Starting /dee2/code/volunteer_pipeline.sh SRR12690125 current disk space = 3058475667456 free memory = 1058027316 SRR12690125 SRAfilesize 8f84ce36b680a359f2f6dac8c98faa7c SRR12690125.sra SRR12690125.sra file validated SRR12690125 is paired end SRR12690125 is conventional basespace SRR12690125 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690125_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6045 37.0 37.0 37.0 37.0 37.0 2 36.43475 37.0 37.0 37.0 37.0 37.0 3 36.565 37.0 37.0 37.0 37.0 37.0 4 36.624 37.0 37.0 37.0 37.0 37.0 5 36.6125 37.0 37.0 37.0 37.0 37.0 6 36.644 37.0 37.0 37.0 37.0 37.0 7 36.5025 37.0 37.0 37.0 37.0 37.0 8 36.626 37.0 37.0 37.0 37.0 37.0 9 36.6975 37.0 37.0 37.0 37.0 37.0 10-14 36.608599999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5889 37.0 37.0 37.0 37.0 37.0 20-24 36.6086 37.0 37.0 37.0 37.0 37.0 25-29 36.5091 37.0 37.0 37.0 37.0 37.0 30-34 36.50750000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.5219 37.0 37.0 37.0 37.0 37.0 40-44 36.4885 37.0 37.0 37.0 37.0 37.0 45-49 36.4473 37.0 37.0 37.0 37.0 37.0 50-54 36.395799999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.3734 37.0 37.0 37.0 37.0 37.0 60-64 36.375099999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.339999999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.333800000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.376099999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.3297 37.0 37.0 37.0 37.0 37.0 85-89 36.2856 37.0 37.0 37.0 37.0 37.0 90-94 36.242200000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.2067 37.0 37.0 37.0 37.0 37.0 100-104 36.1602 37.0 37.0 37.0 37.0 37.0 105-109 36.137100000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.1392 37.0 37.0 37.0 37.0 37.0 115-119 36.0802 37.0 37.0 37.0 37.0 37.0 120-124 36.0122 37.0 37.0 37.0 37.0 37.0 125-129 36.048 37.0 37.0 37.0 37.0 37.0 130-134 35.957 37.0 37.0 37.0 37.0 37.0 135-139 35.9512 37.0 37.0 37.0 37.0 37.0 140-144 35.838499999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.8295 37.0 37.0 37.0 37.0 37.0 150-151 35.655249999999995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 0.0 23 1.0 24 2.0 25 0.0 26 3.0 27 7.0 28 15.0 29 21.0 30 22.0 31 33.0 32 45.0 33 73.0 34 97.0 35 286.0 36 3000.0 37 393.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.275 11.675 6.65 37.4 2 19.318466549736907 13.455274367326483 35.55499874718116 31.671260335755452 3 16.025 15.925 29.9 38.15 4 21.7 24.05 23.125 31.125000000000004 5 21.95 31.8 23.575 22.675 6 18.525 35.3 23.625 22.55 7 16.075 28.050000000000004 38.65 17.224999999999998 8 17.75 27.3 31.05 23.9 9 17.525 24.275 35.275 22.925 10-14 19.45 29.015 28.465 23.07 15-19 20.064999999999998 27.575 28.115000000000002 24.245 20-24 20.14 28.815 27.715 23.330000000000002 25-29 20.080000000000002 28.720000000000002 27.62 23.580000000000002 30-34 20.175 28.244999999999997 28.28 23.3 35-39 20.025000000000002 27.79 28.470000000000002 23.715 40-44 20.53 28.48 27.92 23.07 45-49 19.98 28.335 27.584999999999997 24.099999999999998 50-54 20.215 28.754999999999995 27.55 23.48 55-59 20.1 28.49 27.455000000000002 23.955000000000002 60-64 20.275000000000002 28.12 27.744999999999997 23.86 65-69 20.375 28.87 27.405 23.35 70-74 20.064999999999998 28.84 27.455000000000002 23.64 75-79 20.085 28.7 27.725 23.49 80-84 21.23 28.29 27.339999999999996 23.14 85-89 20.72 28.875 27.229999999999997 23.175 90-94 20.47 28.7 27.445000000000004 23.385 95-99 20.59 27.860000000000003 27.905 23.645 100-104 20.815 27.97 27.810000000000002 23.405 105-109 20.925 27.810000000000002 27.715 23.549999999999997 110-114 20.375 28.435 27.575 23.615 115-119 20.64 28.655 27.529999999999998 23.175 120-124 20.665 28.13 27.675 23.53 125-129 20.575 28.9 27.265 23.26 130-134 21.3 28.044999999999998 27.08 23.575 135-139 21.195 28.395 27.07 23.34 140-144 21.47 27.650000000000002 27.325 23.555 145-149 20.835 28.560000000000002 26.924999999999997 23.68 150-151 20.625 27.8875 27.700000000000003 23.7875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 2.0 24 3.0 25 5.5 26 7.5 27 7.5 28 11.0 29 14.0 30 17.5 31 25.5 32 29.5 33 37.5 34 54.5 35 66.5 36 83.0 37 114.5 38 128.5 39 138.0 40 179.5 41 214.5 42 217.5 43 255.0 44 287.5 45 273.5 46 251.5 47 239.5 48 244.0 49 231.5 50 195.0 51 151.5 52 122.5 53 99.0 54 69.0 55 51.5 56 38.5 57 29.5 58 30.0 59 20.0 60 14.5 61 11.5 62 6.5 63 5.5 64 3.5 65 3.0 66 2.0 67 0.5 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.75 #Duplication Level Percentage of deduplicated Percentage of total 1 90.82644628099173 82.425 2 8.292011019283747 15.049999999999999 3 0.743801652892562 2.025 4 0.13774104683195593 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0125 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0125 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.025 0.0 0.0 0.025 0.0 68-69 0.0625 0.0 0.0 0.025 0.0 70-71 0.075 0.0 0.0 0.025 0.0 72-73 0.075 0.0 0.0 0.025 0.0 74-75 0.1 0.0 0.0 0.025 0.0 76-77 0.1 0.0 0.0 0.025 0.0 78-79 0.1 0.0 0.0 0.025 0.0 80-81 0.1 0.0 0.0 0.025 0.0 82-83 0.15 0.0 0.0 0.025 0.0 84-85 0.16249999999999998 0.0 0.0 0.025 0.0 86-87 0.2625 0.0 0.0 0.025 0.0 88-89 0.3 0.0 0.0 0.025 0.0 90-91 0.3375 0.0 0.0 0.025 0.0 92-93 0.375 0.0 0.0 0.025 0.0 94-95 0.44999999999999996 0.0 0.0 0.025 0.0 96-97 0.55 0.0 0.0 0.025 0.0 98-99 0.675 0.0 0.0 0.025 0.0 100-101 0.825 0.0 0.0 0.025 0.0 102-103 0.9125000000000001 0.0 0.0 0.025 0.0 104-105 1.0375 0.0 0.0 0.025 0.0 106-107 1.2 0.0 0.0 0.025 0.0 108-109 1.3624999999999998 0.0 0.0 0.025 0.0 110-111 1.6125 0.0 0.0 0.025 0.0 112-113 2.1 0.0 0.0 0.025 0.0 114-115 2.4375 0.0 0.0 0.025 0.0 116-117 2.7625 0.0 0.0 0.025 0.0 118-119 3.0625 0.0 0.0 0.025 0.0 120-121 3.375 0.0 0.0 0.025 0.0 122-123 3.725 0.0 0.0 0.025 0.0 124-125 4.0625 0.0 0.0 0.025 0.0 126-127 4.35 0.0 0.0 0.025 0.0 128-129 4.75 0.0 0.0 0.025 0.0 130-131 5.2125 0.0 0.0 0.025 0.0 132-133 5.65 0.0 0.0 0.025 0.0 134-135 6.0875 0.0 0.0 0.025 0.0 136-137 6.6 0.0 0.0 0.025 0.0 138-139 7.2875 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAAGGT 10 0.006830828 145.0 2 CAGCTTG 10 0.006830828 145.0 9 >>END_MODULE SRR12690125 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690125_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3205 37.0 37.0 37.0 37.0 37.0 2 36.1335 37.0 37.0 37.0 37.0 37.0 3 36.254 37.0 37.0 37.0 37.0 37.0 4 36.2555 37.0 37.0 37.0 37.0 37.0 5 36.3195 37.0 37.0 37.0 37.0 37.0 6 36.332 37.0 37.0 37.0 37.0 37.0 7 36.353 37.0 37.0 37.0 37.0 37.0 8 36.2815 37.0 37.0 37.0 37.0 37.0 9 36.3425 37.0 37.0 37.0 37.0 37.0 10-14 36.2685 37.0 37.0 37.0 37.0 37.0 15-19 36.258799999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.2731 37.0 37.0 37.0 37.0 37.0 25-29 36.2087 37.0 37.0 37.0 37.0 37.0 30-34 36.1687 37.0 37.0 37.0 37.0 37.0 35-39 36.164500000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.1322 37.0 37.0 37.0 37.0 37.0 45-49 36.1293 37.0 37.0 37.0 37.0 37.0 50-54 36.0802 37.0 37.0 37.0 37.0 37.0 55-59 35.990899999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.0316 37.0 37.0 37.0 37.0 37.0 65-69 35.971000000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.952200000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.9496 37.0 37.0 37.0 37.0 37.0 80-84 35.9587 37.0 37.0 37.0 37.0 37.0 85-89 35.9227 37.0 37.0 37.0 37.0 37.0 90-94 35.7684 37.0 37.0 37.0 37.0 37.0 95-99 35.8289 37.0 37.0 37.0 37.0 37.0 100-104 35.8619 37.0 37.0 37.0 37.0 37.0 105-109 35.840599999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.7907 37.0 37.0 37.0 37.0 37.0 115-119 35.755399999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.681799999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.5888 37.0 37.0 37.0 37.0 37.0 130-134 35.4899 37.0 37.0 37.0 37.0 37.0 135-139 35.4505 37.0 37.0 37.0 37.0 37.0 140-144 35.4695 37.0 37.0 37.0 37.0 37.0 145-149 35.2667 37.0 37.0 37.0 32.2 37.0 150-151 34.789 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 5.0 14 7.0 15 1.0 16 1.0 17 1.0 18 1.0 19 1.0 20 1.0 21 1.0 22 3.0 23 5.0 24 6.0 25 8.0 26 12.0 27 12.0 28 14.0 29 22.0 30 23.0 31 35.0 32 50.0 33 88.0 34 151.0 35 522.0 36 2738.0 37 289.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.475 25.05 10.8 24.675 2 27.55 27.250000000000004 29.5 15.7 3 21.025 26.674999999999997 32.775 19.525000000000002 4 23.849999999999998 33.5 23.9 18.75 5 24.55 37.375 22.075 16.0 6 19.8 38.75 23.175 18.275 7 21.025 22.475 37.9 18.6 8 21.425 26.8 29.25 22.525000000000002 9 22.95 24.675 29.925 22.45 10-14 23.22 29.54 26.615 20.625 15-19 22.040000000000003 28.549999999999997 27.534999999999997 21.875 20-24 22.725 28.335 27.650000000000002 21.29 25-29 22.175 28.26 28.325 21.240000000000002 30-34 22.395 27.97 29.005 20.630000000000003 35-39 22.5 28.315 28.055000000000003 21.13 40-44 22.1 28.084999999999997 29.044999999999998 20.77 45-49 22.61 27.705000000000002 28.24 21.445 50-54 22.509999999999998 28.384999999999998 27.915 21.19 55-59 22.5 28.444999999999997 28.060000000000002 20.995 60-64 22.645 27.83 28.465 21.060000000000002 65-69 23.195 27.865000000000002 28.205000000000002 20.735 70-74 22.58 28.24 28.435 20.745 75-79 23.189999999999998 27.439999999999998 27.91 21.46 80-84 22.715 28.665000000000003 27.775 20.845 85-89 23.535 28.27 27.560000000000002 20.635 90-94 23.150000000000002 28.07 27.955000000000002 20.825 95-99 23.119999999999997 27.79 28.105000000000004 20.985 100-104 23.599999999999998 27.810000000000002 28.110000000000003 20.48 105-109 23.25 28.1 27.905 20.745 110-114 23.919999999999998 28.16 27.175 20.745 115-119 24.005000000000003 28.365000000000002 27.255000000000003 20.375 120-124 24.025 28.62 27.145000000000003 20.21 125-129 23.97 27.810000000000002 27.35 20.87 130-134 24.529999999999998 27.67 27.474999999999998 20.325 135-139 24.42 28.18 27.605 19.794999999999998 140-144 25.81 27.615000000000002 26.810000000000002 19.765 145-149 25.4 28.13 26.625 19.845 150-151 25.662499999999998 27.675 26.4125 20.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.5 6 1.5 7 1.5 8 0.5 9 0.5 10 0.5 11 0.5 12 1.0 13 2.0 14 2.0 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 0.5 23 2.0 24 3.0 25 2.5 26 5.0 27 7.5 28 12.5 29 15.0 30 17.0 31 28.5 32 34.5 33 43.5 34 64.5 35 83.0 36 94.5 37 119.5 38 152.0 39 167.0 40 181.5 41 218.5 42 247.5 43 257.0 44 263.5 45 260.5 46 277.0 47 269.5 48 222.0 49 177.5 50 146.5 51 117.0 52 94.5 53 90.5 54 84.0 55 63.5 56 39.5 57 29.5 58 20.5 59 20.5 60 17.0 61 7.0 62 7.0 63 6.0 64 3.0 65 2.5 66 1.5 67 0.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.45 #Duplication Level Percentage of deduplicated Percentage of total 1 90.85129906025429 82.175 2 8.098396904367053 14.649999999999999 3 0.7739082365948038 2.1 4 0.22111663902708678 0.8 5 0.027639579878385848 0.125 6 0.027639579878385848 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit AAACTCTGCATTTGCTAGCTAGAAGTCACTCTACCCTTCGCATTACTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.7250000000000001 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 0.9624999999999999 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.4125 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 2.125 0.0 0.0 0.0 0.0 114-115 2.4625000000000004 0.0 0.0125 0.0 0.0 116-117 2.7874999999999996 0.0 0.025 0.0 0.0 118-119 3.0875000000000004 0.0 0.025 0.0 0.0 120-121 3.4000000000000004 0.0 0.025 0.0 0.0 122-123 3.75 0.0 0.025 0.0 0.0 124-125 4.0625 0.0 0.025 0.0 0.0 126-127 4.325 0.0 0.025 0.0 0.0 128-129 4.75 0.0 0.025 0.0 0.0 130-131 5.2375 0.0 0.025 0.0 0.0 132-133 5.725 0.0 0.025 0.0 0.0 134-135 6.1625 0.0 0.025 0.0 0.0 136-137 6.675 0.0 0.025 0.0 0.0 138-139 7.387499999999999 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATGAAT 10 0.006830828 145.0 9 >>END_MODULE Read 685028 spots for SRR12690125.sra Written 685028 spots for SRR12690125.sra Read 685028 spots for SRR12690125.sra Written 685028 spots for SRR12690125.sra Read 685028 spots for SRR12690125.sra Written 685028 spots for SRR12690125.sra Read 685028 spots for SRR12690125.sra Written 685028 spots for SRR12690125.sra Read 685028 spots for SRR12690125.sra Written 685028 spots for SRR12690125.sra Read 685028 spots for SRR12690125.sra Written 685028 spots for SRR12690125.sra Read 685028 spots for SRR12690125.sra Written 685028 spots for SRR12690125.sra Read 685028 spots for SRR12690125.sra Written 685028 spots for SRR12690125.sra Read 685028 spots for SRR12690125.sra Written 685028 spots for SRR12690125.sra Read 685028 spots for SRR12690125.sra Written 685028 spots for SRR12690125.sra Read 685028 spots for SRR12690125.sra Written 685028 spots for SRR12690125.sra Read 685028 spots for SRR12690125.sra Written 685028 spots for SRR12690125.sra Read 685028 spots for SRR12690125.sra Written 685028 spots for SRR12690125.sra Read 685028 spots for SRR12690125.sra Written 685028 spots for SRR12690125.sra Read 685028 spots for SRR12690125.sra Written 685028 spots for SRR12690125.sra Read 685028 spots for SRR12690125.sra Written 685028 spots for SRR12690125.sra Read 685028 spots for SRR12690125.sra Written 685028 spots for SRR12690125.sra Read 685039 spots for SRR12690125.sra Written 685039 spots for SRR12690125.sra Read 685028 spots for SRR12690125.sra Written 685028 spots for SRR12690125.sra Read 685028 spots for SRR12690125.sra Written 685028 spots for SRR12690125.sra SRR ids: ['SRR12690125.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_476d48n9 SRR12690125.sra spots: 13700571 blocks: [[1, 685028], [685029, 1370056], [1370057, 2055084], [2055085, 2740112], [2740113, 3425140], [3425141, 4110168], [4110169, 4795196], [4795197, 5480224], [5480225, 6165252], [6165253, 6850280], [6850281, 7535308], [7535309, 8220336], [8220337, 8905364], [8905365, 9590392], [9590393, 10275420], [10275421, 10960448], [10960449, 11645476], [11645477, 12330504], [12330505, 13015532], [13015533, 13700571]] SRR12690125 file size 4634353 SRR12690125 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690125 SRR12690125_1.fastq SRR12690125_2.fastq Input file: SRR12690125_1.fastq Paired file: SRR12690125_2.fastq trimmed: SRR12690125-trimmed-pair1.fastq, SRR12690125-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:38:54 2025 >> started Mon Feb 10 16:39:09 2025 >> done (15.124s) 13700571 read pairs processed; of these: 31 ( 0.00%) short read pairs filtered out after trimming by size control 3002 ( 0.02%) empty read pairs filtered out after trimming by size control 13697538 (99.98%) read pairs available; of these: 1464096 (10.69%) trimmed read pairs available after processing 12233442 (89.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 6 0.00% 21 3 0.00% 22 6 0.00% 23 9 0.00% 24 13 0.00% 25 17 0.00% 26 15 0.00% 27 12 0.00% 28 10 0.00% 29 16 0.00% 30 15 0.00% 31 13 0.00% 32 11 0.00% 33 10 0.00% 34 16 0.00% 35 7 0.00% 36 18 0.00% 37 18 0.00% 38 23 0.00% 39 18 0.00% 40 18 0.00% 41 20 0.00% 42 21 0.00% 43 29 0.00% 44 26 0.00% 45 28 0.00% 46 31 0.00% 47 41 0.00% 48 48 0.00% 49 50 0.00% 50 61 0.00% 51 53 0.00% 52 80 0.00% 53 65 0.00% 54 75 0.00% 55 84 0.00% 56 91 0.00% 57 97 0.00% 58 114 0.00% 59 130 0.00% 60 167 0.00% 61 174 0.00% 62 234 0.00% 63 237 0.00% 64 255 0.00% 65 262 0.00% 66 304 0.00% 67 359 0.00% 68 444 0.00% 69 497 0.00% 70 496 0.00% 71 661 0.00% 72 750 0.01% 73 866 0.01% 74 954 0.01% 75 1015 0.01% 76 1108 0.01% 77 1265 0.01% 78 1359 0.01% 79 1520 0.01% 80 1689 0.01% 81 1950 0.01% 82 2221 0.02% 83 2341 0.02% 84 2695 0.02% 85 2948 0.02% 86 3257 0.02% 87 3489 0.03% 88 3861 0.03% 89 4155 0.03% 90 4487 0.03% 91 4885 0.04% 92 5248 0.04% 93 5871 0.04% 94 6287 0.05% 95 6730 0.05% 96 7129 0.05% 97 7631 0.06% 98 8176 0.06% 99 8583 0.06% 100 9195 0.07% 101 9425 0.07% 102 10086 0.07% 103 10784 0.08% 104 11457 0.08% 105 11866 0.09% 106 12590 0.09% 107 13362 0.10% 108 13781 0.10% 109 14274 0.10% 110 14629 0.11% 111 15750 0.11% 112 16548 0.12% 113 16774 0.12% 114 17847 0.13% 115 18419 0.13% 116 19115 0.14% 117 19837 0.14% 118 20688 0.15% 119 21243 0.16% 120 22184 0.16% 121 22677 0.17% 122 23534 0.17% 123 24440 0.18% 124 25572 0.19% 125 25754 0.19% 126 26901 0.20% 127 27517 0.20% 128 28497 0.21% 129 29092 0.21% 130 29422 0.21% 131 30703 0.22% 132 31298 0.23% 133 32714 0.24% 134 33036 0.24% 135 33888 0.25% 136 34956 0.26% 137 35697 0.26% 138 36478 0.27% 139 37574 0.27% 140 37895 0.28% 141 38445 0.28% 142 40017 0.29% 143 40934 0.30% 144 41725 0.30% 145 42747 0.31% 146 43460 0.32% 147 44657 0.33% 148 44938 0.33% 149 45406 0.33% 150 46282 0.34% 151 12233442 89.31% 13697538 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=22 prefix-density=0.64 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.10 sequence-density-rank=25 fanout-score=9.70 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=3.7 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=21 prefix-density=0.87 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=56.29 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=5.9 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACC SRR12690125 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:39:58 Started mapping on | Feb 10 16:39:59 Finished on | Feb 10 16:41:25 Mapping speed, Million of reads per hour | 573.39 Number of input reads | 13697538 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12947832 Uniquely mapped reads % | 94.53% Average mapped length | 295.92 Number of splices: Total | 12965105 Number of splices: Annotated (sjdb) | 12669714 Number of splices: GT/AG | 12696247 Number of splices: GC/AG | 213815 Number of splices: AT/AC | 8209 Number of splices: Non-canonical | 46834 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 3.01 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 326276 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 51617 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.57% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 423430 423430 423430 N_multimapping 326276 326276 326276 N_noFeature 505463 12788165 556509 N_ambiguous 194229 616 85264 UnstrandedReadsAssigned:12248140 PositiveStrandReadsAssigned:159051 NegativeStrandReadsAssigned:12306059 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690125 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690125-trimmed-pair1.fastq SRR12690125-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,697,538 reads, 12,318,206 reads pseudoaligned [quant] estimated average fragment length: 248.522 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR12690125.ke.tsv 34699 SRR12690125.se.tsv 87100 total ==> SRR12690125.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.48 331 13.8025 Potri.005G024800.1.v4.1 1035 787.478 170 15.9379 Potri.004G059700.1.v4.1 961 713.568 31 3.20736 Potri.007G009000.2.v4.1 1416 1168.48 0 0 Potri.003G141000.2.v4.1 2943 2695.48 607 16.6255 Potri.016G087400.1.v4.1 270 83.5362 491 433.938 Potri.015G069301.1.v4.1 564 326.309 0 0 Potri.010G195200.1.v4.1 1773 1525.48 7 0.338776 Potri.012G127500.1.v4.1 977 729.504 190 19.2286 ==> SRR12690125.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 412 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 153 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 9 SRR12690125 completed mapping pipeline successfully