Starting /dee2/code/volunteer_pipeline.sh SRR12690122 current disk space = 3058193313792 free memory = 1571540532 SRR12690122 SRAfilesize 2d43209342c8888f2a57b62fb08f7481 SRR12690122.sra SRR12690122.sra file validated SRR12690122 is paired end SRR12690122 is conventional basespace SRR12690122 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690122_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6045 37.0 37.0 37.0 37.0 37.0 2 36.48175 37.0 37.0 37.0 37.0 37.0 3 36.6385 37.0 37.0 37.0 37.0 37.0 4 36.664 37.0 37.0 37.0 37.0 37.0 5 36.668 37.0 37.0 37.0 37.0 37.0 6 36.6575 37.0 37.0 37.0 37.0 37.0 7 36.6215 37.0 37.0 37.0 37.0 37.0 8 36.5745 37.0 37.0 37.0 37.0 37.0 9 36.642 37.0 37.0 37.0 37.0 37.0 10-14 36.64 37.0 37.0 37.0 37.0 37.0 15-19 36.6092 37.0 37.0 37.0 37.0 37.0 20-24 36.576 37.0 37.0 37.0 37.0 37.0 25-29 36.5664 37.0 37.0 37.0 37.0 37.0 30-34 36.5215 37.0 37.0 37.0 37.0 37.0 35-39 36.519600000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.487300000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.4236 37.0 37.0 37.0 37.0 37.0 50-54 36.4289 37.0 37.0 37.0 37.0 37.0 55-59 36.3319 37.0 37.0 37.0 37.0 37.0 60-64 36.2793 37.0 37.0 37.0 37.0 37.0 65-69 36.253699999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.3287 37.0 37.0 37.0 37.0 37.0 75-79 36.3347 37.0 37.0 37.0 37.0 37.0 80-84 36.3041 37.0 37.0 37.0 37.0 37.0 85-89 36.2272 37.0 37.0 37.0 37.0 37.0 90-94 36.2647 37.0 37.0 37.0 37.0 37.0 95-99 36.211 37.0 37.0 37.0 37.0 37.0 100-104 36.1976 37.0 37.0 37.0 37.0 37.0 105-109 36.204899999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.1769 37.0 37.0 37.0 37.0 37.0 115-119 36.0793 37.0 37.0 37.0 37.0 37.0 120-124 36.0726 37.0 37.0 37.0 37.0 37.0 125-129 36.0646 37.0 37.0 37.0 37.0 37.0 130-134 36.0315 37.0 37.0 37.0 37.0 37.0 135-139 36.0142 37.0 37.0 37.0 37.0 37.0 140-144 35.8015 37.0 37.0 37.0 37.0 37.0 145-149 35.7626 37.0 37.0 37.0 37.0 37.0 150-151 35.53275 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 3.0 25 3.0 26 1.0 27 12.0 28 9.0 29 18.0 30 16.0 31 31.0 32 52.0 33 76.0 34 109.0 35 294.0 36 3024.0 37 351.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.025 13.25 8.375 36.35 2 20.972187421698823 13.95640190428464 34.02655975945878 31.044850914557752 3 18.7 14.7 27.500000000000004 39.1 4 21.425 21.075 24.099999999999998 33.4 5 22.35 25.775 25.974999999999998 25.900000000000002 6 22.45 30.95 24.05 22.55 7 17.525 27.525 37.7 17.25 8 16.950000000000003 27.500000000000004 32.025 23.525 9 18.775 23.724999999999998 34.925 22.575 10-14 19.875 28.494999999999997 28.005000000000003 23.625 15-19 20.41 27.205000000000002 27.79 24.595 20-24 20.59 27.105 27.72 24.585 25-29 20.8 26.82 28.07 24.310000000000002 30-34 20.61 27.575 27.084999999999997 24.73 35-39 20.785 27.345000000000002 27.62 24.25 40-44 20.835 27.365000000000002 27.794999999999998 24.005000000000003 45-49 21.51 27.084999999999997 27.525 23.880000000000003 50-54 20.925 27.67 27.384999999999998 24.02 55-59 20.599999999999998 27.735 27.105 24.560000000000002 60-64 20.995 27.37 27.575 24.060000000000002 65-69 21.25 26.965 27.185 24.6 70-74 20.549999999999997 27.43 27.61 24.41 75-79 21.11 27.255000000000003 26.875 24.759999999999998 80-84 21.495 27.595 27.205000000000002 23.705000000000002 85-89 21.81 27.04 27.455000000000002 23.695 90-94 21.195 26.755000000000003 27.47 24.58 95-99 21.285 27.05 27.315 24.349999999999998 100-104 21.529999999999998 27.265 27.465 23.74 105-109 22.17 26.295 28.01 23.525 110-114 22.165000000000003 26.795 27.295 23.745 115-119 21.84 26.775 27.63 23.755000000000003 120-124 22.525000000000002 27.49 26.915 23.07 125-129 21.38 27.435 26.484999999999996 24.7 130-134 21.240000000000002 27.155 27.42 24.185000000000002 135-139 21.805 27.22 26.655 24.32 140-144 21.005 27.334999999999997 26.584999999999997 25.074999999999996 145-149 22.33 27.32 25.865 24.485 150-151 21.125 27.625 25.95 25.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.5 23 2.0 24 3.0 25 3.0 26 2.5 27 3.0 28 8.0 29 9.0 30 9.0 31 11.5 32 14.0 33 22.5 34 31.0 35 45.0 36 72.0 37 87.0 38 99.5 39 123.5 40 151.5 41 175.5 42 207.0 43 245.0 44 250.5 45 247.0 46 248.5 47 249.5 48 252.0 49 243.0 50 220.0 51 201.0 52 171.5 53 131.5 54 106.5 55 89.0 56 79.0 57 55.5 58 32.0 59 23.5 60 20.0 61 15.5 62 7.0 63 4.5 64 3.0 65 3.0 66 4.5 67 4.0 68 3.0 69 2.5 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.425 #Duplication Level Percentage of deduplicated Percentage of total 1 91.76920973475526 83.89999999999999 2 7.328411266065081 13.4 3 0.6836204539239814 1.875 4 0.1914137270987148 0.7000000000000001 5 0.027344818156959255 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTACCAACCATCTCGTAT 5 0.125 TruSeq Adapter, Index 10 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.1625 0.0 0.0 0.0 0.0 100-101 1.3125 0.0 0.0 0.0 0.0 102-103 1.5375 0.0 0.0 0.0 0.0 104-105 1.725 0.0 0.0 0.0 0.0 106-107 1.9875 0.0 0.0 0.0 0.0 108-109 2.25 0.0 0.0 0.0 0.0 110-111 2.6624999999999996 0.0 0.0 0.0 0.0 112-113 3.175 0.0 0.0 0.0 0.0 114-115 3.5 0.0 0.0 0.0 0.0 116-117 3.75 0.0 0.0 0.0 0.0 118-119 4.0625 0.0 0.0 0.0 0.0 120-121 4.45 0.0 0.0 0.0 0.0 122-123 4.85 0.0 0.0 0.0 0.0 124-125 5.3625 0.0 0.0 0.0 0.0 126-127 5.975 0.0 0.0 0.0 0.0 128-129 6.7625 0.0 0.0 0.0 0.0 130-131 7.2875 0.0 0.0 0.0 0.0 132-133 7.862500000000001 0.0 0.0 0.0 0.0 134-135 8.625 0.0 0.0 0.0 0.0 136-137 9.275 0.0 0.0 0.0 0.0 138-139 9.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCCAG 10 0.006830828 145.0 1 >>END_MODULE SRR12690122 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690122_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.299 37.0 37.0 37.0 37.0 37.0 2 36.1695 37.0 37.0 37.0 37.0 37.0 3 36.1995 37.0 37.0 37.0 37.0 37.0 4 36.246 37.0 37.0 37.0 37.0 37.0 5 36.319 37.0 37.0 37.0 37.0 37.0 6 36.2185 37.0 37.0 37.0 37.0 37.0 7 36.396 37.0 37.0 37.0 37.0 37.0 8 36.2825 37.0 37.0 37.0 37.0 37.0 9 36.3965 37.0 37.0 37.0 37.0 37.0 10-14 36.3647 37.0 37.0 37.0 37.0 37.0 15-19 36.2952 37.0 37.0 37.0 37.0 37.0 20-24 36.243500000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.214099999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.203900000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.2293 37.0 37.0 37.0 37.0 37.0 40-44 36.116 37.0 37.0 37.0 37.0 37.0 45-49 36.0958 37.0 37.0 37.0 37.0 37.0 50-54 36.1225 37.0 37.0 37.0 37.0 37.0 55-59 36.108399999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.0488 37.0 37.0 37.0 37.0 37.0 65-69 36.0959 37.0 37.0 37.0 37.0 37.0 70-74 35.9387 37.0 37.0 37.0 37.0 37.0 75-79 35.9716 37.0 37.0 37.0 37.0 37.0 80-84 36.0152 37.0 37.0 37.0 37.0 37.0 85-89 36.053000000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.956399999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.918600000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.985899999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.9563 37.0 37.0 37.0 37.0 37.0 110-114 35.898300000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.794000000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.7634 37.0 37.0 37.0 37.0 37.0 125-129 35.799400000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.6616 37.0 37.0 37.0 37.0 37.0 135-139 35.6263 37.0 37.0 37.0 37.0 37.0 140-144 35.519999999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.3351 37.0 37.0 37.0 34.6 37.0 150-151 34.8925 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 4.0 14 3.0 15 0.0 16 2.0 17 0.0 18 1.0 19 3.0 20 2.0 21 1.0 22 4.0 23 7.0 24 6.0 25 7.0 26 6.0 27 8.0 28 9.0 29 20.0 30 23.0 31 33.0 32 39.0 33 87.0 34 160.0 35 514.0 36 2781.0 37 278.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.7 23.65 12.2 26.450000000000003 2 28.925 29.475 25.624999999999996 15.975 3 21.475 29.825000000000003 29.075 19.625 4 24.525 34.125 23.225 18.125 5 26.275 36.875 20.674999999999997 16.175 6 22.25 39.675 22.05 16.025 7 22.55 23.625 34.775 19.05 8 23.3 27.575 25.025 24.099999999999998 9 22.625 26.200000000000003 28.7 22.475 10-14 24.605 29.015 24.945 21.435000000000002 15-19 23.925 28.615000000000002 26.284999999999997 21.175 20-24 24.565 28.275 26.150000000000002 21.01 25-29 23.755000000000003 28.83 26.27 21.145 30-34 23.595 28.17 26.565 21.67 35-39 23.935000000000002 27.855 26.950000000000003 21.26 40-44 23.044999999999998 28.560000000000002 26.91 21.485000000000003 45-49 23.845 28.54 26.015 21.6 50-54 24.09 27.875 26.645000000000003 21.39 55-59 23.605 27.85 26.965 21.58 60-64 24.240000000000002 27.284999999999997 26.685 21.790000000000003 65-69 23.755000000000003 27.900000000000002 26.11 22.235 70-74 24.154999999999998 27.125 26.945000000000004 21.775 75-79 23.45 27.889999999999997 26.185000000000002 22.475 80-84 24.42 28.24 25.535000000000004 21.805 85-89 24.305 28.134999999999998 25.629999999999995 21.93 90-94 24.6 27.589999999999996 26.090000000000003 21.72 95-99 24.13 28.095 25.814999999999998 21.959999999999997 100-104 24.27 27.675 26.729999999999997 21.325 105-109 24.7 27.755000000000003 26.21 21.335 110-114 24.695 27.915 25.990000000000002 21.4 115-119 25.03 27.82 25.88 21.27 120-124 25.195 28.084999999999997 26.105 20.615 125-129 25.650000000000002 27.584999999999997 26.205000000000002 20.560000000000002 130-134 25.624999999999996 27.855 25.445 21.075 135-139 25.965 28.315 25.575 20.145 140-144 25.814999999999998 27.72 25.77 20.695 145-149 26.290000000000003 26.97 26.06 20.68 150-151 27.150000000000002 27.8375 24.6 20.4125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 2.0 8 2.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 1.0 21 1.0 22 1.0 23 1.5 24 1.5 25 2.5 26 2.5 27 2.0 28 3.5 29 5.5 30 9.0 31 9.5 32 9.5 33 16.5 34 22.5 35 36.0 36 55.5 37 77.5 38 108.0 39 140.0 40 166.5 41 200.5 42 236.0 43 248.0 44 272.0 45 281.5 46 265.5 47 267.0 48 243.0 49 221.5 50 201.5 51 169.0 52 145.0 53 121.0 54 106.5 55 85.0 56 62.5 57 54.0 58 42.5 59 25.5 60 15.0 61 9.5 62 8.0 63 4.5 64 2.5 65 1.0 66 0.0 67 1.0 68 1.5 69 1.0 70 0.5 71 1.0 72 2.5 73 3.0 74 2.5 75 1.0 76 0.0 77 0.5 78 1.0 79 1.0 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.5 94 1.5 95 1.0 96 0.5 97 1.0 98 1.5 99 1.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.14999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.55238617663193 83.45 2 7.350521119034559 13.4 3 0.9325287986834888 2.55 4 0.16456390565002743 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.3375 0.0 0.0 0.0 0.0 102-103 1.5625 0.0 0.0 0.0 0.0 104-105 1.75 0.0 0.0 0.0 0.0 106-107 2.0125 0.0 0.0 0.0 0.0 108-109 2.2750000000000004 0.0 0.0 0.0 0.0 110-111 2.6875 0.0 0.0 0.0 0.0 112-113 3.2 0.0 0.0 0.0 0.0 114-115 3.5250000000000004 0.0 0.0 0.0 0.0 116-117 3.7750000000000004 0.0 0.0 0.0 0.0 118-119 4.0875 0.0 0.0 0.0 0.0 120-121 4.475 0.0 0.0 0.0 0.0 122-123 4.875 0.0 0.0 0.0 0.0 124-125 5.3875 0.0 0.0 0.0 0.0 126-127 5.987500000000001 0.0 0.0 0.0 0.0 128-129 6.7625 0.0 0.0 0.0 0.0 130-131 7.2875 0.0 0.0 0.0 0.0 132-133 7.862500000000001 0.0 0.0 0.0 0.0 134-135 8.6375 0.0 0.0 0.0 0.0 136-137 9.275 0.0 0.0 0.0 0.0 138-139 9.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 650589 spots for SRR12690122.sra Written 650589 spots for SRR12690122.sra Read 650589 spots for SRR12690122.sra Written 650589 spots for SRR12690122.sra Read 650589 spots for SRR12690122.sra Written 650589 spots for SRR12690122.sra Read 650589 spots for SRR12690122.sra Written 650589 spots for SRR12690122.sra Read 650589 spots for SRR12690122.sra Written 650589 spots for SRR12690122.sra Read 650589 spots for SRR12690122.sra Written 650589 spots for SRR12690122.sra Read 650589 spots for SRR12690122.sra Written 650589 spots for SRR12690122.sra Read 650589 spots for SRR12690122.sra Written 650589 spots for SRR12690122.sra Read 650589 spots for SRR12690122.sra Written 650589 spots for SRR12690122.sra Read 650589 spots for SRR12690122.sra Written 650589 spots for SRR12690122.sra Read 650589 spots for SRR12690122.sra Written 650589 spots for SRR12690122.sra Read 650589 spots for SRR12690122.sra Written 650589 spots for SRR12690122.sra Read 650589 spots for SRR12690122.sra Written 650589 spots for SRR12690122.sra Read 650589 spots for SRR12690122.sra Written 650589 spots for SRR12690122.sra Read 650589 spots for SRR12690122.sra Written 650589 spots for SRR12690122.sra Read 650589 spots for SRR12690122.sra Written 650589 spots for SRR12690122.sra Read 650593 spots for SRR12690122.sra Written 650593 spots for SRR12690122.sra Read 650589 spots for SRR12690122.sra Written 650589 spots for SRR12690122.sra Read 650589 spots for SRR12690122.sra Written 650589 spots for SRR12690122.sra Read 650589 spots for SRR12690122.sra Written 650589 spots for SRR12690122.sra SRR ids: ['SRR12690122.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5rzeepz4 SRR12690122.sra spots: 13011784 blocks: [[1, 650589], [650590, 1301178], [1301179, 1951767], [1951768, 2602356], [2602357, 3252945], [3252946, 3903534], [3903535, 4554123], [4554124, 5204712], [5204713, 5855301], [5855302, 6505890], [6505891, 7156479], [7156480, 7807068], [7807069, 8457657], [8457658, 9108246], [9108247, 9758835], [9758836, 10409424], [10409425, 11060013], [11060014, 11710602], [11710603, 12361191], [12361192, 13011784]] SRR12690122 file size 4400273 SRR12690122 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690122 SRR12690122_1.fastq SRR12690122_2.fastq Input file: SRR12690122_1.fastq Paired file: SRR12690122_2.fastq trimmed: SRR12690122-trimmed-pair1.fastq, SRR12690122-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:12:26 2025 >> started Mon Feb 10 17:12:47 2025 >> done (20.745s) 13011784 read pairs processed; of these: 34 ( 0.00%) short read pairs filtered out after trimming by size control 35858 ( 0.28%) empty read pairs filtered out after trimming by size control 12975892 (99.72%) read pairs available; of these: 2008297 (15.48%) trimmed read pairs available after processing 10967595 (84.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 7 0.00% 20 4 0.00% 21 7 0.00% 22 5 0.00% 23 13 0.00% 24 10 0.00% 25 20 0.00% 26 20 0.00% 27 28 0.00% 28 14 0.00% 29 24 0.00% 30 34 0.00% 31 18 0.00% 32 29 0.00% 33 35 0.00% 34 43 0.00% 35 42 0.00% 36 34 0.00% 37 30 0.00% 38 39 0.00% 39 52 0.00% 40 59 0.00% 41 45 0.00% 42 55 0.00% 43 49 0.00% 44 42 0.00% 45 53 0.00% 46 60 0.00% 47 79 0.00% 48 99 0.00% 49 114 0.00% 50 104 0.00% 51 103 0.00% 52 130 0.00% 53 148 0.00% 54 152 0.00% 55 161 0.00% 56 203 0.00% 57 202 0.00% 58 247 0.00% 59 292 0.00% 60 300 0.00% 61 352 0.00% 62 391 0.00% 63 466 0.00% 64 515 0.00% 65 545 0.00% 66 621 0.00% 67 625 0.00% 68 794 0.01% 69 807 0.01% 70 998 0.01% 71 1068 0.01% 72 1273 0.01% 73 1405 0.01% 74 1619 0.01% 75 1825 0.01% 76 2073 0.02% 77 2180 0.02% 78 2410 0.02% 79 2751 0.02% 80 3002 0.02% 81 3404 0.03% 82 3617 0.03% 83 4075 0.03% 84 4482 0.03% 85 4939 0.04% 86 5523 0.04% 87 5853 0.05% 88 6423 0.05% 89 6564 0.05% 90 7159 0.06% 91 7919 0.06% 92 8493 0.07% 93 9295 0.07% 94 9882 0.08% 95 10791 0.08% 96 11411 0.09% 97 11887 0.09% 98 12577 0.10% 99 13081 0.10% 100 14241 0.11% 101 14675 0.11% 102 15299 0.12% 103 16202 0.12% 104 17044 0.13% 105 17514 0.13% 106 18501 0.14% 107 19453 0.15% 108 20253 0.16% 109 21054 0.16% 110 21761 0.17% 111 22542 0.17% 112 23739 0.18% 113 24235 0.19% 114 25261 0.19% 115 26453 0.20% 116 27255 0.21% 117 28284 0.22% 118 29347 0.23% 119 30337 0.23% 120 30710 0.24% 121 32125 0.25% 122 33160 0.26% 123 33970 0.26% 124 35311 0.27% 125 35569 0.27% 126 37064 0.29% 127 38404 0.30% 128 39066 0.30% 129 39960 0.31% 130 41145 0.32% 131 41080 0.32% 132 42586 0.33% 133 44189 0.34% 134 44954 0.35% 135 44873 0.35% 136 46533 0.36% 137 46948 0.36% 138 47638 0.37% 139 49242 0.38% 140 50134 0.39% 141 50382 0.39% 142 51923 0.40% 143 52671 0.41% 144 54503 0.42% 145 54365 0.42% 146 54543 0.42% 147 54951 0.42% 148 56246 0.43% 149 56654 0.44% 150 57648 0.44% 151 10967595 84.52% 12975892 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=24 prefix-density=0.85 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=12.03 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=3.6 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=1.03 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=19 prefix-density=1.06 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=23.77 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=2.4 sequence=GCCAAAACTCTGCATTTGCTAGCTAGAAGTCACTCTACCCTTCGCATTACTTCCTCAATCAACCACTGCTGTTTGATCATGGCAGCAACCATCTCAACCGTTGGAGCTGTCAACACAGCACCGCTGGCTTTGAATGGCTCTGGCGCTGGATCCACAGTCCCAAATTCAGCTTTCTTTGGCAACAGCTTGAAGAAAGTGAGCTCATCAAGGTTCACAAACTCCAAAATTTCACCAGGGAGCTTCAAGGTTGTTGCAGAGTACGATGAGAAGAAGCAGACCGACAAGGACAGATGGGGAGGCCTTGTTACAGACATGTCTGATGACCAACAAGATATCAGCAGAGGAAAGGGTATGGTGGACTCTCTTTTCCAAGCCCCCCAGGGAACTGGAACTCACAACCCCGTTTTGAATTCTTATGAGTATCTCAGTCAAGGTCTTCGTACGTACAACTTGGACAACAACATGGATGGTTTCTACATTGCTCCTGCTTTCATGGACAAGCTTGTTGTTC SRR12690122 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:13:29 Started mapping on | Feb 10 17:13:30 Finished on | Feb 10 17:15:03 Mapping speed, Million of reads per hour | 502.29 Number of input reads | 12975892 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12138281 Uniquely mapped reads % | 93.54% Average mapped length | 293.50 Number of splices: Total | 12805554 Number of splices: Annotated (sjdb) | 12564442 Number of splices: GT/AG | 12537943 Number of splices: GC/AG | 225330 Number of splices: AT/AC | 10379 Number of splices: Non-canonical | 31902 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 299984 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 136259 % of reads mapped to too many loci | 1.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.86% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 537627 537627 537627 N_multimapping 299984 299984 299984 N_noFeature 313655 11984001 351616 N_ambiguous 200726 596 84019 UnstrandedReadsAssigned:11623900 PositiveStrandReadsAssigned:153684 NegativeStrandReadsAssigned:11702646 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690122 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690122-trimmed-pair1.fastq SRR12690122-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,975,892 reads, 11,857,300 reads pseudoaligned [quant] estimated average fragment length: 225.929 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,021 rounds 52401 SRR12690122.ke.tsv 34699 SRR12690122.se.tsv 87100 total ==> SRR12690122.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.07 391 15.2268 Potri.005G024800.1.v4.1 1035 810.071 185 15.9469 Potri.004G059700.1.v4.1 961 736.105 46 4.36361 Potri.007G009000.2.v4.1 1416 1191.07 0 0 Potri.003G141000.2.v4.1 2943 2718.07 451 11.5863 Potri.016G087400.1.v4.1 270 89.2608 569 445.123 Potri.015G069301.1.v4.1 564 343.146 0 0 Potri.010G195200.1.v4.1 1773 1548.07 22 0.992339 Potri.012G127500.1.v4.1 977 752.094 272 25.2537 ==> SRR12690122.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 190 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 186 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 9 SRR12690122 completed mapping pipeline successfully