0 17 1.5 18 1.5 19 0.5 20 0.5 21 0.5 22 0.5 23 1.5 24 3.0 25 3.5 26 5.0 27 5.5 28 7.0 29 10.5 30 17.0 31 22.0 32 24.5 33 35.0 34 47.0 35 71.5 36 86.0 37 95.5 38 115.5 39 158.0 40 199.0 41 223.0 42 254.0 43 273.0 44 277.5 45 272.5 46 282.0 47 261.0 48 219.0 49 191.0 50 157.0 51 129.5 52 108.5 53 89.5 54 77.5 55 65.5 56 46.5 57 31.0 58 24.0 59 20.5 60 15.5 61 11.5 62 11.0 63 8.5 64 4.0 65 1.5 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.5 72 1.5 73 1.0 74 0.0 75 1.0 76 1.0 77 0.5 78 1.5 79 1.0 80 0.0 81 0.5 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 1.0 94 1.0 95 0.0 96 0.0 97 0.5 98 1.0 99 0.5 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.525 #Duplication Level Percentage of deduplicated Percentage of total 1 92.29718656104889 84.475 2 6.610215788036056 12.1 3 0.8467631794591642 2.325 4 0.2185195301830101 0.8 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027314941272876262 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 12 0.3 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.07500000000000001 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.3 0.0 0.0 0.0 0.0 108-109 1.4875 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.7875 0.0 0.0 0.0 0.0 114-115 1.9874999999999998 0.0 0.0 0.0 0.0 116-117 2.2249999999999996 0.0 0.0 0.0 0.0 118-119 2.5250000000000004 0.0 0.0 0.0 0.0 120-121 2.8499999999999996 0.0 0.025 0.0 0.0 122-123 3.125 0.0 0.025 0.0 0.0 124-125 3.4 0.0 0.025 0.0 0.0 126-127 4.1375 0.0 0.025 0.0 0.0 128-129 4.525 0.0 0.025 0.0 0.0 130-131 4.975 0.0 0.025 0.0 0.0 132-133 5.550000000000001 0.0 0.025 0.0 0.0 134-135 6.0125 0.0 0.025 0.0 0.0 136-137 6.4625 0.0 0.025 0.0 0.0 138-139 6.9625 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAAGT 10 0.006830828 145.0 3 TTTTTTT 35 0.0035366106 20.714287 115-119 >>END_MODULE Read 707617 spots for SRR12690119.sra Written 707617 spots for SRR12690119.sra Read 707617 spots for SRR12690119.sra Written 707617 spots for SRR12690119.sra Read 707617 spots for SRR12690119.sra Written 707617 spots for SRR12690119.sra Read 707617 spots for SRR12690119.sra Written 707617 spots for SRR12690119.sra Read 707617 spots for SRR12690119.sra Written 707617 spots for SRR12690119.sra Read 707617 spots for SRR12690119.sra Written 707617 spots for SRR12690119.sra Read 707617 spots for SRR12690119.sra Written 707617 spots for SRR12690119.sra Read 707617 spots for SRR12690119.sra Written 707617 spots for SRR12690119.sra Read 707617 spots for SRR12690119.sra Written 707617 spots for SRR12690119.sra Read 707617 spots for SRR12690119.sra Written 707617 spots for SRR12690119.sra Read 707617 spots for SRR12690119.sra Written 707617 spots for SRR12690119.sra Read 707617 spots for SRR12690119.sra Written 707617 spots for SRR12690119.sra Read 707617 spots for SRR12690119.sra Written 707617 spots for SRR12690119.sra Read 707617 spots for SRR12690119.sra Written 707617 spots for SRR12690119.sra Read 707617 spots for SRR12690119.sra Written 707617 spots for SRR12690119.sra Read 707617 spots for SRR12690119.sra Written 707617 spots for SRR12690119.sra Read 707617 spots for SRR12690119.sra Written 707617 spots for SRR12690119.sra Read 707622 spots for SRR12690119.sra Written 707622 spots for SRR12690119.sra Read 707617 spots for SRR12690119.sra Written 707617 spots for SRR12690119.sra Read 707617 spots for SRR12690119.sra Written 707617 spots for SRR12690119.sra SRR ids: ['SRR12690119.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ktet827z SRR12690119.sra spots: 14152345 blocks: [[1, 707617], [707618, 1415234], [1415235, 2122851], [2122852, 2830468], [2830469, 3538085], [3538086, 4245702], [4245703, 4953319], [4953320, 5660936], [5660937, 6368553], [6368554, 7076170], [7076171, 7783787], [7783788, 8491404], [8491405, 9199021], [9199022, 9906638], [9906639, 10614255], [10614256, 11321872], [11321873, 12029489], [12029490, 12737106], [12737107, 13444723], [13444724, 14152345]] SRR12690119 file size 4787885 SRR12690119 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690119 SRR12690119_1.fastq SRR12690119_2.fastq Input file: SRR12690119_1.fastq Paired file: SRR12690119_2.fastq trimmed: SRR12690119-trimmed-pair1.fastq, SRR12690119-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:16:40 2025 >> started Mon Feb 10 16:16:57 2025 >> done (16.315s) 14152345 read pairs processed; of these: 15 ( 0.00%) short read pairs filtered out after trimming by size control 2603 ( 0.02%) empty read pairs filtered out after trimming by size control 14149727 (99.98%) read pairs available; of these: 1585136 (11.20%) trimmed read pairs available after processing 12564591 (88.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 6 0.00% 21 4 0.00% 22 7 0.00% 23 1 0.00% 24 6 0.00% 25 7 0.00% 26 10 0.00% 27 8 0.00% 28 7 0.00% 29 13 0.00% 30 14 0.00% 31 14 0.00% 32 7 0.00% 33 15 0.00% 34 15 0.00% 35 16 0.00% 36 27 0.00% 37 22 0.00% 38 19 0.00% 39 27 0.00% 40 33 0.00% 41 28 0.00% 42 25 0.00% 43 22 0.00% 44 22 0.00% 45 36 0.00% 46 46 0.00% 47 25 0.00% 48 38 0.00% 49 51 0.00% 50 78 0.00% 51 68 0.00% 52 64 0.00% 53 71 0.00% 54 85 0.00% 55 110 0.00% 56 105 0.00% 57 125 0.00% 58 130 0.00% 59 165 0.00% 60 174 0.00% 61 221 0.00% 62 232 0.00% 63 346 0.00% 64 352 0.00% 65 343 0.00% 66 388 0.00% 67 444 0.00% 68 520 0.00% 69 609 0.00% 70 628 0.00% 71 776 0.01% 72 886 0.01% 73 1022 0.01% 74 1102 0.01% 75 1165 0.01% 76 1335 0.01% 77 1470 0.01% 78 1587 0.01% 79 1879 0.01% 80 2085 0.01% 81 2279 0.02% 82 2616 0.02% 83 2869 0.02% 84 3230 0.02% 85 3507 0.02% 86 3911 0.03% 87 4201 0.03% 88 4484 0.03% 89 4912 0.03% 90 5303 0.04% 91 5785 0.04% 92 6060 0.04% 93 6615 0.05% 94 7453 0.05% 95 7780 0.05% 96 8404 0.06% 97 8983 0.06% 98 9567 0.07% 99 10086 0.07% 100 10391 0.07% 101 11066 0.08% 102 11465 0.08% 103 12358 0.09% 104 12709 0.09% 105 13326 0.09% 106 14368 0.10% 107 14634 0.10% 108 15566 0.11% 109 16337 0.12% 110 16750 0.12% 111 17670 0.12% 112 18209 0.13% 113 18723 0.13% 114 19478 0.14% 115 20395 0.14% 116 20992 0.15% 117 22241 0.16% 118 23156 0.16% 119 23713 0.17% 120 24525 0.17% 121 25175 0.18% 122 26017 0.18% 123 26679 0.19% 124 27570 0.19% 125 27790 0.20% 126 29040 0.21% 127 29909 0.21% 128 30955 0.22% 129 31347 0.22% 130 32541 0.23% 131 33097 0.23% 132 34222 0.24% 133 35065 0.25% 134 35273 0.25% 135 36260 0.26% 136 37047 0.26% 137 37834 0.27% 138 38066 0.27% 139 39800 0.28% 140 40338 0.29% 141 41043 0.29% 142 42404 0.30% 143 43314 0.31% 144 43800 0.31% 145 44342 0.31% 146 44703 0.32% 147 44925 0.32% 148 46197 0.33% 149 47124 0.33% 150 48001 0.34% 151 12564591 88.80% 14149727 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=22 prefix-density=0.51 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=21 fanout-score=10.27 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=5.6 sequence=CCATCCACATTAGCACCATATTTGTCGACATATTGGTACAC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=23 prefix-density=0.66 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.14 sequence-density-rank=26 fanout-score=25.13 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=5.4 sequence=AATGGCAGCCTCAGTTATGGCTTCACTGAACCTGAAACCATCTCCATTCACGGTTGAGAAGTCTTCAGTGAGAGGCCTCCCAACTCTTTCAAGGAGATCTTTCAAGATT SRR12690119 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:17:45 Started mapping on | Feb 10 16:17:46 Finished on | Feb 10 16:19:23 Mapping speed, Million of reads per hour | 525.14 Number of input reads | 14149727 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13386768 Uniquely mapped reads % | 94.61% Average mapped length | 295.67 Number of splices: Total | 13839181 Number of splices: Annotated (sjdb) | 13553959 Number of splices: GT/AG | 13557311 Number of splices: GC/AG | 231662 Number of splices: AT/AC | 8476 Number of splices: Non-canonical | 41732 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 296001 % of reads mapped to multiple loci | 2.09% Number of reads mapped to too many loci | 77973 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.60% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 466958 466958 466958 N_multimapping 296001 296001 296001 N_noFeature 464466 13223627 512759 N_ambiguous 198094 865 82739 UnstrandedReadsAssigned:12724208 PositiveStrandReadsAssigned:162276 NegativeStrandReadsAssigned:12791270 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690119 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690119-trimmed-pair1.fastq SRR12690119-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,149,727 reads, 12,876,094 reads pseudoaligned [quant] estimated average fragment length: 249.925 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,014 rounds 52401 SRR12690119.ke.tsv 34699 SRR12690119.se.tsv 87100 total ==> SRR12690119.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.08 500 20.5931 Potri.005G024800.1.v4.1 1035 786.075 266 24.6557 Potri.004G059700.1.v4.1 961 712.238 20 2.04599 Potri.007G009000.2.v4.1 1416 1167.08 0 0 Potri.003G141000.2.v4.1 2943 2694.08 598 16.173 Potri.016G087400.1.v4.1 270 84.0562 552 478.485 Potri.015G069301.1.v4.1 564 328.434 0 0 Potri.010G195200.1.v4.1 1773 1524.08 19 0.908335 Potri.012G127500.1.v4.1 977 728.164 465 46.5289 ==> SRR12690119.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 105 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 248 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 13 SRR12690119 completed mapping pipeline successfully