Starting /dee2/code/volunteer_pipeline.sh SRR12690126 current disk space = 3058305167360 free memory = 1161900680 SRR12690126 SRAfilesize c9e5b03ba58bc3e4e2577fc10b053eca SRR12690126.sra SRR12690126.sra file validated SRR12690126 is paired end SRR12690126 is conventional basespace SRR12690126 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690126_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6845 37.0 37.0 37.0 37.0 37.0 2 36.421 37.0 37.0 37.0 37.0 37.0 3 36.6235 37.0 37.0 37.0 37.0 37.0 4 36.5475 37.0 37.0 37.0 37.0 37.0 5 36.5945 37.0 37.0 37.0 37.0 37.0 6 36.6565 37.0 37.0 37.0 37.0 37.0 7 36.601 37.0 37.0 37.0 37.0 37.0 8 36.548 37.0 37.0 37.0 37.0 37.0 9 36.6445 37.0 37.0 37.0 37.0 37.0 10-14 36.64 37.0 37.0 37.0 37.0 37.0 15-19 36.602 37.0 37.0 37.0 37.0 37.0 20-24 36.5937 37.0 37.0 37.0 37.0 37.0 25-29 36.5304 37.0 37.0 37.0 37.0 37.0 30-34 36.52040000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.48909999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.4945 37.0 37.0 37.0 37.0 37.0 45-49 36.450100000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.4367 37.0 37.0 37.0 37.0 37.0 55-59 36.390699999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.4199 37.0 37.0 37.0 37.0 37.0 65-69 36.366499999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.3421 37.0 37.0 37.0 37.0 37.0 75-79 36.3352 37.0 37.0 37.0 37.0 37.0 80-84 36.3221 37.0 37.0 37.0 37.0 37.0 85-89 36.2867 37.0 37.0 37.0 37.0 37.0 90-94 36.3043 37.0 37.0 37.0 37.0 37.0 95-99 36.224399999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.1574 37.0 37.0 37.0 37.0 37.0 105-109 36.161100000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.1207 37.0 37.0 37.0 37.0 37.0 115-119 36.1309 37.0 37.0 37.0 37.0 37.0 120-124 35.9864 37.0 37.0 37.0 37.0 37.0 125-129 36.0507 37.0 37.0 37.0 37.0 37.0 130-134 36.064 37.0 37.0 37.0 37.0 37.0 135-139 35.96939999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.7907 37.0 37.0 37.0 37.0 37.0 145-149 35.723699999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.521 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 1.0 23 2.0 24 0.0 25 5.0 26 2.0 27 6.0 28 11.0 29 18.0 30 22.0 31 29.0 32 46.0 33 72.0 34 102.0 35 294.0 36 2972.0 37 416.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.325 11.65 8.95 37.075 2 21.385542168674696 13.60441767068273 34.33734939759036 30.672690763052206 3 17.8 17.224999999999998 27.175 37.8 4 22.25 24.025 24.95 28.775000000000002 5 23.35 29.725 24.75 22.175 6 21.4 33.074999999999996 23.849999999999998 21.675 7 16.675 26.724999999999998 39.5 17.1 8 18.075 28.15 30.099999999999998 23.674999999999997 9 17.05 25.05 34.25 23.65 10-14 19.93 29.26 27.584999999999997 23.225 15-19 19.759999999999998 27.72 27.900000000000002 24.62 20-24 20.265 27.46 28.139999999999997 24.135 25-29 20.5 27.68 27.49 24.33 30-34 20.635 27.37 28.199999999999996 23.794999999999998 35-39 20.244999999999997 28.144999999999996 27.275 24.335 40-44 20.165 28.38 27.74 23.715 45-49 20.905 27.400000000000002 27.85 23.845 50-54 20.44 27.700000000000003 27.22 24.64 55-59 20.375 28.075 27.105 24.445 60-64 20.23 28.544999999999998 26.935 24.29 65-69 20.27 27.235 28.044999999999998 24.45 70-74 20.48 27.98 27.584999999999997 23.955000000000002 75-79 20.34 27.365000000000002 28.005000000000003 24.29 80-84 20.59 27.11 27.785 24.515 85-89 21.01 28.645 26.63 23.715 90-94 20.990000000000002 27.284999999999997 27.71 24.015 95-99 20.825 27.339999999999996 27.834999999999997 24.0 100-104 20.965 27.944999999999997 27.384999999999998 23.705000000000002 105-109 20.77 27.975 27.034999999999997 24.22 110-114 21.425 27.915 26.755000000000003 23.905 115-119 21.245 27.32 27.084999999999997 24.349999999999998 120-124 21.3 27.900000000000002 26.76 24.04 125-129 21.905 27.235 26.5 24.36 130-134 21.154999999999998 28.515 26.240000000000002 24.09 135-139 21.525 27.655 27.145000000000003 23.674999999999997 140-144 21.654999999999998 27.41 26.334999999999997 24.6 145-149 21.279999999999998 28.09 26.195 24.435000000000002 150-151 21.762500000000003 28.0875 25.0375 25.112499999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 1.0 20 1.5 21 1.0 22 2.0 23 4.5 24 4.0 25 3.0 26 4.0 27 6.5 28 7.0 29 7.5 30 10.0 31 9.5 32 22.0 33 36.5 34 41.5 35 61.5 36 76.5 37 94.0 38 113.5 39 137.0 40 166.5 41 189.0 42 224.0 43 255.0 44 247.5 45 248.0 46 280.5 47 263.5 48 233.5 49 229.0 50 217.0 51 179.5 52 133.5 53 99.5 54 82.0 55 73.0 56 56.0 57 43.5 58 30.0 59 24.5 60 24.5 61 17.5 62 9.5 63 4.5 64 3.0 65 3.0 66 3.5 67 2.5 68 2.5 69 2.5 70 1.5 71 1.5 72 1.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.575 #Duplication Level Percentage of deduplicated Percentage of total 1 91.1399392768424 82.55 2 7.645597571073696 13.850000000000001 3 0.9660502346121999 2.625 4 0.22081148219707425 0.8 5 0.0 0.0 6 0.0 0.0 7 0.02760143527463428 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.0875 0.0 0.0 0.0 0.0 100-101 1.1875 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.45 0.0 0.0 0.0 0.0 106-107 1.6375000000000002 0.0 0.0 0.0 0.0 108-109 1.975 0.0 0.0 0.0 0.0 110-111 2.375 0.0 0.0 0.0 0.0 112-113 2.6875 0.0 0.0 0.0 0.0 114-115 3.1125 0.0 0.0 0.0 0.0 116-117 3.55 0.0 0.0 0.0 0.0 118-119 4.0375 0.0 0.0 0.0 0.0 120-121 4.3375 0.0 0.0 0.0 0.0 122-123 4.762499999999999 0.0 0.0 0.0 0.0 124-125 5.262499999999999 0.0 0.0 0.0 0.0 126-127 5.7875 0.0 0.0 0.0 0.0 128-129 6.4375 0.0 0.0 0.0 0.0 130-131 7.050000000000001 0.0 0.0 0.0 0.0 132-133 7.5125 0.0 0.0 0.0 0.0 134-135 8.075 0.0 0.0 0.0 0.0 136-137 8.85 0.0 0.0 0.0 0.0 138-139 9.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTCCT 10 0.006830828 145.0 4 >>END_MODULE SRR12690126 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690126_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.31275 37.0 37.0 37.0 37.0 37.0 2 36.099 37.0 37.0 37.0 37.0 37.0 3 36.1405 37.0 37.0 37.0 37.0 37.0 4 36.1575 37.0 37.0 37.0 37.0 37.0 5 36.3435 37.0 37.0 37.0 37.0 37.0 6 36.322 37.0 37.0 37.0 37.0 37.0 7 36.2645 37.0 37.0 37.0 37.0 37.0 8 36.4015 37.0 37.0 37.0 37.0 37.0 9 36.302 37.0 37.0 37.0 37.0 37.0 10-14 36.2872 37.0 37.0 37.0 37.0 37.0 15-19 36.3303 37.0 37.0 37.0 37.0 37.0 20-24 36.2565 37.0 37.0 37.0 37.0 37.0 25-29 36.2314 37.0 37.0 37.0 37.0 37.0 30-34 36.2135 37.0 37.0 37.0 37.0 37.0 35-39 36.188500000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.196299999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.2153 37.0 37.0 37.0 37.0 37.0 50-54 36.075599999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.15069999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.0848 37.0 37.0 37.0 37.0 37.0 65-69 36.061 37.0 37.0 37.0 37.0 37.0 70-74 35.98870000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.98819999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.0268 37.0 37.0 37.0 37.0 37.0 85-89 35.9426 37.0 37.0 37.0 37.0 37.0 90-94 35.864 37.0 37.0 37.0 37.0 37.0 95-99 35.9583 37.0 37.0 37.0 37.0 37.0 100-104 36.00279999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.974599999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.845600000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.79970000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.7102 37.0 37.0 37.0 37.0 37.0 125-129 35.685 37.0 37.0 37.0 37.0 37.0 130-134 35.5404 37.0 37.0 37.0 37.0 37.0 135-139 35.6115 37.0 37.0 37.0 37.0 37.0 140-144 35.4995 37.0 37.0 37.0 37.0 37.0 145-149 35.336800000000004 37.0 37.0 37.0 32.2 37.0 150-151 34.850750000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 1.0 14 2.0 15 3.0 16 1.0 17 1.0 18 1.0 19 0.0 20 1.0 21 3.0 22 2.0 23 2.0 24 7.0 25 7.0 26 7.0 27 10.0 28 13.0 29 13.0 30 23.0 31 31.0 32 56.0 33 90.0 34 189.0 35 539.0 36 2688.0 37 307.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.0847711927982 24.406101525381345 11.70292573143286 24.8062015503876 2 29.65 27.125 26.3 16.925 3 23.05 28.525 28.9 19.525000000000002 4 23.724999999999998 34.875 23.125 18.275 5 25.974999999999998 35.825 21.275 16.925 6 21.95 39.35 21.2 17.5 7 22.2 22.6 36.449999999999996 18.75 8 22.2 26.950000000000003 26.450000000000003 24.4 9 22.400000000000002 24.7 29.799999999999997 23.1 10-14 23.29 29.525000000000002 25.855 21.33 15-19 24.13 28.060000000000002 26.834999999999997 20.974999999999998 20-24 23.135 28.375 27.33 21.16 25-29 23.535 28.51 27.08 20.875 30-34 23.13 28.125 27.860000000000003 20.885 35-39 23.465 28.299999999999997 26.419999999999998 21.815 40-44 23.365 28.01 26.805 21.82 45-49 23.305 28.275 27.310000000000002 21.11 50-54 23.54 28.1 26.645000000000003 21.715 55-59 23.145 27.725 26.919999999999998 22.21 60-64 23.385 27.950000000000003 26.935 21.73 65-69 23.69 26.974999999999998 26.935 22.400000000000002 70-74 23.369999999999997 28.125 26.845000000000002 21.66 75-79 23.465 27.985 27.025 21.525 80-84 24.41 27.74 26.71 21.14 85-89 23.9 27.810000000000002 26.83 21.46 90-94 24.59 27.339999999999996 26.705000000000002 21.365000000000002 95-99 24.21 27.834999999999997 26.905 21.05 100-104 24.67 27.38 26.91 21.04 105-109 23.794999999999998 28.1 26.705000000000002 21.4 110-114 24.185000000000002 27.83 27.415 20.57 115-119 25.295 27.894999999999996 26.38 20.43 120-124 25.074999999999996 28.21 25.7 21.015 125-129 24.93 27.93 26.185000000000002 20.955 130-134 25.430000000000003 27.860000000000003 26.72 19.99 135-139 25.105 28.4 26.52 19.975 140-144 25.895000000000003 27.91 25.91 20.285 145-149 25.71 27.939999999999998 26.135 20.215 150-151 25.55 28.4125 25.9625 20.075000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 1.5 23 1.5 24 1.5 25 2.0 26 1.0 27 1.5 28 4.5 29 9.0 30 13.5 31 17.5 32 17.5 33 22.0 34 33.5 35 43.0 36 63.5 37 97.0 38 132.0 39 145.5 40 166.5 41 199.0 42 225.0 43 258.5 44 274.0 45 284.5 46 291.0 47 271.0 48 246.0 49 213.0 50 166.0 51 137.0 52 126.5 53 110.0 54 99.5 55 85.0 56 54.5 57 40.0 58 31.5 59 24.0 60 21.0 61 14.5 62 9.5 63 7.0 64 5.5 65 4.5 66 4.5 67 2.5 68 0.5 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.5 97 0.5 98 0.0 99 0.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.96435479414204 82.3 2 7.8198397347333515 14.149999999999999 3 1.0223818734457033 2.775 4 0.13815971262779772 0.5 5 0.027631942525559547 0.125 6 0.027631942525559547 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.0875 0.0 0.0 0.0 0.0 100-101 1.1875 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.4875 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 2.05 0.0 0.0 0.0 0.0 110-111 2.4749999999999996 0.0 0.0 0.0 0.0 112-113 2.7874999999999996 0.0 0.0 0.0 0.0 114-115 3.2375 0.0 0.0 0.0 0.0 116-117 3.675 0.0 0.0 0.0 0.0 118-119 4.1625 0.0 0.0 0.0 0.0 120-121 4.4625 0.0 0.0 0.0 0.0 122-123 4.887499999999999 0.0 0.0 0.0 0.0 124-125 5.387499999999999 0.0 0.0 0.0 0.0 126-127 5.925 0.0 0.0 0.0 0.0 128-129 6.6 0.0 0.0 0.0 0.0 130-131 7.225 0.0 0.0 0.0 0.0 132-133 7.6875 0.0 0.0 0.0 0.0 134-135 8.25 0.0 0.0 0.0 0.0 136-137 9.037500000000001 0.0 0.0 0.0 0.0 138-139 9.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 766190 spots for SRR12690126.sra Written 766190 spots for SRR12690126.sra Read 766190 spots for SRR12690126.sra Written 766190 spots for SRR12690126.sra Read 766190 spots for SRR12690126.sra Written 766190 spots for SRR12690126.sra Read 766190 spots for SRR12690126.sra Written 766190 spots for SRR12690126.sra Read 766190 spots for SRR12690126.sra Written 766190 spots for SRR12690126.sra Read 766190 spots for SRR12690126.sra Written 766190 spots for SRR12690126.sra Read 766190 spots for SRR12690126.sra Written 766190 spots for SRR12690126.sra Read 766190 spots for SRR12690126.sra Written 766190 spots for SRR12690126.sra Read 766190 spots for SRR12690126.sra Written 766190 spots for SRR12690126.sra Read 766190 spots for SRR12690126.sra Written 766190 spots for SRR12690126.sra Read 766190 spots for SRR12690126.sra Written 766190 spots for SRR12690126.sra Read 766190 spots for SRR12690126.sra Written 766190 spots for SRR12690126.sra Read 766190 spots for SRR12690126.sra Written 766190 spots for SRR12690126.sra Read 766190 spots for SRR12690126.sra Written 766190 spots for SRR12690126.sra Read 766190 spots for SRR12690126.sra Written 766190 spots for SRR12690126.sra Read 766190 spots for SRR12690126.sra Written 766190 spots for SRR12690126.sra Read 766190 spots for SRR12690126.sra Written 766190 spots for SRR12690126.sra Read 766190 spots for SRR12690126.sra Written 766190 spots for SRR12690126.sra Read 766190 spots for SRR12690126.sra Written 766190 spots for SRR12690126.sra Read 766197 spots for SRR12690126.sra Written 766197 spots for SRR12690126.sra SRR ids: ['SRR12690126.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dxfb6cpu SRR12690126.sra spots: 15323807 blocks: [[1, 766190], [766191, 1532380], [1532381, 2298570], [2298571, 3064760], [3064761, 3830950], [3830951, 4597140], [4597141, 5363330], [5363331, 6129520], [6129521, 6895710], [6895711, 7661900], [7661901, 8428090], [8428091, 9194280], [9194281, 9960470], [9960471, 10726660], [10726661, 11492850], [11492851, 12259040], [12259041, 13025230], [13025231, 13791420], [13791421, 14557610], [14557611, 15323807]] SRR12690126 file size 5185999 SRR12690126 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690126 SRR12690126_1.fastq SRR12690126_2.fastq Input file: SRR12690126_1.fastq Paired file: SRR12690126_2.fastq trimmed: SRR12690126-trimmed-pair1.fastq, SRR12690126-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:48:37 2025 >> started Mon Feb 10 16:48:57 2025 >> done (20.433s) 15323807 read pairs processed; of these: 30 ( 0.00%) short read pairs filtered out after trimming by size control 9475 ( 0.06%) empty read pairs filtered out after trimming by size control 15314302 (99.94%) read pairs available; of these: 2124057 (13.87%) trimmed read pairs available after processing 13190245 (86.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 1 0.00% 20 2 0.00% 21 4 0.00% 22 9 0.00% 23 11 0.00% 24 10 0.00% 25 16 0.00% 26 19 0.00% 27 11 0.00% 28 20 0.00% 29 23 0.00% 30 16 0.00% 31 24 0.00% 32 36 0.00% 33 27 0.00% 34 26 0.00% 35 22 0.00% 36 25 0.00% 37 29 0.00% 38 32 0.00% 39 40 0.00% 40 27 0.00% 41 44 0.00% 42 54 0.00% 43 51 0.00% 44 62 0.00% 45 62 0.00% 46 63 0.00% 47 77 0.00% 48 79 0.00% 49 95 0.00% 50 90 0.00% 51 95 0.00% 52 125 0.00% 53 151 0.00% 54 135 0.00% 55 157 0.00% 56 169 0.00% 57 225 0.00% 58 222 0.00% 59 252 0.00% 60 314 0.00% 61 387 0.00% 62 381 0.00% 63 430 0.00% 64 526 0.00% 65 525 0.00% 66 564 0.00% 67 640 0.00% 68 738 0.00% 69 822 0.01% 70 934 0.01% 71 1048 0.01% 72 1249 0.01% 73 1495 0.01% 74 1549 0.01% 75 1786 0.01% 76 1973 0.01% 77 2174 0.01% 78 2439 0.02% 79 2754 0.02% 80 3079 0.02% 81 3453 0.02% 82 3774 0.02% 83 4103 0.03% 84 4643 0.03% 85 5077 0.03% 86 5550 0.04% 87 6000 0.04% 88 6451 0.04% 89 6950 0.05% 90 7363 0.05% 91 8083 0.05% 92 8863 0.06% 93 9709 0.06% 94 10322 0.07% 95 11237 0.07% 96 11660 0.08% 97 12349 0.08% 98 13249 0.09% 99 13860 0.09% 100 14671 0.10% 101 15349 0.10% 102 16272 0.11% 103 17344 0.11% 104 18184 0.12% 105 19001 0.12% 106 19986 0.13% 107 20655 0.13% 108 21425 0.14% 109 22357 0.15% 110 22953 0.15% 111 24197 0.16% 112 25066 0.16% 113 25740 0.17% 114 27025 0.18% 115 28210 0.18% 116 29040 0.19% 117 30207 0.20% 118 30815 0.20% 119 32021 0.21% 120 33092 0.22% 121 34400 0.22% 122 34885 0.23% 123 35853 0.23% 124 37372 0.24% 125 37648 0.25% 126 39522 0.26% 127 40608 0.27% 128 40651 0.27% 129 42369 0.28% 130 43231 0.28% 131 43941 0.29% 132 45262 0.30% 133 46598 0.30% 134 47186 0.31% 135 48277 0.32% 136 49574 0.32% 137 49931 0.33% 138 50751 0.33% 139 51882 0.34% 140 51875 0.34% 141 53303 0.35% 142 55063 0.36% 143 55468 0.36% 144 57456 0.38% 145 58394 0.38% 146 58226 0.38% 147 58694 0.38% 148 59750 0.39% 149 60143 0.39% 150 60987 0.40% 151 13190245 86.13% 15314302 reads passed initial QC criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=19 prefix-density=0.88 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=101.50 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=2.0 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=1.25 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=16 prefix-density=1.26 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=38.69 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=5.9 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATC SRR12690126 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:49:44 Started mapping on | Feb 10 16:49:44 Finished on | Feb 10 16:52:39 Mapping speed, Million of reads per hour | 315.04 Number of input reads | 15314302 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13705761 Uniquely mapped reads % | 89.50% Average mapped length | 294.25 Number of splices: Total | 14122107 Number of splices: Annotated (sjdb) | 13867997 Number of splices: GT/AG | 13827781 Number of splices: GC/AG | 251836 Number of splices: AT/AC | 9494 Number of splices: Non-canonical | 32996 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 345760 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 115875 % of reads mapped to too many loci | 0.76% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.28% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1262781 1262781 1262781 N_multimapping 345760 345760 345760 N_noFeature 326085 13548342 370187 N_ambiguous 205639 739 91823 UnstrandedReadsAssigned:13174037 PositiveStrandReadsAssigned:156680 NegativeStrandReadsAssigned:13243751 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690126 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690126-trimmed-pair1.fastq SRR12690126-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,314,302 reads, 13,394,501 reads pseudoaligned [quant] estimated average fragment length: 234.911 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,095 rounds 52401 SRR12690126.ke.tsv 34699 SRR12690126.se.tsv 87100 total ==> SRR12690126.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.09 324 12.3099 Potri.005G024800.1.v4.1 1035 801.089 182 15.3998 Potri.004G059700.1.v4.1 961 727.15 46 4.28803 Potri.007G009000.2.v4.1 1416 1182.09 0 0 Potri.003G141000.2.v4.1 2943 2709.09 464 11.6097 Potri.016G087400.1.v4.1 270 88.433 825 632.359 Potri.015G069301.1.v4.1 564 337.743 0 0 Potri.010G195200.1.v4.1 1773 1539.09 3 0.132124 Potri.012G127500.1.v4.1 977 743.128 728 66.4037 ==> SRR12690126.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 93 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 202 Potri.001G212900.v4.1 14 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 32 SRR12690126 completed mapping pipeline successfully