Starting /dee2/code/volunteer_pipeline.sh SRR12690124 current disk space = 3057870704640 free memory = 1574954304 SRR12690124 SRAfilesize 1c596a94a1129e04d220dde9719223d2 SRR12690124.sra SRR12690124.sra file validated SRR12690124 is paired end SRR12690124 is conventional basespace SRR12690124 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690124_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.632 37.0 37.0 37.0 37.0 37.0 2 36.33075 37.0 37.0 37.0 37.0 37.0 3 36.6485 37.0 37.0 37.0 37.0 37.0 4 36.626 37.0 37.0 37.0 37.0 37.0 5 36.6375 37.0 37.0 37.0 37.0 37.0 6 36.6195 37.0 37.0 37.0 37.0 37.0 7 36.507 37.0 37.0 37.0 37.0 37.0 8 36.5745 37.0 37.0 37.0 37.0 37.0 9 36.61 37.0 37.0 37.0 37.0 37.0 10-14 36.6115 37.0 37.0 37.0 37.0 37.0 15-19 36.5826 37.0 37.0 37.0 37.0 37.0 20-24 36.5675 37.0 37.0 37.0 37.0 37.0 25-29 36.5567 37.0 37.0 37.0 37.0 37.0 30-34 36.5119 37.0 37.0 37.0 37.0 37.0 35-39 36.4825 37.0 37.0 37.0 37.0 37.0 40-44 36.5012 37.0 37.0 37.0 37.0 37.0 45-49 36.468999999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.46659999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.4168 37.0 37.0 37.0 37.0 37.0 60-64 36.4058 37.0 37.0 37.0 37.0 37.0 65-69 36.3582 37.0 37.0 37.0 37.0 37.0 70-74 36.3667 37.0 37.0 37.0 37.0 37.0 75-79 36.3717 37.0 37.0 37.0 37.0 37.0 80-84 36.3149 37.0 37.0 37.0 37.0 37.0 85-89 36.29019999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.286 37.0 37.0 37.0 37.0 37.0 95-99 36.229 37.0 37.0 37.0 37.0 37.0 100-104 36.1546 37.0 37.0 37.0 37.0 37.0 105-109 36.2297 37.0 37.0 37.0 37.0 37.0 110-114 36.1881 37.0 37.0 37.0 37.0 37.0 115-119 36.1342 37.0 37.0 37.0 37.0 37.0 120-124 36.0846 37.0 37.0 37.0 37.0 37.0 125-129 36.064299999999996 37.0 37.0 37.0 37.0 37.0 130-134 36.02669999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.9802 37.0 37.0 37.0 37.0 37.0 140-144 35.8536 37.0 37.0 37.0 37.0 37.0 145-149 35.7828 37.0 37.0 37.0 37.0 37.0 150-151 35.579 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 1.0 26 5.0 27 8.0 28 9.0 29 12.0 30 17.0 31 31.0 32 45.0 33 72.0 34 117.0 35 296.0 36 3034.0 37 351.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.199999999999996 13.075000000000001 6.800000000000001 37.925 2 19.82953121082978 12.735021308598645 37.35271997994485 30.08272750062672 3 16.975 15.475 27.775 39.775 4 20.8 24.575 24.474999999999998 30.15 5 23.45 28.9 24.975 22.675 6 22.400000000000002 33.25 23.575 20.775 7 15.2 26.3 41.925000000000004 16.575 8 18.05 26.174999999999997 30.349999999999998 25.424999999999997 9 17.375 24.4 34.75 23.474999999999998 10-14 19.615 28.494999999999997 28.225 23.665 15-19 19.96 27.57 28.17 24.3 20-24 20.525 28.244999999999997 28.005000000000003 23.225 25-29 19.98 28.050000000000004 28.64 23.330000000000002 30-34 19.715 27.79 27.92 24.575 35-39 19.900000000000002 28.185 28.050000000000004 23.865 40-44 21.04 27.755000000000003 27.47 23.735 45-49 19.825 28.22 27.875 24.08 50-54 20.22 28.87 27.134999999999998 23.775 55-59 20.150000000000002 28.310000000000002 27.425 24.115000000000002 60-64 20.355 28.335 27.815 23.494999999999997 65-69 20.580000000000002 27.345000000000002 28.205000000000002 23.87 70-74 20.68 28.499999999999996 26.61 24.21 75-79 20.43 27.85 27.694999999999997 24.025 80-84 20.9 27.925 27.36 23.815 85-89 20.76 28.165000000000003 27.089999999999996 23.985 90-94 21.3 27.560000000000002 27.66 23.48 95-99 20.815 27.82 26.77 24.595 100-104 21.055 28.060000000000002 27.534999999999997 23.35 105-109 20.825 27.529999999999998 28.205000000000002 23.44 110-114 21.135 27.855 27.96 23.05 115-119 21.675 27.13 27.735 23.46 120-124 20.990000000000002 27.55 27.345000000000002 24.115000000000002 125-129 20.87 28.060000000000002 27.51 23.56 130-134 21.565 27.750000000000004 27.52 23.165 135-139 21.595 27.500000000000004 27.43 23.474999999999998 140-144 22.065 27.51 26.534999999999997 23.89 145-149 21.29 28.199999999999996 26.889999999999997 23.62 150-151 20.6125 28.4375 27.275 23.674999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 1.0 25 0.5 26 2.0 27 4.5 28 7.5 29 11.0 30 11.5 31 13.0 32 19.0 33 30.0 34 41.5 35 52.5 36 70.0 37 95.5 38 131.0 39 174.5 40 195.0 41 193.5 42 220.0 43 257.0 44 279.0 45 280.5 46 285.5 47 270.5 48 237.0 49 216.0 50 175.0 51 143.0 52 133.0 53 100.0 54 67.5 55 58.0 56 56.0 57 49.0 58 34.5 59 29.0 60 19.0 61 11.5 62 7.5 63 4.5 64 2.5 65 1.0 66 1.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.175 #Duplication Level Percentage of deduplicated Percentage of total 1 92.56848386221861 85.32499999999999 2 6.590724165988608 12.15 3 0.7051803634391104 1.95 4 0.08136696501220504 0.3 5 0.027122321670735017 0.125 6 0.027122321670735017 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCTTTAGCTGACTGCTGATATCCGCTAAAAACAGCTCCCCTTTCTTGA 6 0.15 No Hit GGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.775 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 1.025 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.4125 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.6124999999999998 0.0 0.0 0.0 0.0 122-123 1.8375 0.0 0.0 0.0 0.0 124-125 2.0999999999999996 0.0 0.0 0.0 0.0 126-127 2.4375 0.0 0.0 0.0 0.0 128-129 2.6625 0.0 0.0 0.0 0.0 130-131 3.0374999999999996 0.0 0.0 0.0 0.0 132-133 3.5125 0.0 0.0 0.0 0.0 134-135 3.9125 0.0 0.0 0.0 0.0 136-137 4.275 0.0 0.0 0.0 0.0 138-139 4.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGATCA 10 0.006830828 145.0 4 >>END_MODULE SRR12690124 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690124_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3235 37.0 37.0 37.0 37.0 37.0 2 36.119 37.0 37.0 37.0 37.0 37.0 3 36.0695 37.0 37.0 37.0 37.0 37.0 4 36.28 37.0 37.0 37.0 37.0 37.0 5 36.272 37.0 37.0 37.0 37.0 37.0 6 36.2385 37.0 37.0 37.0 37.0 37.0 7 36.22 37.0 37.0 37.0 37.0 37.0 8 36.3465 37.0 37.0 37.0 37.0 37.0 9 36.3965 37.0 37.0 37.0 37.0 37.0 10-14 36.3193 37.0 37.0 37.0 37.0 37.0 15-19 36.236599999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.3044 37.0 37.0 37.0 37.0 37.0 25-29 36.196 37.0 37.0 37.0 37.0 37.0 30-34 36.1906 37.0 37.0 37.0 37.0 37.0 35-39 36.2247 37.0 37.0 37.0 37.0 37.0 40-44 36.11 37.0 37.0 37.0 37.0 37.0 45-49 36.1186 37.0 37.0 37.0 37.0 37.0 50-54 36.1031 37.0 37.0 37.0 37.0 37.0 55-59 36.1218 37.0 37.0 37.0 37.0 37.0 60-64 36.071600000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.044999999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.9702 37.0 37.0 37.0 37.0 37.0 75-79 35.9718 37.0 37.0 37.0 37.0 37.0 80-84 36.016 37.0 37.0 37.0 37.0 37.0 85-89 35.9936 37.0 37.0 37.0 37.0 37.0 90-94 35.888 37.0 37.0 37.0 37.0 37.0 95-99 35.937400000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.9254 37.0 37.0 37.0 37.0 37.0 105-109 35.9148 37.0 37.0 37.0 37.0 37.0 110-114 35.7812 37.0 37.0 37.0 37.0 37.0 115-119 35.7148 37.0 37.0 37.0 37.0 37.0 120-124 35.7266 37.0 37.0 37.0 37.0 37.0 125-129 35.660399999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.550599999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.444 37.0 37.0 37.0 37.0 37.0 140-144 35.4602 37.0 37.0 37.0 37.0 37.0 145-149 35.412099999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.013000000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 1.0 15 1.0 16 2.0 17 0.0 18 0.0 19 0.0 20 2.0 21 4.0 22 3.0 23 6.0 24 3.0 25 4.0 26 4.0 27 14.0 28 12.0 29 17.0 30 33.0 31 39.0 32 62.0 33 103.0 34 170.0 35 540.0 36 2699.0 37 278.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.05 24.075 10.375 28.499999999999996 2 27.05 28.549999999999997 29.225 15.174999999999999 3 19.425 28.349999999999998 32.025 20.200000000000003 4 24.275 33.324999999999996 23.375 19.025 5 23.9 37.8 20.75 17.549999999999997 6 20.525 40.825 21.7 16.950000000000003 7 21.125 21.625 37.6 19.650000000000002 8 20.549999999999997 27.950000000000003 28.799999999999997 22.7 9 22.475 23.375 30.599999999999998 23.549999999999997 10-14 22.009999999999998 29.57 26.46 21.959999999999997 15-19 22.91 28.634999999999998 27.43 21.025 20-24 22.305 28.53 27.555000000000003 21.61 25-29 22.54 28.895 27.42 21.145 30-34 22.79 27.79 27.825 21.595 35-39 22.165000000000003 27.87 27.975 21.990000000000002 40-44 22.755 28.83 27.46 20.955 45-49 22.505 27.345000000000002 28.02 22.13 50-54 23.22 28.134999999999998 26.93 21.715 55-59 23.225 27.884999999999998 27.575 21.315 60-64 22.915 28.375 26.889999999999997 21.82 65-69 23.015 28.23 27.365000000000002 21.39 70-74 22.59 28.115000000000002 27.315 21.98 75-79 22.91 27.950000000000003 27.41 21.73 80-84 22.705000000000002 28.055000000000003 27.485 21.755 85-89 23.07 28.615000000000002 27.075 21.240000000000002 90-94 23.225 27.400000000000002 27.865000000000002 21.51 95-99 23.599999999999998 28.595 27.11 20.695 100-104 24.03 28.575 26.595000000000002 20.8 105-109 23.25 28.175 27.71 20.865000000000002 110-114 23.47 28.28 27.384999999999998 20.865000000000002 115-119 24.375 27.92 27.04 20.665 120-124 23.990000000000002 27.71 27.255000000000003 21.044999999999998 125-129 24.205 27.79 27.35 20.655 130-134 24.505 28.255000000000003 26.625 20.615 135-139 24.435000000000002 28.175 26.369999999999997 21.02 140-144 24.654999999999998 28.285 26.490000000000002 20.57 145-149 25.130000000000003 27.97 26.534999999999997 20.365 150-151 24.9 27.3875 28.175 19.537499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.5 20 1.0 21 0.5 22 1.5 23 3.0 24 2.0 25 2.0 26 5.5 27 6.0 28 9.5 29 11.0 30 12.0 31 16.5 32 24.0 33 41.5 34 54.5 35 59.0 36 75.5 37 110.5 38 136.5 39 158.5 40 197.0 41 223.0 42 250.0 43 263.5 44 274.5 45 285.5 46 261.5 47 259.0 48 235.0 49 187.0 50 147.0 51 131.0 52 114.0 53 84.0 54 83.5 55 65.0 56 48.0 57 39.5 58 23.0 59 20.0 60 21.5 61 15.0 62 11.0 63 8.0 64 3.0 65 1.0 66 1.5 67 2.5 68 1.5 69 1.0 70 1.0 71 0.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 1.0 95 1.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.025 #Duplication Level Percentage of deduplicated Percentage of total 1 92.31187177397446 84.95 2 6.845965770171149 12.6 3 0.7606628633523499 2.1 4 0.05433306166802499 0.2 5 0.0 0.0 6 0.027166530834012496 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCAAAAGCTCTCTCCTTTTTGTGGTTTCCTTGATTACCGTTTATTCGAA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.775 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 1.025 0.0 0.0 0.0 0.0 114-115 1.15 0.0 0.0 0.0 0.0 116-117 1.3875 0.0 0.0 0.0 0.0 118-119 1.5125 0.0 0.0 0.0 0.0 120-121 1.5875 0.0 0.0 0.0 0.0 122-123 1.7875 0.0 0.0 0.0 0.0 124-125 2.05 0.0 0.0 0.0 0.0 126-127 2.3875 0.0 0.0 0.0 0.0 128-129 2.6125 0.0 0.0 0.0 0.0 130-131 2.9875 0.0 0.0 0.0 0.0 132-133 3.45 0.0 0.0 0.0 0.0 134-135 3.8375 0.0 0.0 0.0 0.0 136-137 4.2 0.0 0.0 0.0 0.0 138-139 4.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 627796 spots for SRR12690124.sra Written 627796 spots for SRR12690124.sra Read 627796 spots for SRR12690124.sra Written 627796 spots for SRR12690124.sra Read 627796 spots for SRR12690124.sra Written 627796 spots for SRR12690124.sra Read 627796 spots for SRR12690124.sra Written 627796 spots for SRR12690124.sra Read 627796 spots for SRR12690124.sra Written 627796 spots for SRR12690124.sra Read 627796 spots for SRR12690124.sra Written 627796 spots for SRR12690124.sra Read 627796 spots for SRR12690124.sra Written 627796 spots for SRR12690124.sra Read 627796 spots for SRR12690124.sra Written 627796 spots for SRR12690124.sra Read 627796 spots for SRR12690124.sra Written 627796 spots for SRR12690124.sra Read 627796 spots for SRR12690124.sra Written 627796 spots for SRR12690124.sra Read 627796 spots for SRR12690124.sra Written 627796 spots for SRR12690124.sra Read 627796 spots for SRR12690124.sra Written 627796 spots for SRR12690124.sra Read 627796 spots for SRR12690124.sra Written 627796 spots for SRR12690124.sra Read 627796 spots for SRR12690124.sra Written 627796 spots for SRR12690124.sra Read 627796 spots for SRR12690124.sra Written 627796 spots for SRR12690124.sra Read 627796 spots for SRR12690124.sra Written 627796 spots for SRR12690124.sra Read 627796 spots for SRR12690124.sra Written 627796 spots for SRR12690124.sra Read 627796 spots for SRR12690124.sra Written 627796 spots for SRR12690124.sra Read 627796 spots for SRR12690124.sra Written 627796 spots for SRR12690124.sra Read 627808 spots for SRR12690124.sra Written 627808 spots for SRR12690124.sra SRR ids: ['SRR12690124.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ey9lrrkd SRR12690124.sra spots: 12555932 blocks: [[1, 627796], [627797, 1255592], [1255593, 1883388], [1883389, 2511184], [2511185, 3138980], [3138981, 3766776], [3766777, 4394572], [4394573, 5022368], [5022369, 5650164], [5650165, 6277960], [6277961, 6905756], [6905757, 7533552], [7533553, 8161348], [8161349, 8789144], [8789145, 9416940], [9416941, 10044736], [10044737, 10672532], [10672533, 11300328], [11300329, 11928124], [11928125, 12555932]] SRR12690124 file size 4245354 SRR12690124 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690124 SRR12690124_1.fastq SRR12690124_2.fastq Input file: SRR12690124_1.fastq Paired file: SRR12690124_2.fastq trimmed: SRR12690124-trimmed-pair1.fastq, SRR12690124-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:49:42 2025 >> started Mon Feb 10 17:49:57 2025 >> done (14.720s) 12555932 read pairs processed; of these: 31 ( 0.00%) short read pairs filtered out after trimming by size control 2390 ( 0.02%) empty read pairs filtered out after trimming by size control 12553511 (99.98%) read pairs available; of these: 1006889 ( 8.02%) trimmed read pairs available after processing 11546622 (91.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 2 0.00% 21 5 0.00% 22 6 0.00% 23 10 0.00% 24 12 0.00% 25 9 0.00% 26 18 0.00% 27 17 0.00% 28 16 0.00% 29 13 0.00% 30 20 0.00% 31 15 0.00% 32 16 0.00% 33 18 0.00% 34 20 0.00% 35 10 0.00% 36 18 0.00% 37 26 0.00% 38 23 0.00% 39 19 0.00% 40 21 0.00% 41 27 0.00% 42 18 0.00% 43 31 0.00% 44 28 0.00% 45 29 0.00% 46 35 0.00% 47 41 0.00% 48 38 0.00% 49 45 0.00% 50 65 0.00% 51 69 0.00% 52 79 0.00% 53 63 0.00% 54 63 0.00% 55 94 0.00% 56 86 0.00% 57 81 0.00% 58 112 0.00% 59 112 0.00% 60 161 0.00% 61 161 0.00% 62 163 0.00% 63 194 0.00% 64 213 0.00% 65 242 0.00% 66 280 0.00% 67 291 0.00% 68 300 0.00% 69 348 0.00% 70 338 0.00% 71 510 0.00% 72 540 0.00% 73 580 0.00% 74 672 0.01% 75 731 0.01% 76 742 0.01% 77 827 0.01% 78 973 0.01% 79 1069 0.01% 80 1162 0.01% 81 1326 0.01% 82 1551 0.01% 83 1582 0.01% 84 1849 0.01% 85 2036 0.02% 86 2154 0.02% 87 2403 0.02% 88 2472 0.02% 89 2704 0.02% 90 2972 0.02% 91 3113 0.02% 92 3365 0.03% 93 3866 0.03% 94 4085 0.03% 95 4329 0.03% 96 4610 0.04% 97 4835 0.04% 98 5312 0.04% 99 5370 0.04% 100 5800 0.05% 101 6024 0.05% 102 6599 0.05% 103 6968 0.06% 104 7204 0.06% 105 7708 0.06% 106 7945 0.06% 107 8396 0.07% 108 8717 0.07% 109 9083 0.07% 110 9381 0.07% 111 9768 0.08% 112 10632 0.08% 113 10653 0.08% 114 11394 0.09% 115 11881 0.09% 116 12159 0.10% 117 12777 0.10% 118 13231 0.11% 119 13652 0.11% 120 14477 0.12% 121 14841 0.12% 122 15424 0.12% 123 16171 0.13% 124 16724 0.13% 125 17061 0.14% 126 18010 0.14% 127 18375 0.15% 128 19204 0.15% 129 19854 0.16% 130 20412 0.16% 131 21158 0.17% 132 21837 0.17% 133 22205 0.18% 134 22726 0.18% 135 23562 0.19% 136 24280 0.19% 137 24840 0.20% 138 25574 0.20% 139 26689 0.21% 140 26875 0.21% 141 27853 0.22% 142 28685 0.23% 143 29794 0.24% 144 30663 0.24% 145 31028 0.25% 146 32045 0.26% 147 32847 0.26% 148 33243 0.26% 149 33618 0.27% 150 34976 0.28% 151 11546622 91.98% 12553511 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=18 prefix-density=0.65 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=20 fanout-score=10.94 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=5.7 sequence=CCATCCACATTAGCACCATATTTGTCGACATATTGGTACAC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=19 prefix-density=0.87 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=11.02 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=1.0 sequence=GCTACACAGAGAACACATTCATAC SRR12690124 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:51:04 Started mapping on | Feb 10 17:51:04 Finished on | Feb 10 17:52:21 Mapping speed, Million of reads per hour | 586.92 Number of input reads | 12553511 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 11819866 Uniquely mapped reads % | 94.16% Average mapped length | 297.36 Number of splices: Total | 11958832 Number of splices: Annotated (sjdb) | 11710065 Number of splices: GT/AG | 11714330 Number of splices: GC/AG | 198703 Number of splices: AT/AC | 7136 Number of splices: Non-canonical | 38663 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 284056 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 96195 % of reads mapped to too many loci | 0.77% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.64% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 449589 449589 449589 N_multimapping 284056 284056 284056 N_noFeature 456704 11666925 502235 N_ambiguous 177399 741 69529 UnstrandedReadsAssigned:11185763 PositiveStrandReadsAssigned:152200 NegativeStrandReadsAssigned:11248102 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690124 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690124-trimmed-pair1.fastq SRR12690124-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,553,511 reads, 11,286,709 reads pseudoaligned [quant] estimated average fragment length: 259.516 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,004 rounds 52401 SRR12690124.ke.tsv 34699 SRR12690124.se.tsv 87100 total ==> SRR12690124.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.48 280 12.5871 Potri.005G024800.1.v4.1 1035 776.484 178 18.1318 Potri.004G059700.1.v4.1 961 702.627 6 0.675428 Potri.007G009000.2.v4.1 1416 1157.48 0 0 Potri.003G141000.2.v4.1 2943 2684.48 640.583 18.8741 Potri.016G087400.1.v4.1 270 77.4454 479 489.207 Potri.015G069301.1.v4.1 564 318.446 0 0 Potri.010G195200.1.v4.1 1773 1514.48 15 0.783392 Potri.012G127500.1.v4.1 977 718.575 86 9.46628 ==> SRR12690124.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 53 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 168 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12690124 completed mapping pipeline successfully