Starting /dee2/code/volunteer_pipeline.sh SRR12690121 current disk space = 3058663374848 free memory = 1053708148 SRR12690121 SRAfilesize da9f75aab12be330578b0bf19c446514 SRR12690121.sra SRR12690121.sra file validated SRR12690121 is paired end SRR12690121 is conventional basespace SRR12690121 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690121_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.634 37.0 37.0 37.0 37.0 37.0 2 36.43525 37.0 37.0 37.0 37.0 37.0 3 36.6345 37.0 37.0 37.0 37.0 37.0 4 36.649 37.0 37.0 37.0 37.0 37.0 5 36.675 37.0 37.0 37.0 37.0 37.0 6 36.639 37.0 37.0 37.0 37.0 37.0 7 36.5295 37.0 37.0 37.0 37.0 37.0 8 36.6195 37.0 37.0 37.0 37.0 37.0 9 36.6255 37.0 37.0 37.0 37.0 37.0 10-14 36.617599999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.620900000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.5829 37.0 37.0 37.0 37.0 37.0 25-29 36.534 37.0 37.0 37.0 37.0 37.0 30-34 36.4912 37.0 37.0 37.0 37.0 37.0 35-39 36.496500000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.504200000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.4433 37.0 37.0 37.0 37.0 37.0 50-54 36.390499999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.394600000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.388099999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.3047 37.0 37.0 37.0 37.0 37.0 70-74 36.3425 37.0 37.0 37.0 37.0 37.0 75-79 36.339999999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.3119 37.0 37.0 37.0 37.0 37.0 85-89 36.2839 37.0 37.0 37.0 37.0 37.0 90-94 36.2733 37.0 37.0 37.0 37.0 37.0 95-99 36.2595 37.0 37.0 37.0 37.0 37.0 100-104 36.1832 37.0 37.0 37.0 37.0 37.0 105-109 36.14190000000001 37.0 37.0 37.0 37.0 37.0 110-114 36.1336 37.0 37.0 37.0 37.0 37.0 115-119 36.1355 37.0 37.0 37.0 37.0 37.0 120-124 36.0766 37.0 37.0 37.0 37.0 37.0 125-129 36.0535 37.0 37.0 37.0 37.0 37.0 130-134 36.0119 37.0 37.0 37.0 37.0 37.0 135-139 36.0056 37.0 37.0 37.0 37.0 37.0 140-144 35.768 37.0 37.0 37.0 37.0 37.0 145-149 35.7858 37.0 37.0 37.0 37.0 37.0 150-151 35.6095 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 0.0 24 1.0 25 1.0 26 7.0 27 7.0 28 14.0 29 12.0 30 21.0 31 29.0 32 61.0 33 81.0 34 105.0 35 258.0 36 3013.0 37 388.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.85 12.8 7.675 37.675 2 22.22222222222222 12.440431402056685 33.00727363932781 32.33007273639328 3 16.2 16.475 28.799999999999997 38.525 4 22.6 20.65 25.75 31.0 5 23.724999999999998 28.375 23.849999999999998 24.05 6 21.8 32.225 23.974999999999998 22.0 7 16.875 27.1 38.324999999999996 17.7 8 17.275 26.025 32.625 24.075 9 19.775000000000002 23.9 33.050000000000004 23.275000000000002 10-14 20.055 28.33 27.905 23.71 15-19 19.755 26.765 28.58 24.9 20-24 20.555 27.675 27.205000000000002 24.565 25-29 20.31 27.115000000000002 28.15 24.425 30-34 21.005 27.63 27.29 24.075 35-39 21.029999999999998 27.68 27.134999999999998 24.154999999999998 40-44 20.335 27.800000000000004 27.505000000000003 24.36 45-49 21.22 27.42 27.145000000000003 24.215 50-54 20.69 27.139999999999997 27.400000000000002 24.77 55-59 20.84 27.88 27.3 23.98 60-64 20.715 27.445000000000004 27.165 24.675 65-69 20.7 27.384999999999998 27.534999999999997 24.38 70-74 20.745 27.975 27.165 24.115000000000002 75-79 20.815 26.895000000000003 27.67 24.62 80-84 21.154999999999998 27.089999999999996 27.71 24.044999999999998 85-89 20.885 27.229999999999997 27.62 24.265 90-94 20.89 27.250000000000004 27.565 24.295 95-99 21.94 26.700000000000003 27.85 23.51 100-104 21.51 27.265 27.255000000000003 23.97 105-109 21.33 26.865 27.215 24.59 110-114 21.345 27.12 27.084999999999997 24.45 115-119 22.05 27.265 26.715 23.97 120-124 21.51 27.589999999999996 27.265 23.635 125-129 22.09 26.615 26.96 24.335 130-134 21.955 27.284999999999997 26.685 24.075 135-139 22.1 27.500000000000004 26.400000000000002 24.0 140-144 21.584999999999997 27.01 27.265 24.14 145-149 21.695 26.82 26.284999999999997 25.2 150-151 22.400000000000002 26.5125 26.6125 24.474999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.5 26 2.5 27 2.5 28 3.5 29 6.0 30 10.5 31 13.5 32 14.5 33 21.0 34 35.5 35 56.5 36 63.5 37 73.0 38 108.0 39 140.5 40 153.5 41 175.5 42 214.5 43 240.0 44 233.0 45 249.5 46 293.5 47 287.5 48 268.0 49 259.0 50 208.5 51 163.0 52 141.0 53 126.5 54 111.0 55 78.5 56 66.5 57 54.0 58 32.5 59 23.5 60 17.5 61 12.5 62 8.5 63 6.0 64 5.5 65 3.0 66 2.0 67 2.5 68 1.5 69 0.5 70 1.0 71 0.5 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.95 #Duplication Level Percentage of deduplicated Percentage of total 1 90.80044469149527 81.675 2 7.64313507504169 13.750000000000002 3 1.2506948304613674 3.375 4 0.22234574763757642 0.8 5 0.055586436909394105 0.25 6 0.027793218454697052 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGC 6 0.15 No Hit CTTCAACCTGCCCTTTAAATAGTGTTGTAAGAGGCCTTCCACCAACACCA 5 0.125 No Hit GTTGTCAAATGTGGCCCTCAAATTTCCAGGGGAGAAAAGTTTCCCTTCAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.025 0.0 0.0 0.025 0.0 80-81 0.0875 0.0 0.0 0.025 0.0 82-83 0.1625 0.0 0.0 0.025 0.0 84-85 0.25 0.0 0.0 0.025 0.0 86-87 0.3125 0.0 0.0 0.025 0.0 88-89 0.38749999999999996 0.0 0.0 0.025 0.0 90-91 0.4625 0.0 0.0 0.025 0.0 92-93 0.5874999999999999 0.0 0.0 0.025 0.0 94-95 0.675 0.0 0.0 0.025 0.0 96-97 0.7875000000000001 0.0 0.0 0.025 0.0 98-99 0.8999999999999999 0.0 0.0 0.025 0.0 100-101 1.1875 0.0 0.0 0.025 0.0 102-103 1.4625 0.0 0.0 0.025 0.0 104-105 1.625 0.0 0.0 0.025 0.0 106-107 1.775 0.0 0.0 0.025 0.0 108-109 2.0375 0.0 0.0 0.025 0.0 110-111 2.2625 0.0 0.0 0.025 0.0 112-113 2.625 0.0 0.0 0.025 0.0 114-115 2.9749999999999996 0.0 0.0 0.025 0.0 116-117 3.3625 0.0 0.0 0.025 0.0 118-119 3.7375 0.0 0.0 0.025 0.0 120-121 4.2375 0.0 0.0 0.025 0.0 122-123 4.6625 0.0 0.0 0.025 0.0 124-125 5.1625 0.0 0.0 0.025 0.0 126-127 5.775 0.0 0.0 0.025 0.0 128-129 6.4 0.0 0.0 0.025 0.0 130-131 7.112500000000001 0.0 0.0 0.025 0.0 132-133 7.612500000000001 0.0 0.0 0.025 0.0 134-135 8.1875 0.0 0.0 0.025 0.0 136-137 8.7375 0.0 0.0 0.025 0.0 138-139 9.575 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTCTGA 45 0.008957279 48.333332 145 >>END_MODULE SRR12690121 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690121_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3545 37.0 37.0 37.0 37.0 37.0 2 35.9695 37.0 37.0 37.0 37.0 37.0 3 36.227 37.0 37.0 37.0 37.0 37.0 4 36.1825 37.0 37.0 37.0 37.0 37.0 5 36.296 37.0 37.0 37.0 37.0 37.0 6 36.176 37.0 37.0 37.0 37.0 37.0 7 36.2315 37.0 37.0 37.0 37.0 37.0 8 36.28 37.0 37.0 37.0 37.0 37.0 9 36.2175 37.0 37.0 37.0 37.0 37.0 10-14 36.1627 37.0 37.0 37.0 37.0 37.0 15-19 36.1927 37.0 37.0 37.0 37.0 37.0 20-24 36.196999999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.1714 37.0 37.0 37.0 37.0 37.0 30-34 36.148199999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.11319999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.0784 37.0 37.0 37.0 37.0 37.0 45-49 36.0833 37.0 37.0 37.0 37.0 37.0 50-54 36.0447 37.0 37.0 37.0 37.0 37.0 55-59 36.028800000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.954899999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.99210000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.9512 37.0 37.0 37.0 37.0 37.0 75-79 35.9127 37.0 37.0 37.0 37.0 37.0 80-84 35.8867 37.0 37.0 37.0 37.0 37.0 85-89 35.9387 37.0 37.0 37.0 37.0 37.0 90-94 35.78430000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.836 37.0 37.0 37.0 37.0 37.0 100-104 35.873599999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.864700000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.8223 37.0 37.0 37.0 37.0 37.0 115-119 35.71660000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.6025 37.0 37.0 37.0 37.0 37.0 125-129 35.585100000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.4655 37.0 37.0 37.0 37.0 37.0 135-139 35.311 37.0 37.0 37.0 34.6 37.0 140-144 35.26950000000001 37.0 37.0 37.0 37.0 37.0 145-149 34.9413 37.0 37.0 37.0 27.4 37.0 150-151 34.44725 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 5.0 15 2.0 16 2.0 17 6.0 18 0.0 19 5.0 20 0.0 21 4.0 22 6.0 23 9.0 24 4.0 25 6.0 26 7.0 27 12.0 28 14.0 29 22.0 30 24.0 31 35.0 32 57.0 33 92.0 34 170.0 35 517.0 36 2737.0 37 259.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.775 25.1 11.0 26.125 2 28.725 27.0 27.700000000000003 16.575 3 22.7 28.65 28.199999999999996 20.45 4 24.0 33.95 22.775000000000002 19.275000000000002 5 26.5 36.175000000000004 19.625 17.7 6 21.825 38.95 21.45 17.775 7 21.85 24.025 34.849999999999994 19.275000000000002 8 22.2 28.15 25.650000000000002 24.0 9 23.375 24.625 30.65 21.349999999999998 10-14 23.849999999999998 28.799999999999997 25.465 21.884999999999998 15-19 23.52 28.13 26.55 21.8 20-24 23.825 28.910000000000004 25.669999999999998 21.595 25-29 23.925 29.14 25.66 21.275 30-34 24.005000000000003 28.12 26.735 21.14 35-39 23.735 28.015 26.740000000000002 21.51 40-44 23.52 28.144999999999996 26.784999999999997 21.55 45-49 23.78 27.065 27.32 21.834999999999997 50-54 23.9 28.565 26.625 20.91 55-59 24.15 28.050000000000004 26.215 21.584999999999997 60-64 23.87 27.875 26.490000000000002 21.765 65-69 24.01 27.150000000000002 26.685 22.155 70-74 24.245 27.79 25.855 22.11 75-79 23.69 28.110000000000003 26.450000000000003 21.75 80-84 23.79 28.15 26.119999999999997 21.94 85-89 24.12 27.925 26.055 21.9 90-94 24.21 28.444999999999997 26.22 21.125 95-99 25.255 28.04 25.919999999999998 20.785 100-104 24.465 28.294999999999998 26.200000000000003 21.04 105-109 24.275 28.34 26.145000000000003 21.240000000000002 110-114 24.525 27.915 26.174999999999997 21.385 115-119 24.36 27.625 26.55 21.465 120-124 24.725 28.285 26.384999999999998 20.605 125-129 25.605 28.215 26.085 20.095 130-134 25.779999999999998 27.79 25.775 20.655 135-139 25.674999999999997 27.785 26.290000000000003 20.25 140-144 26.715 27.229999999999997 25.924999999999997 20.13 145-149 27.655 27.384999999999998 25.705 19.255 150-151 27.987499999999997 27.700000000000003 25.662499999999998 18.65 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 1.0 3 1.0 4 1.0 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 2.0 25 3.5 26 2.0 27 2.5 28 2.5 29 4.0 30 7.0 31 9.0 32 14.5 33 20.5 34 28.5 35 39.0 36 55.0 37 84.5 38 105.5 39 142.0 40 175.0 41 193.0 42 227.5 43 239.5 44 254.5 45 270.0 46 268.5 47 261.5 48 260.5 49 243.5 50 209.0 51 171.5 52 135.5 53 120.0 54 105.5 55 79.5 56 61.0 57 48.5 58 31.5 59 29.5 60 23.5 61 13.5 62 8.5 63 8.0 64 7.0 65 2.5 66 2.0 67 1.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.5 74 1.5 75 1.5 76 1.0 77 1.0 78 0.5 79 0.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 1.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.7 #Duplication Level Percentage of deduplicated Percentage of total 1 90.55183946488295 81.22500000000001 2 7.803790412486064 14.000000000000002 3 1.3656633221850614 3.675 4 0.19509476031215162 0.7000000000000001 5 0.055741360089186176 0.25 6 0.027870680044593088 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CCATCTTTGGAGTGTGGCCAGGAGAAAAATTAATTGGGGTAACGGGGAGA 5 0.125 No Hit ACATTGGTCTTGAACTTAGTGCAGCTTTAAGAATCAACAATATTGATGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1625 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.38749999999999996 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.7875000000000001 0.0 0.0 0.0 0.0 98-99 0.8999999999999999 0.0 0.0 0.0 0.0 100-101 1.1875 0.0 0.0 0.0 0.0 102-103 1.4625 0.0 0.0 0.0 0.0 104-105 1.625 0.0 0.0 0.0 0.0 106-107 1.775 0.0 0.0 0.0 0.0 108-109 2.05 0.0 0.0 0.0 0.0 110-111 2.3 0.0 0.0 0.0 0.0 112-113 2.6625 0.0 0.0 0.0 0.0 114-115 3.0 0.0 0.0 0.0 0.0 116-117 3.3875 0.0 0.0 0.0 0.0 118-119 3.75 0.0 0.0 0.0 0.0 120-121 4.2375 0.0 0.0 0.0 0.0 122-123 4.675 0.0 0.0 0.0 0.0 124-125 5.1875 0.0 0.0 0.0 0.0 126-127 5.800000000000001 0.0 0.0 0.0 0.0 128-129 6.425000000000001 0.0 0.0 0.0 0.0 130-131 7.137499999999999 0.0 0.0 0.0 0.0 132-133 7.625 0.0 0.0 0.0 0.0 134-135 8.1875 0.0 0.0 0.0 0.0 136-137 8.7375 0.0 0.0 0.0 0.0 138-139 9.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGGAAT 10 0.006830828 145.0 1 AGAGCGT 40 0.0076550315 18.125 135-139 >>END_MODULE Read 846622 spots for SRR12690121.sra Written 846622 spots for SRR12690121.sra Read 846622 spots for SRR12690121.sra Written 846622 spots for SRR12690121.sra Read 846622 spots for SRR12690121.sra Written 846622 spots for SRR12690121.sra Read 846622 spots for SRR12690121.sra Written 846622 spots for SRR12690121.sra Read 846622 spots for SRR12690121.sra Written 846622 spots for SRR12690121.sra Read 846622 spots for SRR12690121.sra Written 846622 spots for SRR12690121.sra Read 846622 spots for SRR12690121.sra Written 846622 spots for SRR12690121.sra Read 846622 spots for SRR12690121.sra Written 846622 spots for SRR12690121.sra Read 846622 spots for SRR12690121.sra Written 846622 spots for SRR12690121.sra Read 846622 spots for SRR12690121.sra Written 846622 spots for SRR12690121.sra Read 846622 spots for SRR12690121.sra Written 846622 spots for SRR12690121.sra Read 846622 spots for SRR12690121.sra Written 846622 spots for SRR12690121.sra Read 846622 spots for SRR12690121.sra Written 846622 spots for SRR12690121.sra Read 846622 spots for SRR12690121.sra Written 846622 spots for SRR12690121.sra Read 846622 spots for SRR12690121.sra Written 846622 spots for SRR12690121.sra Read 846622 spots for SRR12690121.sra Written 846622 spots for SRR12690121.sra Read 846637 spots for SRR12690121.sra Written 846637 spots for SRR12690121.sra Read 846622 spots for SRR12690121.sra Written 846622 spots for SRR12690121.sra Read 846622 spots for SRR12690121.sra Written 846622 spots for SRR12690121.sra Read 846622 spots for SRR12690121.sra Written 846622 spots for SRR12690121.sra SRR ids: ['SRR12690121.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zg3zp3pt SRR12690121.sra spots: 16932455 blocks: [[1, 846622], [846623, 1693244], [1693245, 2539866], [2539867, 3386488], [3386489, 4233110], [4233111, 5079732], [5079733, 5926354], [5926355, 6772976], [6772977, 7619598], [7619599, 8466220], [8466221, 9312842], [9312843, 10159464], [10159465, 11006086], [11006087, 11852708], [11852709, 12699330], [12699331, 13545952], [13545953, 14392574], [14392575, 15239196], [15239197, 16085818], [16085819, 16932455]] SRR12690121 file size 5732688 SRR12690121 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690121 SRR12690121_1.fastq SRR12690121_2.fastq Input file: SRR12690121_1.fastq Paired file: SRR12690121_2.fastq trimmed: SRR12690121-trimmed-pair1.fastq, SRR12690121-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:11:46 2025 >> started Mon Feb 10 16:12:12 2025 >> done (26.904s) 16932455 read pairs processed; of these: 23 ( 0.00%) short read pairs filtered out after trimming by size control 21652 ( 0.13%) empty read pairs filtered out after trimming by size control 16910780 (99.87%) read pairs available; of these: 2464957 (14.58%) trimmed read pairs available after processing 14445823 (85.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 6 0.00% 20 12 0.00% 21 7 0.00% 22 10 0.00% 23 22 0.00% 24 18 0.00% 25 13 0.00% 26 21 0.00% 27 41 0.00% 28 30 0.00% 29 28 0.00% 30 47 0.00% 31 32 0.00% 32 28 0.00% 33 35 0.00% 34 37 0.00% 35 32 0.00% 36 45 0.00% 37 45 0.00% 38 52 0.00% 39 45 0.00% 40 32 0.00% 41 55 0.00% 42 74 0.00% 43 58 0.00% 44 74 0.00% 45 90 0.00% 46 67 0.00% 47 71 0.00% 48 101 0.00% 49 108 0.00% 50 126 0.00% 51 123 0.00% 52 142 0.00% 53 193 0.00% 54 194 0.00% 55 194 0.00% 56 228 0.00% 57 230 0.00% 58 266 0.00% 59 300 0.00% 60 379 0.00% 61 448 0.00% 62 429 0.00% 63 560 0.00% 64 603 0.00% 65 655 0.00% 66 762 0.00% 67 772 0.00% 68 919 0.01% 69 1017 0.01% 70 1242 0.01% 71 1394 0.01% 72 1570 0.01% 73 1735 0.01% 74 2016 0.01% 75 2280 0.01% 76 2440 0.01% 77 2652 0.02% 78 2987 0.02% 79 3259 0.02% 80 3580 0.02% 81 3999 0.02% 82 4591 0.03% 83 4927 0.03% 84 5479 0.03% 85 6105 0.04% 86 6430 0.04% 87 7038 0.04% 88 7753 0.05% 89 8033 0.05% 90 8437 0.05% 91 9709 0.06% 92 10138 0.06% 93 10807 0.06% 94 11820 0.07% 95 12629 0.07% 96 13413 0.08% 97 14044 0.08% 98 14857 0.09% 99 15493 0.09% 100 16573 0.10% 101 17292 0.10% 102 18488 0.11% 103 19261 0.11% 104 19860 0.12% 105 20748 0.12% 106 21996 0.13% 107 22905 0.14% 108 24141 0.14% 109 25249 0.15% 110 25592 0.15% 111 26748 0.16% 112 27917 0.17% 113 28293 0.17% 114 30425 0.18% 115 31421 0.19% 116 32417 0.19% 117 34067 0.20% 118 34855 0.21% 119 35826 0.21% 120 37190 0.22% 121 38138 0.23% 122 39694 0.23% 123 40925 0.24% 124 42654 0.25% 125 42809 0.25% 126 44512 0.26% 127 46611 0.28% 128 47634 0.28% 129 49026 0.29% 130 50400 0.30% 131 51043 0.30% 132 52368 0.31% 133 54551 0.32% 134 55836 0.33% 135 56638 0.33% 136 57490 0.34% 137 58922 0.35% 138 59782 0.35% 139 62163 0.37% 140 62212 0.37% 141 63536 0.38% 142 64897 0.38% 143 66283 0.39% 144 68269 0.40% 145 69517 0.41% 146 69790 0.41% 147 70281 0.42% 148 71781 0.42% 149 71844 0.42% 150 73352 0.43% 151 14445823 85.42% 16910780 reads passed initial QC criterion=sequence-density sequence-density=1.09 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=17 prefix-density=1.10 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=111.73 fanout-score-rank=1 prefix-density=1.07 prefix-fanout=2.0 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=23 prefix-density=0.92 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=106.77 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=6.4 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGACTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTAGAATAAAAGGGGTGCTCGAGCATGTTTGAGCT SRR12690121 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:13:02 Started mapping on | Feb 10 16:13:02 Finished on | Feb 10 16:14:51 Mapping speed, Million of reads per hour | 558.52 Number of input reads | 16910780 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15916241 Uniquely mapped reads % | 94.12% Average mapped length | 294.16 Number of splices: Total | 16314442 Number of splices: Annotated (sjdb) | 16041573 Number of splices: GT/AG | 15975373 Number of splices: GC/AG | 288493 Number of splices: AT/AC | 12738 Number of splices: Non-canonical | 37838 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 409230 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 182725 % of reads mapped to too many loci | 1.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.15% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 585309 585309 585309 N_multimapping 409230 409230 409230 N_noFeature 350158 15738095 397044 N_ambiguous 231528 770 99760 UnstrandedReadsAssigned:15334555 PositiveStrandReadsAssigned:177376 NegativeStrandReadsAssigned:15419437 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690121 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690121-trimmed-pair1.fastq SRR12690121-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,910,780 reads, 15,615,919 reads pseudoaligned [quant] estimated average fragment length: 223.311 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52401 SRR12690121.ke.tsv 34699 SRR12690121.se.tsv 87100 total ==> SRR12690121.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795.69 389 11.7194 Potri.005G024800.1.v4.1 1035 812.689 158 10.5177 Potri.004G059700.1.v4.1 961 738.689 96 7.03067 Potri.007G009000.2.v4.1 1416 1193.69 0 0 Potri.003G141000.2.v4.1 2943 2720.69 448 8.90812 Potri.016G087400.1.v4.1 270 87.3055 1042 645.673 Potri.015G069301.1.v4.1 564 344.656 0 0 Potri.010G195200.1.v4.1 1773 1550.69 4 0.139548 Potri.012G127500.1.v4.1 977 754.689 1560 111.826 ==> SRR12690121.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 38 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 264 Potri.001G212900.v4.1 13 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12690121 completed mapping pipeline successfully