Starting /dee2/code/volunteer_pipeline.sh SRR12690120 current disk space = 3058502586368 free memory = 1104895120 SRR12690120 SRAfilesize acd0a024b27d3242f6a4a4c1b33abf3b SRR12690120.sra SRR12690120.sra file validated SRR12690120 is paired end SRR12690120 is conventional basespace SRR12690120 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690120_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6615 37.0 37.0 37.0 37.0 37.0 2 36.496 37.0 37.0 37.0 37.0 37.0 3 36.723 37.0 37.0 37.0 37.0 37.0 4 36.6235 37.0 37.0 37.0 37.0 37.0 5 36.6645 37.0 37.0 37.0 37.0 37.0 6 36.7005 37.0 37.0 37.0 37.0 37.0 7 36.5645 37.0 37.0 37.0 37.0 37.0 8 36.554 37.0 37.0 37.0 37.0 37.0 9 36.599 37.0 37.0 37.0 37.0 37.0 10-14 36.63549999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.639799999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.594500000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.587199999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.5148 37.0 37.0 37.0 37.0 37.0 35-39 36.497 37.0 37.0 37.0 37.0 37.0 40-44 36.498400000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.44799999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.42569999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.376999999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.3779 37.0 37.0 37.0 37.0 37.0 65-69 36.3498 37.0 37.0 37.0 37.0 37.0 70-74 36.3488 37.0 37.0 37.0 37.0 37.0 75-79 36.3869 37.0 37.0 37.0 37.0 37.0 80-84 36.283300000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.3323 37.0 37.0 37.0 37.0 37.0 90-94 36.243700000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.3136 37.0 37.0 37.0 37.0 37.0 100-104 36.2647 37.0 37.0 37.0 37.0 37.0 105-109 36.221599999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.18330000000001 37.0 37.0 37.0 37.0 37.0 115-119 36.1374 37.0 37.0 37.0 37.0 37.0 120-124 36.110200000000006 37.0 37.0 37.0 37.0 37.0 125-129 36.110400000000006 37.0 37.0 37.0 37.0 37.0 130-134 36.0344 37.0 37.0 37.0 37.0 37.0 135-139 36.027499999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.844800000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.8671 37.0 37.0 37.0 37.0 37.0 150-151 35.644000000000005 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 0.0 25 5.0 26 7.0 27 7.0 28 10.0 29 11.0 30 25.0 31 27.0 32 47.0 33 67.0 34 104.0 35 269.0 36 3005.0 37 414.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.25 13.425 7.3 38.025 2 20.195195195195197 12.287287287287288 35.685685685685684 31.83183183183183 3 16.75 16.275000000000002 28.175 38.800000000000004 4 20.5 23.575 24.975 30.95 5 23.775 28.1 24.875 23.25 6 21.775 32.175 23.35 22.7 7 17.0 28.475 37.45 17.075000000000003 8 18.375 26.825 30.85 23.95 9 17.599999999999998 24.224999999999998 34.849999999999994 23.325000000000003 10-14 19.56 28.955 28.155 23.330000000000002 15-19 20.115 27.060000000000002 27.54 25.285000000000004 20-24 20.5 27.305 28.24 23.955000000000002 25-29 20.11 27.68 28.13 24.08 30-34 20.035 27.73 27.500000000000004 24.735 35-39 20.44 28.189999999999998 27.315 24.055 40-44 20.78 27.975 27.41 23.835 45-49 21.075 28.194999999999997 26.640000000000004 24.09 50-54 20.599999999999998 27.525 27.465 24.41 55-59 20.31 27.474999999999998 27.63 24.585 60-64 20.41 27.474999999999998 27.79 24.325 65-69 20.79 27.33 27.785 24.095 70-74 20.64 28.050000000000004 27.215 24.095 75-79 21.22 26.69 27.22 24.87 80-84 20.735 28.28 27.505000000000003 23.48 85-89 21.834999999999997 26.845000000000002 27.175 24.145 90-94 20.89 27.83 27.045 24.235 95-99 21.584999999999997 26.77 27.284999999999997 24.36 100-104 21.54 27.485 27.18 23.794999999999998 105-109 21.63 27.005000000000003 27.029999999999998 24.335 110-114 21.145 27.165 27.525 24.165 115-119 21.615000000000002 27.500000000000004 26.900000000000002 23.985 120-124 20.925 27.229999999999997 27.384999999999998 24.46 125-129 21.83 26.775 27.065 24.33 130-134 21.6 27.29 27.155 23.955000000000002 135-139 22.105 27.405 26.56 23.93 140-144 21.84 27.775 26.8 23.585 145-149 22.28 27.625 26.419999999999998 23.674999999999997 150-151 22.525000000000002 26.787499999999998 25.9875 24.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 2.5 27 4.5 28 5.5 29 8.0 30 14.0 31 19.0 32 24.5 33 33.5 34 42.5 35 52.0 36 64.0 37 88.0 38 120.0 39 152.0 40 168.0 41 179.0 42 207.0 43 220.0 44 239.5 45 270.0 46 266.0 47 256.0 48 248.0 49 227.0 50 214.5 51 195.5 52 145.0 53 97.5 54 82.5 55 83.5 56 76.0 57 56.5 58 38.0 59 27.5 60 21.5 61 14.5 62 9.0 63 4.0 64 2.0 65 3.5 66 4.5 67 3.0 68 1.5 69 2.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.21454144863674 82.8 2 7.738914899476729 14.05 3 0.7986780501239329 2.175 4 0.16524373450839988 0.6 5 0.08262186725419994 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATAGCGGTATCTCGTAT 5 0.125 TruSeq Adapter, Index 3 (97% over 37bp) GTCCTTTCAACCCACTGCAGCAAGCTGCAGGCACAGCCCCACCCTTCTGG 5 0.125 No Hit GCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5375 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.1375 0.0 0.0 0.0 0.0 100-101 1.35 0.0 0.0 0.0 0.0 102-103 1.5375 0.0 0.0 0.0 0.0 104-105 1.625 0.0 0.0 0.0 0.0 106-107 1.8625 0.0 0.0 0.0 0.0 108-109 2.1125 0.0 0.0 0.0 0.0 110-111 2.2625 0.0 0.0 0.0 0.0 112-113 2.55 0.0 0.0 0.0 0.0 114-115 2.825 0.0 0.0 0.0 0.0 116-117 3.2 0.0 0.0 0.0 0.0 118-119 3.6 0.0 0.0 0.0 0.0 120-121 3.9875 0.0 0.0 0.0 0.0 122-123 4.525 0.0 0.0 0.0 0.0 124-125 5.025 0.0 0.0 0.0 0.0 126-127 5.675 0.0 0.0 0.0 0.0 128-129 6.175 0.0 0.0 0.0 0.0 130-131 6.675000000000001 0.0 0.0 0.0 0.0 132-133 7.2875 0.0 0.0 0.0 0.0 134-135 7.8999999999999995 0.0 0.0 0.0 0.0 136-137 8.524999999999999 0.0 0.0 0.0 0.0 138-139 9.274999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCAGTA 10 0.006830828 145.0 145 CATATAA 10 0.006830828 145.0 5 ATTTAAG 10 0.006830828 145.0 6 >>END_MODULE SRR12690120 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690120_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.291 37.0 37.0 37.0 37.0 37.0 2 36.135 37.0 37.0 37.0 37.0 37.0 3 36.096 37.0 37.0 37.0 37.0 37.0 4 36.156 37.0 37.0 37.0 37.0 37.0 5 36.315 37.0 37.0 37.0 37.0 37.0 6 36.1375 37.0 37.0 37.0 37.0 37.0 7 36.157 37.0 37.0 37.0 37.0 37.0 8 36.235 37.0 37.0 37.0 37.0 37.0 9 36.32 37.0 37.0 37.0 37.0 37.0 10-14 36.1987 37.0 37.0 37.0 37.0 37.0 15-19 36.1917 37.0 37.0 37.0 37.0 37.0 20-24 36.20120000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.1547 37.0 37.0 37.0 37.0 37.0 30-34 36.0543 37.0 37.0 37.0 37.0 37.0 35-39 36.060700000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.0019 37.0 37.0 37.0 37.0 37.0 45-49 36.015899999999995 37.0 37.0 37.0 37.0 37.0 50-54 35.986000000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.0199 37.0 37.0 37.0 37.0 37.0 60-64 35.912400000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.9208 37.0 37.0 37.0 37.0 37.0 70-74 35.8643 37.0 37.0 37.0 37.0 37.0 75-79 35.831 37.0 37.0 37.0 37.0 37.0 80-84 35.8554 37.0 37.0 37.0 37.0 37.0 85-89 35.8263 37.0 37.0 37.0 37.0 37.0 90-94 35.8101 37.0 37.0 37.0 37.0 37.0 95-99 35.8526 37.0 37.0 37.0 37.0 37.0 100-104 35.872 37.0 37.0 37.0 37.0 37.0 105-109 35.80159999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.7238 37.0 37.0 37.0 37.0 37.0 115-119 35.649 37.0 37.0 37.0 37.0 37.0 120-124 35.628699999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.540000000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.4336 37.0 37.0 37.0 37.0 37.0 135-139 35.4005 37.0 37.0 37.0 37.0 37.0 140-144 35.2986 37.0 37.0 37.0 34.6 37.0 145-149 35.1368 37.0 37.0 37.0 29.8 37.0 150-151 34.5755 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 5.0 13 6.0 14 2.0 15 1.0 16 4.0 17 0.0 18 3.0 19 2.0 20 5.0 21 1.0 22 4.0 23 7.0 24 6.0 25 11.0 26 14.0 27 11.0 28 12.0 29 26.0 30 21.0 31 21.0 32 65.0 33 96.0 34 139.0 35 545.0 36 2780.0 37 213.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.3 24.75 10.65 26.3 2 28.4 29.425 26.525 15.65 3 21.575 30.349999999999998 29.299999999999997 18.775 4 23.674999999999997 34.675 22.15 19.5 5 26.35 35.55 21.625 16.475 6 22.025 38.425 21.525 18.025 7 21.625 23.849999999999998 35.375 19.15 8 23.325000000000003 25.55 26.375 24.75 9 23.375 24.025 29.425 23.175 10-14 24.395 29.445 25.130000000000003 21.029999999999998 15-19 24.365000000000002 28.23 26.35 21.055 20-24 23.419999999999998 28.24 26.735 21.605 25-29 24.355 27.82 26.77 21.055 30-34 23.985 28.065 26.395000000000003 21.555 35-39 24.065 27.685 27.305 20.945 40-44 23.75 28.725 26.815 20.71 45-49 23.885 28.13 26.685 21.3 50-54 23.585 28.46 26.41 21.545 55-59 24.585 27.825 26.795 20.794999999999998 60-64 24.005000000000003 28.125 26.174999999999997 21.695 65-69 24.355 27.715 26.5 21.43 70-74 24.265 28.299999999999997 26.075 21.36 75-79 24.145 27.525 27.125 21.205 80-84 24.445 27.93 26.619999999999997 21.005 85-89 24.365000000000002 27.529999999999998 26.905 21.2 90-94 24.12 27.634999999999998 26.63 21.615000000000002 95-99 24.605 28.544999999999998 26.505000000000003 20.345 100-104 24.965 28.349999999999998 26.224999999999998 20.46 105-109 24.085 28.535 26.33 21.05 110-114 24.955 27.935 26.645000000000003 20.465 115-119 25.009999999999998 28.625 25.845000000000002 20.52 120-124 25.295 28.365000000000002 26.325 20.015 125-129 26.05 28.105000000000004 25.91 19.935 130-134 25.86 27.82 26.224999999999998 20.095 135-139 25.869999999999997 27.51 26.115 20.505000000000003 140-144 26.534999999999997 27.625 26.525 19.314999999999998 145-149 27.675 27.915 25.3 19.11 150-151 27.0625 28.012500000000003 25.587500000000002 19.3375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 2.0 6 2.5 7 1.0 8 0.5 9 0.0 10 1.5 11 1.5 12 0.0 13 1.0 14 1.0 15 1.5 16 1.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 2.0 24 2.5 25 2.0 26 2.5 27 2.5 28 2.5 29 3.5 30 6.0 31 9.5 32 12.0 33 13.5 34 25.5 35 41.0 36 51.0 37 80.0 38 119.5 39 147.0 40 184.0 41 218.5 42 225.0 43 259.5 44 280.0 45 272.0 46 275.5 47 264.5 48 252.0 49 242.0 50 204.5 51 163.0 52 130.5 53 101.0 54 80.0 55 63.5 56 59.5 57 44.5 58 28.0 59 22.0 60 19.0 61 16.5 62 11.5 63 5.5 64 3.0 65 1.5 66 0.5 67 2.5 68 3.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 1.0 77 1.5 78 0.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.5 85 1.0 86 1.0 87 1.0 88 0.5 89 0.5 90 0.5 91 0.0 92 0.5 93 1.5 94 1.5 95 1.0 96 1.5 97 1.0 98 0.0 99 0.0 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.675 #Duplication Level Percentage of deduplicated Percentage of total 1 91.53570443893024 83.0 2 7.2511717673008 13.15 3 0.8271298593879239 2.25 4 0.30328094844223874 1.0999999999999999 5 0.027570995312930797 0.125 6 0.027570995312930797 0.15 7 0.0 0.0 8 0.0 0.0 9 0.027570995312930797 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit GGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5375 0.0 0.0 0.0 0.0 90-91 0.65 0.0 0.0 0.0 0.0 92-93 0.725 0.0 0.0 0.0 0.0 94-95 0.8374999999999999 0.0 0.0 0.0 0.0 96-97 0.975 0.0 0.0 0.0 0.0 98-99 1.1625 0.0 0.0 0.0 0.0 100-101 1.375 0.0 0.0 0.0 0.0 102-103 1.5625 0.0 0.0 0.0 0.0 104-105 1.65 0.0 0.0 0.0 0.0 106-107 1.8875 0.0 0.0 0.0 0.0 108-109 2.1375 0.0 0.0 0.0 0.0 110-111 2.2875 0.0 0.0 0.0 0.0 112-113 2.5999999999999996 0.0 0.0 0.0 0.0 114-115 2.8875 0.0 0.0 0.0 0.0 116-117 3.25 0.0 0.0 0.0 0.0 118-119 3.65 0.0 0.0 0.0 0.0 120-121 4.0375 0.0 0.0 0.0 0.0 122-123 4.574999999999999 0.0 0.0 0.0 0.0 124-125 5.074999999999999 0.0 0.0 0.0 0.0 126-127 5.7125 0.0 0.0 0.0 0.0 128-129 6.2 0.0 0.0 0.0 0.0 130-131 6.699999999999999 0.0 0.0 0.0 0.0 132-133 7.324999999999999 0.0 0.0 0.0 0.0 134-135 7.9375 0.0 0.0 0.0 0.0 136-137 8.524999999999999 0.0 0.0 0.0 0.0 138-139 9.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 704806 spots for SRR12690120.sra Written 704806 spots for SRR12690120.sra Read 704806 spots for SRR12690120.sra Written 704806 spots for SRR12690120.sra Read 704806 spots for SRR12690120.sra Written 704806 spots for SRR12690120.sra Read 704806 spots for SRR12690120.sra Written 704806 spots for SRR12690120.sra Read 704806 spots for SRR12690120.sra Written 704806 spots for SRR12690120.sra Read 704806 spots for SRR12690120.sra Written 704806 spots for SRR12690120.sra Read 704806 spots for SRR12690120.sra Written 704806 spots for SRR12690120.sra Read 704806 spots for SRR12690120.sra Written 704806 spots for SRR12690120.sra Read 704806 spots for SRR12690120.sra Written 704806 spots for SRR12690120.sra Read 704806 spots for SRR12690120.sra Written 704806 spots for SRR12690120.sra Read 704806 spots for SRR12690120.sra Written 704806 spots for SRR12690120.sra Read 704806 spots for SRR12690120.sra Written 704806 spots for SRR12690120.sra Read 704824 spots for SRR12690120.sra Written 704824 spots for SRR12690120.sra Read 704806 spots for SRR12690120.sra Written 704806 spots for SRR12690120.sra Read 704806 spots for SRR12690120.sra Written 704806 spots for SRR12690120.sra Read 704806 spots for SRR12690120.sra Written 704806 spots for SRR12690120.sra Read 704806 spots for SRR12690120.sra Written 704806 spots for SRR12690120.sra Read 704806 spots for SRR12690120.sra Written 704806 spots for SRR12690120.sra Read 704806 spots for SRR12690120.sra Written 704806 spots for SRR12690120.sra Read 704806 spots for SRR12690120.sra Written 704806 spots for SRR12690120.sra SRR ids: ['SRR12690120.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jti7sz04 SRR12690120.sra spots: 14096138 blocks: [[1, 704806], [704807, 1409612], [1409613, 2114418], [2114419, 2819224], [2819225, 3524030], [3524031, 4228836], [4228837, 4933642], [4933643, 5638448], [5638449, 6343254], [6343255, 7048060], [7048061, 7752866], [7752867, 8457672], [8457673, 9162478], [9162479, 9867284], [9867285, 10572090], [10572091, 11276896], [11276897, 11981702], [11981703, 12686508], [12686509, 13391314], [13391315, 14096138]] SRR12690120 file size 4768784 SRR12690120 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690120 SRR12690120_1.fastq SRR12690120_2.fastq Input file: SRR12690120_1.fastq Paired file: SRR12690120_2.fastq trimmed: SRR12690120-trimmed-pair1.fastq, SRR12690120-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:22:51 2025 >> started Mon Feb 10 16:23:06 2025 >> done (15.788s) 14096138 read pairs processed; of these: 42 ( 0.00%) short read pairs filtered out after trimming by size control 47712 ( 0.34%) empty read pairs filtered out after trimming by size control 14048384 (99.66%) read pairs available; of these: 2127604 (15.14%) trimmed read pairs available after processing 11920780 (84.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 4 0.00% 21 10 0.00% 22 13 0.00% 23 12 0.00% 24 25 0.00% 25 20 0.00% 26 27 0.00% 27 22 0.00% 28 32 0.00% 29 33 0.00% 30 41 0.00% 31 32 0.00% 32 31 0.00% 33 29 0.00% 34 40 0.00% 35 30 0.00% 36 31 0.00% 37 40 0.00% 38 39 0.00% 39 45 0.00% 40 42 0.00% 41 51 0.00% 42 56 0.00% 43 51 0.00% 44 57 0.00% 45 83 0.00% 46 81 0.00% 47 90 0.00% 48 83 0.00% 49 89 0.00% 50 98 0.00% 51 124 0.00% 52 133 0.00% 53 151 0.00% 54 200 0.00% 55 178 0.00% 56 210 0.00% 57 229 0.00% 58 246 0.00% 59 259 0.00% 60 315 0.00% 61 376 0.00% 62 471 0.00% 63 504 0.00% 64 485 0.00% 65 519 0.00% 66 566 0.00% 67 678 0.00% 68 721 0.01% 69 796 0.01% 70 959 0.01% 71 987 0.01% 72 1191 0.01% 73 1321 0.01% 74 1498 0.01% 75 1679 0.01% 76 1831 0.01% 77 2045 0.01% 78 2266 0.02% 79 2664 0.02% 80 2728 0.02% 81 3026 0.02% 82 3366 0.02% 83 3846 0.03% 84 4187 0.03% 85 4691 0.03% 86 4983 0.04% 87 5324 0.04% 88 5817 0.04% 89 6331 0.05% 90 7027 0.05% 91 7534 0.05% 92 7952 0.06% 93 8537 0.06% 94 9322 0.07% 95 10103 0.07% 96 10582 0.08% 97 11443 0.08% 98 11882 0.08% 99 12964 0.09% 100 13397 0.10% 101 13993 0.10% 102 14787 0.11% 103 15560 0.11% 104 16478 0.12% 105 17453 0.12% 106 18143 0.13% 107 19081 0.14% 108 19999 0.14% 109 20573 0.15% 110 21436 0.15% 111 22299 0.16% 112 23371 0.17% 113 24236 0.17% 114 25242 0.18% 115 26507 0.19% 116 27815 0.20% 117 28932 0.21% 118 29698 0.21% 119 30613 0.22% 120 31928 0.23% 121 33216 0.24% 122 34077 0.24% 123 35152 0.25% 124 36655 0.26% 125 37336 0.27% 126 38587 0.27% 127 40146 0.29% 128 40984 0.29% 129 42287 0.30% 130 42812 0.30% 131 44835 0.32% 132 45821 0.33% 133 47630 0.34% 134 48202 0.34% 135 49023 0.35% 136 50272 0.36% 137 51301 0.37% 138 52289 0.37% 139 54244 0.39% 140 54725 0.39% 141 56191 0.40% 142 58155 0.41% 143 58991 0.42% 144 61109 0.43% 145 61597 0.44% 146 62686 0.45% 147 63279 0.45% 148 64740 0.46% 149 65503 0.47% 150 67629 0.48% 151 11920780 84.86% 14048384 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=14 prefix-density=0.76 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.11 sequence-density-rank=24 fanout-score=12.44 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=3.8 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=18 prefix-density=0.81 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=37.10 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=5.3 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTAGAATAAAAGGGGTGCTCGAGCATGTTTGAGCT SRR12690120 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:23:51 Started mapping on | Feb 10 16:23:52 Finished on | Feb 10 16:25:28 Mapping speed, Million of reads per hour | 526.81 Number of input reads | 14048384 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13161453 Uniquely mapped reads % | 93.69% Average mapped length | 294.05 Number of splices: Total | 13574587 Number of splices: Annotated (sjdb) | 13321086 Number of splices: GT/AG | 13279166 Number of splices: GC/AG | 248595 Number of splices: AT/AC | 13709 Number of splices: Non-canonical | 33117 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 350995 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 126719 % of reads mapped to too many loci | 0.90% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.69% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 535936 535936 535936 N_multimapping 350995 350995 350995 N_noFeature 315091 12978379 362583 N_ambiguous 215707 720 79639 UnstrandedReadsAssigned:12630655 PositiveStrandReadsAssigned:182354 NegativeStrandReadsAssigned:12719231 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690120 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690120-trimmed-pair1.fastq SRR12690120-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,048,384 reads, 12,900,638 reads pseudoaligned [quant] estimated average fragment length: 213.823 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52401 SRR12690120.ke.tsv 34699 SRR12690120.se.tsv 87100 total ==> SRR12690120.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.18 284 9.23794 Potri.005G024800.1.v4.1 1035 822.177 150 10.7128 Potri.004G059700.1.v4.1 961 748.177 25 1.96206 Potri.007G009000.2.v4.1 1416 1203.18 0 0 Potri.003G141000.2.v4.1 2943 2730.18 416.377 8.95514 Potri.016G087400.1.v4.1 270 86.7632 1184 801.295 Potri.015G069301.1.v4.1 564 352.482 0 0 Potri.010G195200.1.v4.1 1773 1560.18 3.66406 0.1379 Potri.012G127500.1.v4.1 977 764.177 225 17.2888 ==> SRR12690120.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 264 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 263 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 4 SRR12690120 completed mapping pipeline successfully