Starting /dee2/code/volunteer_pipeline.sh SRR12690123 current disk space = 3058013401088 free memory = 1580110148 SRR12690123 SRAfilesize 54a08f0570382b810977474fc6802169 SRR12690123.sra SRR12690123.sra file validated SRR12690123 is paired end SRR12690123 is conventional basespace SRR12690123 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690123_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6405 37.0 37.0 37.0 37.0 37.0 2 36.425 37.0 37.0 37.0 37.0 37.0 3 36.611 37.0 37.0 37.0 37.0 37.0 4 36.5905 37.0 37.0 37.0 37.0 37.0 5 36.6335 37.0 37.0 37.0 37.0 37.0 6 36.678 37.0 37.0 37.0 37.0 37.0 7 36.5435 37.0 37.0 37.0 37.0 37.0 8 36.662 37.0 37.0 37.0 37.0 37.0 9 36.6315 37.0 37.0 37.0 37.0 37.0 10-14 36.6152 37.0 37.0 37.0 37.0 37.0 15-19 36.6098 37.0 37.0 37.0 37.0 37.0 20-24 36.59 37.0 37.0 37.0 37.0 37.0 25-29 36.5674 37.0 37.0 37.0 37.0 37.0 30-34 36.5486 37.0 37.0 37.0 37.0 37.0 35-39 36.5176 37.0 37.0 37.0 37.0 37.0 40-44 36.4748 37.0 37.0 37.0 37.0 37.0 45-49 36.5016 37.0 37.0 37.0 37.0 37.0 50-54 36.4285 37.0 37.0 37.0 37.0 37.0 55-59 36.4094 37.0 37.0 37.0 37.0 37.0 60-64 36.422200000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.3427 37.0 37.0 37.0 37.0 37.0 70-74 36.326 37.0 37.0 37.0 37.0 37.0 75-79 36.376 37.0 37.0 37.0 37.0 37.0 80-84 36.2654 37.0 37.0 37.0 37.0 37.0 85-89 36.302 37.0 37.0 37.0 37.0 37.0 90-94 36.29299999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.2033 37.0 37.0 37.0 37.0 37.0 100-104 36.2048 37.0 37.0 37.0 37.0 37.0 105-109 36.1535 37.0 37.0 37.0 37.0 37.0 110-114 36.12 37.0 37.0 37.0 37.0 37.0 115-119 36.1058 37.0 37.0 37.0 37.0 37.0 120-124 36.0541 37.0 37.0 37.0 37.0 37.0 125-129 36.022200000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.987 37.0 37.0 37.0 37.0 37.0 135-139 35.9969 37.0 37.0 37.0 37.0 37.0 140-144 35.8886 37.0 37.0 37.0 37.0 37.0 145-149 35.804700000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.620999999999995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 4.0 26 4.0 27 7.0 28 14.0 29 14.0 30 15.0 31 40.0 32 46.0 33 52.0 34 116.0 35 298.0 36 3050.0 37 340.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.175 11.975 7.825 39.025 2 19.899749373433583 13.132832080200501 36.817042606516296 30.15037593984962 3 16.525000000000002 15.75 28.625 39.1 4 21.25 24.9 24.275 29.575000000000003 5 23.025000000000002 30.349999999999998 23.875 22.75 6 20.775 34.775 23.599999999999998 20.849999999999998 7 16.625 27.325 39.45 16.6 8 18.025 26.924999999999997 31.374999999999996 23.674999999999997 9 17.025000000000002 25.124999999999996 34.050000000000004 23.799999999999997 10-14 20.025000000000002 29.299999999999997 27.805000000000003 22.869999999999997 15-19 19.61 28.24 28.175 23.974999999999998 20-24 20.755000000000003 27.884999999999998 27.63 23.73 25-29 20.055 27.794999999999998 28.18 23.97 30-34 20.25 28.425 27.389999999999997 23.935000000000002 35-39 20.285 28.249999999999996 27.339999999999996 24.125 40-44 20.3 28.54 27.48 23.68 45-49 19.830000000000002 27.975 27.79 24.404999999999998 50-54 19.725 27.955000000000002 27.825 24.495 55-59 20.28 27.644999999999996 28.194999999999997 23.880000000000003 60-64 20.32 28.08 27.855 23.745 65-69 20.785 28.000000000000004 27.565 23.65 70-74 20.49 28.24 27.075 24.195 75-79 20.215 27.994999999999997 27.555000000000003 24.235 80-84 20.095 27.965 27.639999999999997 24.3 85-89 20.599999999999998 27.935 27.57 23.895 90-94 20.035 27.595 28.249999999999996 24.12 95-99 19.785 28.215 27.91 24.09 100-104 20.77 27.615000000000002 27.639999999999997 23.974999999999998 105-109 20.44 27.439999999999998 27.985 24.135 110-114 20.54 28.144999999999996 27.665 23.65 115-119 20.47 28.09 27.68 23.76 120-124 20.49 28.050000000000004 27.205000000000002 24.255 125-129 21.135 28.194999999999997 26.965 23.705000000000002 130-134 21.125 28.470000000000002 27.185 23.22 135-139 20.905 28.425 27.435 23.235 140-144 21.740000000000002 27.425 26.884999999999998 23.95 145-149 21.43 28.299999999999997 26.619999999999997 23.65 150-151 22.8125 27.725 26.187500000000004 23.275000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 1.5 24 1.0 25 2.0 26 3.5 27 6.0 28 9.5 29 15.0 30 20.5 31 19.0 32 25.5 33 35.5 34 46.5 35 69.0 36 78.0 37 89.0 38 123.5 39 157.5 40 184.0 41 197.0 42 215.0 43 247.0 44 268.5 45 268.0 46 265.5 47 271.0 48 252.0 49 222.0 50 189.5 51 152.5 52 127.5 53 101.0 54 79.0 55 61.0 56 46.0 57 39.5 58 26.0 59 22.5 60 22.5 61 11.5 62 7.5 63 6.0 64 4.0 65 3.5 66 2.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.575 #Duplication Level Percentage of deduplicated Percentage of total 1 90.80872205354679 82.25 2 8.11482197074248 14.7 3 0.9384487993375654 2.55 4 0.1380071763731714 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 1.05 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.525 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 1.9625000000000001 0.0 0.0 0.0 0.0 110-111 2.3 0.0 0.0 0.0 0.0 112-113 2.55 0.0 0.0 0.0 0.0 114-115 2.7625 0.0 0.0 0.0 0.0 116-117 3.1 0.0 0.0 0.0 0.0 118-119 3.3625 0.0 0.0 0.0 0.0 120-121 3.7625 0.0 0.0 0.0 0.0 122-123 4.15 0.0 0.0 0.0 0.0 124-125 4.575 0.0 0.0 0.0 0.0 126-127 5.0375 0.0 0.0 0.0 0.0 128-129 5.425 0.0 0.0 0.0 0.0 130-131 6.025 0.0 0.0 0.0 0.0 132-133 6.6 0.0 0.0 0.0 0.0 134-135 7.05 0.0 0.0 0.0 0.0 136-137 7.6 0.0 0.0 0.0 0.0 138-139 8.350000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12690123 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690123_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4735 37.0 37.0 37.0 37.0 37.0 2 36.1755 37.0 37.0 37.0 37.0 37.0 3 36.2495 37.0 37.0 37.0 37.0 37.0 4 36.272 37.0 37.0 37.0 37.0 37.0 5 36.397 37.0 37.0 37.0 37.0 37.0 6 36.3185 37.0 37.0 37.0 37.0 37.0 7 36.355 37.0 37.0 37.0 37.0 37.0 8 36.455 37.0 37.0 37.0 37.0 37.0 9 36.375 37.0 37.0 37.0 37.0 37.0 10-14 36.3409 37.0 37.0 37.0 37.0 37.0 15-19 36.335699999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.3024 37.0 37.0 37.0 37.0 37.0 25-29 36.2783 37.0 37.0 37.0 37.0 37.0 30-34 36.240899999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.2898 37.0 37.0 37.0 37.0 37.0 40-44 36.1962 37.0 37.0 37.0 37.0 37.0 45-49 36.2421 37.0 37.0 37.0 37.0 37.0 50-54 36.16420000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.1827 37.0 37.0 37.0 37.0 37.0 60-64 36.1102 37.0 37.0 37.0 37.0 37.0 65-69 36.065999999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.047700000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.0287 37.0 37.0 37.0 37.0 37.0 80-84 36.075 37.0 37.0 37.0 37.0 37.0 85-89 35.9984 37.0 37.0 37.0 37.0 37.0 90-94 35.8818 37.0 37.0 37.0 37.0 37.0 95-99 35.932599999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.956199999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.930400000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.8933 37.0 37.0 37.0 37.0 37.0 115-119 35.7527 37.0 37.0 37.0 37.0 37.0 120-124 35.748900000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.6672 37.0 37.0 37.0 37.0 37.0 130-134 35.6207 37.0 37.0 37.0 37.0 37.0 135-139 35.5739 37.0 37.0 37.0 37.0 37.0 140-144 35.4439 37.0 37.0 37.0 37.0 37.0 145-149 35.313900000000004 37.0 37.0 37.0 32.2 37.0 150-151 34.891999999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 2.0 15 1.0 16 0.0 17 2.0 18 0.0 19 1.0 20 0.0 21 1.0 22 0.0 23 2.0 24 2.0 25 5.0 26 5.0 27 10.0 28 14.0 29 23.0 30 23.0 31 36.0 32 64.0 33 85.0 34 176.0 35 533.0 36 2749.0 37 262.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.7 24.725 10.525 27.05 2 28.7 28.549999999999997 27.925 14.825 3 20.65 29.049999999999997 31.25 19.05 4 24.625 34.0 23.799999999999997 17.575 5 24.8 35.9 21.675 17.625 6 20.474999999999998 39.875 21.8 17.849999999999998 7 21.025 22.625 37.65 18.7 8 21.325 26.325 27.700000000000003 24.65 9 21.8 25.45 29.099999999999998 23.65 10-14 22.45 29.59 26.674999999999997 21.285 15-19 22.835 28.265 27.515 21.385 20-24 22.585 28.52 27.425 21.47 25-29 22.835 28.065 28.265 20.835 30-34 22.325 28.01 28.735 20.93 35-39 22.919999999999998 28.660000000000004 27.189999999999998 21.23 40-44 22.415 28.65 28.04 20.895 45-49 22.81 27.77 28.345 21.075 50-54 22.8 27.72 28.02 21.46 55-59 23.29 27.560000000000002 28.165000000000003 20.985 60-64 23.345 27.639999999999997 27.88 21.135 65-69 23.665 27.26 27.985 21.09 70-74 22.93 28.42 27.63 21.02 75-79 23.605 27.67 27.705000000000002 21.02 80-84 23.425 27.605 27.544999999999998 21.425 85-89 23.93 28.09 26.87 21.11 90-94 23.415 28.46 27.18 20.945 95-99 23.085 28.345 27.26 21.310000000000002 100-104 24.46 28.115000000000002 27.060000000000002 20.365 105-109 23.9 28.43 27.089999999999996 20.580000000000002 110-114 24.41 28.485 26.645000000000003 20.46 115-119 24.625 28.105000000000004 26.619999999999997 20.65 120-124 24.6 28.255000000000003 26.85 20.294999999999998 125-129 24.665 27.834999999999997 27.29 20.21 130-134 25.56 28.360000000000003 26.85 19.23 135-139 25.77 27.99 26.645000000000003 19.595000000000002 140-144 25.825 27.725 26.83 19.62 145-149 26.919999999999998 27.6 26.415 19.064999999999998 150-151 26.375 27.212500000000002 26.974999999999998 19.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.5 6 1.0 7 2.0 8 2.5 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 1.5 21 1.0 22 0.0 23 0.5 24 1.0 25 1.5 26 3.5 27 6.0 28 8.5 29 13.0 30 15.5 31 14.5 32 25.5 33 40.0 34 47.5 35 61.0 36 92.5 37 117.0 38 137.5 39 163.0 40 189.0 41 221.5 42 254.5 43 267.0 44 259.5 45 253.0 46 267.5 47 266.0 48 213.0 49 188.5 50 185.0 51 145.0 52 105.0 53 94.0 54 78.0 55 59.5 56 48.0 57 38.0 58 27.0 59 17.5 60 14.0 61 14.5 62 12.5 63 6.0 64 3.0 65 2.5 66 3.0 67 1.0 68 0.0 69 1.0 70 1.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.5 #Duplication Level Percentage of deduplicated Percentage of total 1 90.99447513812154 82.35 2 7.81767955801105 14.149999999999999 3 0.9944751381215469 2.7 4 0.13812154696132595 0.5 5 0.027624309392265196 0.125 6 0.0 0.0 7 0.027624309392265196 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 1.05 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.5125 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 1.9625000000000001 0.0 0.0 0.0 0.0 110-111 2.3 0.0 0.0 0.0 0.0 112-113 2.55 0.0 0.0 0.0 0.0 114-115 2.7874999999999996 0.0 0.0 0.0 0.0 116-117 3.125 0.0 0.0 0.0 0.0 118-119 3.4125 0.0 0.0 0.0 0.0 120-121 3.8125 0.0 0.0 0.0 0.0 122-123 4.2125 0.0 0.0 0.0 0.0 124-125 4.637499999999999 0.0 0.0 0.0 0.0 126-127 5.0625 0.0 0.0 0.0 0.0 128-129 5.4375 0.0 0.0 0.0 0.0 130-131 6.025 0.0 0.0 0.0 0.0 132-133 6.6 0.0 0.0 0.0 0.0 134-135 7.05 0.0 0.0 0.0 0.0 136-137 7.574999999999999 0.0 0.0 0.0 0.0 138-139 8.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 741699 spots for SRR12690123.sra Written 741699 spots for SRR12690123.sra Read 741699 spots for SRR12690123.sra Written 741699 spots for SRR12690123.sra Read 741699 spots for SRR12690123.sra Written 741699 spots for SRR12690123.sra Read 741699 spots for SRR12690123.sra Written 741699 spots for SRR12690123.sra Read 741699 spots for SRR12690123.sra Written 741699 spots for SRR12690123.sra Read 741699 spots for SRR12690123.sra Written 741699 spots for SRR12690123.sra Read 741699 spots for SRR12690123.sra Written 741699 spots for SRR12690123.sra Read 741699 spots for SRR12690123.sra Written 741699 spots for SRR12690123.sra Read 741699 spots for SRR12690123.sra Written 741699 spots for SRR12690123.sra Read 741699 spots for SRR12690123.sra Written 741699 spots for SRR12690123.sra Read 741699 spots for SRR12690123.sra Written 741699 spots for SRR12690123.sra Read 741699 spots for SRR12690123.sra Written 741699 spots for SRR12690123.sra Read 741699 spots for SRR12690123.sra Written 741699 spots for SRR12690123.sra Read 741699 spots for SRR12690123.sra Written 741699 spots for SRR12690123.sra Read 741699 spots for SRR12690123.sra Written 741699 spots for SRR12690123.sra Read 741699 spots for SRR12690123.sra Written 741699 spots for SRR12690123.sra Read 741707 spots for SRR12690123.sra Written 741707 spots for SRR12690123.sra Read 741699 spots for SRR12690123.sra Written 741699 spots for SRR12690123.sra Read 741699 spots for SRR12690123.sra Written 741699 spots for SRR12690123.sra Read 741699 spots for SRR12690123.sra Written 741699 spots for SRR12690123.sra SRR ids: ['SRR12690123.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1vwjv6p0 SRR12690123.sra spots: 14833988 blocks: [[1, 741699], [741700, 1483398], [1483399, 2225097], [2225098, 2966796], [2966797, 3708495], [3708496, 4450194], [4450195, 5191893], [5191894, 5933592], [5933593, 6675291], [6675292, 7416990], [7416991, 8158689], [8158690, 8900388], [8900389, 9642087], [9642088, 10383786], [10383787, 11125485], [11125486, 11867184], [11867185, 12608883], [12608884, 13350582], [13350583, 14092281], [14092282, 14833988]] SRR12690123 file size 5019537 SRR12690123 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690123 SRR12690123_1.fastq SRR12690123_2.fastq Input file: SRR12690123_1.fastq Paired file: SRR12690123_2.fastq trimmed: SRR12690123-trimmed-pair1.fastq, SRR12690123-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:30:23 2025 >> started Mon Feb 10 17:30:39 2025 >> done (16.125s) 14833988 read pairs processed; of these: 24 ( 0.00%) short read pairs filtered out after trimming by size control 3137 ( 0.02%) empty read pairs filtered out after trimming by size control 14830827 (99.98%) read pairs available; of these: 1917906 (12.93%) trimmed read pairs available after processing 12912921 (87.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 1 0.00% 21 5 0.00% 22 4 0.00% 23 9 0.00% 24 7 0.00% 25 4 0.00% 26 19 0.00% 27 19 0.00% 28 12 0.00% 29 11 0.00% 30 20 0.00% 31 18 0.00% 32 17 0.00% 33 24 0.00% 34 18 0.00% 35 21 0.00% 36 28 0.00% 37 27 0.00% 38 27 0.00% 39 20 0.00% 40 24 0.00% 41 31 0.00% 42 30 0.00% 43 25 0.00% 44 41 0.00% 45 50 0.00% 46 58 0.00% 47 39 0.00% 48 62 0.00% 49 69 0.00% 50 72 0.00% 51 97 0.00% 52 99 0.00% 53 98 0.00% 54 110 0.00% 55 98 0.00% 56 126 0.00% 57 151 0.00% 58 167 0.00% 59 180 0.00% 60 248 0.00% 61 267 0.00% 62 276 0.00% 63 345 0.00% 64 374 0.00% 65 391 0.00% 66 426 0.00% 67 468 0.00% 68 559 0.00% 69 605 0.00% 70 720 0.00% 71 827 0.01% 72 930 0.01% 73 1051 0.01% 74 1095 0.01% 75 1307 0.01% 76 1453 0.01% 77 1608 0.01% 78 1884 0.01% 79 1978 0.01% 80 2288 0.02% 81 2536 0.02% 82 2924 0.02% 83 3178 0.02% 84 3673 0.02% 85 3837 0.03% 86 4290 0.03% 87 4641 0.03% 88 5167 0.03% 89 5483 0.04% 90 6007 0.04% 91 6590 0.04% 92 7080 0.05% 93 7919 0.05% 94 8589 0.06% 95 9327 0.06% 96 9852 0.07% 97 10585 0.07% 98 11215 0.08% 99 11996 0.08% 100 12393 0.08% 101 13175 0.09% 102 13750 0.09% 103 14634 0.10% 104 15753 0.11% 105 16754 0.11% 106 17554 0.12% 107 18408 0.12% 108 18786 0.13% 109 19957 0.13% 110 20520 0.14% 111 21517 0.15% 112 22163 0.15% 113 22796 0.15% 114 24307 0.16% 115 25342 0.17% 116 26362 0.18% 117 27299 0.18% 118 28618 0.19% 119 28780 0.19% 120 30274 0.20% 121 30843 0.21% 122 31499 0.21% 123 32895 0.22% 124 33872 0.23% 125 34441 0.23% 126 36118 0.24% 127 37056 0.25% 128 37712 0.25% 129 38864 0.26% 130 39551 0.27% 131 40296 0.27% 132 41467 0.28% 133 42395 0.29% 134 42740 0.29% 135 44002 0.30% 136 44824 0.30% 137 45776 0.31% 138 46749 0.32% 139 48004 0.32% 140 49018 0.33% 141 49944 0.34% 142 50793 0.34% 143 50903 0.34% 144 52610 0.35% 145 52910 0.36% 146 54144 0.37% 147 54126 0.36% 148 55826 0.38% 149 55681 0.38% 150 57775 0.39% 151 12912921 87.07% 14830827 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=18 prefix-density=0.56 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.20 sequence-density-rank=17 fanout-score=8.85 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=4.0 sequence=TTGCAGCCATTCTC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=24 prefix-density=0.69 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=48.63 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=5.2 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACC SRR12690123 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:31:41 Started mapping on | Feb 10 17:31:41 Finished on | Feb 10 17:33:05 Mapping speed, Million of reads per hour | 635.61 Number of input reads | 14830827 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 12911775 Uniquely mapped reads % | 87.06% Average mapped length | 292.57 Number of splices: Total | 13237978 Number of splices: Annotated (sjdb) | 12952056 Number of splices: GT/AG | 12972039 Number of splices: GC/AG | 213938 Number of splices: AT/AC | 11252 Number of splices: Non-canonical | 40749 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 310071 % of reads mapped to multiple loci | 2.09% Number of reads mapped to too many loci | 63822 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.31% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1608981 1608981 1608981 N_multimapping 310071 310071 310071 N_noFeature 436828 12745853 487100 N_ambiguous 243735 1365 127225 UnstrandedReadsAssigned:12231212 PositiveStrandReadsAssigned:164557 NegativeStrandReadsAssigned:12297450 Dataset is classified negative stranded MeadianReadLen=147 20thPercentileLength=147 echo kmer=143 SRR12690123 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690123-trimmed-pair1.fastq SRR12690123-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,830,827 reads, 13,497,474 reads pseudoaligned [quant] estimated average fragment length: 237.739 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,205 rounds 52401 SRR12690123.ke.tsv 34699 SRR12690123.se.tsv 87100 total ==> SRR12690123.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.26 889 33.1552 Potri.005G024800.1.v4.1 1035 798.261 360 29.9595 Potri.004G059700.1.v4.1 961 724.363 78 7.15346 Potri.007G009000.2.v4.1 1416 1179.26 0 0 Potri.003G141000.2.v4.1 2943 2706.26 685.412 16.8252 Potri.016G087400.1.v4.1 270 89.4001 528 392.35 Potri.015G069301.1.v4.1 564 336.802 0 0 Potri.010G195200.1.v4.1 1773 1536.26 6 0.259456 Potri.012G127500.1.v4.1 977 740.299 596 53.4831 ==> SRR12690123.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 204 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 221 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 5 SRR12690123 completed mapping pipeline successfully