Starting /dee2/code/volunteer_pipeline.sh SRR12690127 current disk space = 3058295390208 free memory = 1028477896 SRR12690127 SRAfilesize edc77c92713247923ecd8a16d76ff877 SRR12690127.sra SRR12690127.sra file validated SRR12690127 is paired end SRR12690127 is conventional basespace SRR12690127 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690127_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6335 37.0 37.0 37.0 37.0 37.0 2 36.37325 37.0 37.0 37.0 37.0 37.0 3 36.616 37.0 37.0 37.0 37.0 37.0 4 36.6525 37.0 37.0 37.0 37.0 37.0 5 36.654 37.0 37.0 37.0 37.0 37.0 6 36.696 37.0 37.0 37.0 37.0 37.0 7 36.584 37.0 37.0 37.0 37.0 37.0 8 36.608 37.0 37.0 37.0 37.0 37.0 9 36.56 37.0 37.0 37.0 37.0 37.0 10-14 36.6114 37.0 37.0 37.0 37.0 37.0 15-19 36.5989 37.0 37.0 37.0 37.0 37.0 20-24 36.619299999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.5558 37.0 37.0 37.0 37.0 37.0 30-34 36.51480000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.5254 37.0 37.0 37.0 37.0 37.0 40-44 36.486900000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.4553 37.0 37.0 37.0 37.0 37.0 50-54 36.4679 37.0 37.0 37.0 37.0 37.0 55-59 36.4191 37.0 37.0 37.0 37.0 37.0 60-64 36.415200000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.306599999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.3835 37.0 37.0 37.0 37.0 37.0 75-79 36.3657 37.0 37.0 37.0 37.0 37.0 80-84 36.2912 37.0 37.0 37.0 37.0 37.0 85-89 36.2949 37.0 37.0 37.0 37.0 37.0 90-94 36.25429999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.2899 37.0 37.0 37.0 37.0 37.0 100-104 36.216899999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.1622 37.0 37.0 37.0 37.0 37.0 110-114 36.177200000000006 37.0 37.0 37.0 37.0 37.0 115-119 36.1006 37.0 37.0 37.0 37.0 37.0 120-124 36.0399 37.0 37.0 37.0 37.0 37.0 125-129 36.056 37.0 37.0 37.0 37.0 37.0 130-134 35.9444 37.0 37.0 37.0 37.0 37.0 135-139 36.002300000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.8275 37.0 37.0 37.0 37.0 37.0 145-149 35.7896 37.0 37.0 37.0 37.0 37.0 150-151 35.52275 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 0.0 25 2.0 26 4.0 27 7.0 28 11.0 29 8.0 30 25.0 31 42.0 32 55.0 33 48.0 34 122.0 35 310.0 36 2946.0 37 418.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.275 12.675 6.575 36.475 2 20.175658720200754 12.74780426599749 34.93099121706399 32.14554579673777 3 15.75 13.850000000000001 30.275000000000002 40.125 4 20.275000000000002 22.275 26.075 31.374999999999996 5 22.225 29.849999999999998 23.5 24.425 6 22.85 31.55 23.575 22.025 7 17.1 26.474999999999998 37.75 18.675 8 17.549999999999997 27.175 31.1 24.175 9 18.35 24.625 33.825 23.200000000000003 10-14 20.05 28.615000000000002 27.71 23.625 15-19 20.990000000000002 26.915 27.365000000000002 24.73 20-24 20.5 27.48 27.725 24.295 25-29 20.405 27.22 27.250000000000004 25.124999999999996 30-34 20.47 27.26 27.55 24.72 35-39 20.485 27.52 27.465 24.529999999999998 40-44 20.805 27.58 27.095000000000002 24.52 45-49 21.12 27.42 27.295 24.165 50-54 20.855 27.860000000000003 27.26 24.025 55-59 20.945 27.775 26.900000000000002 24.38 60-64 20.68 26.735 27.79 24.795 65-69 21.455 26.900000000000002 27.700000000000003 23.945 70-74 21.535 26.919999999999998 26.805 24.740000000000002 75-79 20.705000000000002 26.700000000000003 28.084999999999997 24.51 80-84 21.57 25.979999999999997 27.584999999999997 24.865000000000002 85-89 20.595 27.115000000000002 27.54 24.75 90-94 21.85 26.755000000000003 27.165 24.23 95-99 21.47 27.389999999999997 27.215 23.925 100-104 21.62 27.560000000000002 26.865 23.955000000000002 105-109 22.2 27.11 26.365 24.325 110-114 21.365000000000002 26.855 27.51 24.27 115-119 21.035 27.515 27.065 24.385 120-124 21.005 27.060000000000002 26.979999999999997 24.955 125-129 21.775 26.795 26.200000000000003 25.230000000000004 130-134 21.395 26.740000000000002 26.939999999999998 24.925 135-139 22.189999999999998 26.43 26.805 24.575 140-144 21.865000000000002 26.765 26.815 24.555 145-149 21.54 26.85 26.375 25.235000000000003 150-151 22.225 26.937499999999996 26.05 24.7875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.5 18 1.0 19 0.0 20 0.5 21 1.0 22 2.5 23 2.0 24 0.5 25 1.0 26 1.0 27 3.5 28 4.5 29 4.0 30 6.0 31 10.5 32 20.5 33 27.0 34 30.5 35 31.0 36 54.5 37 85.5 38 94.5 39 113.5 40 138.0 41 184.0 42 222.0 43 248.5 44 259.0 45 256.0 46 268.5 47 269.5 48 262.0 49 240.5 50 212.0 51 174.0 52 141.5 53 133.0 54 119.5 55 95.0 56 76.0 57 51.5 58 34.0 59 36.0 60 27.5 61 14.5 62 11.5 63 7.5 64 4.0 65 2.5 66 3.0 67 2.5 68 3.0 69 3.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.5 #Duplication Level Percentage of deduplicated Percentage of total 1 89.60893854748603 80.2 2 9.134078212290502 16.35 3 1.1731843575418994 3.15 4 0.08379888268156424 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.175 0.0 0.0 0.0 0.0 100-101 1.45 0.0 0.0 0.0 0.0 102-103 1.675 0.0 0.0 0.0 0.0 104-105 1.8624999999999998 0.0 0.0 0.0 0.0 106-107 2.125 0.0 0.0 0.0 0.0 108-109 2.3125 0.0 0.0 0.0 0.0 110-111 2.5125 0.0 0.0 0.0 0.0 112-113 2.925 0.0 0.0 0.0 0.0 114-115 3.3125 0.0 0.0 0.0 0.0 116-117 3.75 0.0 0.0 0.0 0.0 118-119 3.925 0.0 0.0 0.0 0.0 120-121 4.15 0.0 0.0 0.0 0.0 122-123 4.475 0.0 0.0 0.0 0.0 124-125 4.95 0.0 0.0 0.0 0.0 126-127 5.65 0.0 0.0 0.0 0.0 128-129 6.1 0.0 0.0 0.0 0.0 130-131 6.4625 0.0 0.0 0.0 0.0 132-133 6.8875 0.0 0.0 0.0 0.0 134-135 7.2875 0.0 0.0 0.0 0.0 136-137 7.875 0.0 0.0 0.0 0.0 138-139 8.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGAACAT 10 0.006830828 145.0 4 >>END_MODULE SRR12690127 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690127_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3265 37.0 37.0 37.0 37.0 37.0 2 36.0485 37.0 37.0 37.0 37.0 37.0 3 36.146 37.0 37.0 37.0 37.0 37.0 4 36.22 37.0 37.0 37.0 37.0 37.0 5 36.1795 37.0 37.0 37.0 37.0 37.0 6 36.1515 37.0 37.0 37.0 37.0 37.0 7 36.211 37.0 37.0 37.0 37.0 37.0 8 36.319 37.0 37.0 37.0 37.0 37.0 9 36.3105 37.0 37.0 37.0 37.0 37.0 10-14 36.25449999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.2072 37.0 37.0 37.0 37.0 37.0 20-24 36.282 37.0 37.0 37.0 37.0 37.0 25-29 36.2237 37.0 37.0 37.0 37.0 37.0 30-34 36.17470000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.143 37.0 37.0 37.0 37.0 37.0 40-44 36.1118 37.0 37.0 37.0 37.0 37.0 45-49 36.0972 37.0 37.0 37.0 37.0 37.0 50-54 36.0592 37.0 37.0 37.0 37.0 37.0 55-59 36.0581 37.0 37.0 37.0 37.0 37.0 60-64 35.9605 37.0 37.0 37.0 37.0 37.0 65-69 35.9536 37.0 37.0 37.0 37.0 37.0 70-74 35.8924 37.0 37.0 37.0 37.0 37.0 75-79 35.937400000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.9654 37.0 37.0 37.0 37.0 37.0 85-89 35.9364 37.0 37.0 37.0 37.0 37.0 90-94 35.7687 37.0 37.0 37.0 37.0 37.0 95-99 35.8784 37.0 37.0 37.0 37.0 37.0 100-104 35.918099999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.8954 37.0 37.0 37.0 37.0 37.0 110-114 35.7907 37.0 37.0 37.0 37.0 37.0 115-119 35.7457 37.0 37.0 37.0 37.0 37.0 120-124 35.6269 37.0 37.0 37.0 37.0 37.0 125-129 35.5783 37.0 37.0 37.0 37.0 37.0 130-134 35.463499999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.41510000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.3893 37.0 37.0 37.0 37.0 37.0 145-149 35.1906 37.0 37.0 37.0 29.8 37.0 150-151 34.845 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 2.0 15 1.0 16 0.0 17 2.0 18 0.0 19 1.0 20 1.0 21 6.0 22 6.0 23 2.0 24 6.0 25 5.0 26 7.0 27 8.0 28 13.0 29 20.0 30 27.0 31 43.0 32 58.0 33 110.0 34 218.0 35 580.0 36 2662.0 37 220.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.575 25.650000000000002 9.925 23.849999999999998 2 29.299999999999997 29.225 24.975 16.5 3 22.325 29.125 29.475 19.075 4 23.35 36.225 22.45 17.974999999999998 5 26.150000000000002 35.55 20.825 17.474999999999998 6 23.25 38.574999999999996 19.75 18.425 7 21.725 23.724999999999998 35.699999999999996 18.85 8 22.675 28.1 25.0 24.224999999999998 9 22.375 24.75 28.675 24.2 10-14 23.815 29.439999999999998 24.865000000000002 21.88 15-19 24.16 28.475 26.375 20.990000000000002 20-24 24.18 28.485 25.485000000000003 21.85 25-29 24.395 28.439999999999998 25.259999999999998 21.905 30-34 23.775 28.075 26.32 21.83 35-39 23.28 27.955000000000002 27.27 21.495 40-44 23.72 27.800000000000004 26.71 21.77 45-49 24.01 26.705000000000002 27.12 22.165000000000003 50-54 23.995 27.04 26.88 22.085 55-59 24.785 26.96 26.27 21.985 60-64 23.919999999999998 27.439999999999998 26.5 22.14 65-69 24.5 27.145000000000003 26.284999999999997 22.07 70-74 25.345000000000002 27.355 25.855 21.445 75-79 24.505 27.395000000000003 26.150000000000002 21.95 80-84 24.834999999999997 27.83 25.624999999999996 21.709999999999997 85-89 24.065 28.255000000000003 26.025 21.654999999999998 90-94 24.62 27.48 26.035000000000004 21.865000000000002 95-99 24.415 27.875 26.47 21.240000000000002 100-104 24.625 28.084999999999997 26.325 20.965 105-109 24.775 27.235 26.58 21.41 110-114 24.825 27.11 26.36 21.705 115-119 24.935 27.384999999999998 26.14 21.54 120-124 25.64 28.084999999999997 25.7 20.575 125-129 25.56 27.02 26.685 20.735 130-134 26.5 26.619999999999997 26.27 20.61 135-139 25.955000000000002 27.485 26.06 20.5 140-144 26.96 26.484999999999996 25.695 20.86 145-149 26.965 26.355 25.71 20.97 150-151 27.0875 28.3375 25.05 19.525000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.5 13 1.0 14 0.5 15 0.5 16 1.0 17 0.5 18 2.0 19 2.5 20 0.5 21 1.0 22 1.0 23 1.0 24 1.5 25 0.5 26 0.0 27 0.5 28 3.0 29 4.0 30 6.5 31 10.5 32 9.5 33 12.5 34 21.5 35 29.5 36 39.0 37 68.5 38 91.0 39 116.0 40 161.0 41 208.0 42 243.0 43 255.0 44 255.5 45 266.0 46 291.5 47 290.5 48 268.0 49 247.5 50 206.0 51 160.5 52 149.0 53 122.0 54 91.5 55 78.0 56 54.5 57 46.0 58 42.0 59 29.0 60 18.5 61 16.5 62 17.5 63 12.5 64 7.5 65 3.0 66 0.5 67 1.5 68 1.0 69 1.5 70 1.5 71 1.0 72 1.0 73 1.5 74 1.5 75 0.0 76 0.0 77 0.5 78 1.0 79 1.0 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 1.0 87 1.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.5 98 1.5 99 1.0 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.925 #Duplication Level Percentage of deduplicated Percentage of total 1 89.26061287601912 79.375 2 9.446162496485803 16.8 3 1.1526567332021367 3.075 4 0.11245431543435479 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.028113578858588697 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 14 0.35000000000000003 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.5375 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.875 0.0 0.0 0.0 0.0 96-97 1.075 0.0 0.0 0.0 0.0 98-99 1.25 0.0 0.0 0.0 0.0 100-101 1.525 0.0 0.0 0.0 0.0 102-103 1.75 0.0 0.0 0.0 0.0 104-105 1.9375 0.0 0.0 0.0 0.0 106-107 2.2 0.0 0.0 0.0 0.0 108-109 2.3875 0.0 0.0 0.0 0.0 110-111 2.5875000000000004 0.0 0.0 0.0 0.0 112-113 3.0 0.0 0.0 0.0 0.0 114-115 3.3875 0.0 0.0 0.0 0.0 116-117 3.8 0.0 0.0 0.0 0.0 118-119 3.975 0.0 0.0 0.0 0.0 120-121 4.225 0.0 0.0 0.0 0.0 122-123 4.55 0.0 0.0 0.0 0.0 124-125 5.025 0.0 0.0 0.0 0.0 126-127 5.725 0.0 0.0 0.0 0.0 128-129 6.175 0.0 0.0 0.0 0.0 130-131 6.5375 0.0 0.0 0.0 0.0 132-133 7.0 0.0 0.0 0.0 0.0 134-135 7.4125 0.0 0.0 0.0 0.0 136-137 8.025 0.0 0.0 0.0 0.0 138-139 8.725000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 748718 spots for SRR12690127.sra Written 748718 spots for SRR12690127.sra Read 748718 spots for SRR12690127.sra Written 748718 spots for SRR12690127.sra Read 748718 spots for SRR12690127.sra Written 748718 spots for SRR12690127.sra Read 748718 spots for SRR12690127.sra Written 748718 spots for SRR12690127.sra Read 748718 spots for SRR12690127.sra Written 748718 spots for SRR12690127.sra Read 748718 spots for SRR12690127.sra Written 748718 spots for SRR12690127.sra Read 748718 spots for SRR12690127.sra Written 748718 spots for SRR12690127.sra Read 748718 spots for SRR12690127.sra Written 748718 spots for SRR12690127.sra Read 748718 spots for SRR12690127.sra Written 748718 spots for SRR12690127.sra Read 748718 spots for SRR12690127.sra Written 748718 spots for SRR12690127.sra Read 748718 spots for SRR12690127.sra Written 748718 spots for SRR12690127.sra Read 748718 spots for SRR12690127.sra Written 748718 spots for SRR12690127.sra Read 748718 spots for SRR12690127.sra Written 748718 spots for SRR12690127.sra Read 748718 spots for SRR12690127.sra Written 748718 spots for SRR12690127.sra Read 748718 spots for SRR12690127.sra Written 748718 spots for SRR12690127.sra Read 748718 spots for SRR12690127.sra Written 748718 spots for SRR12690127.sra Read 748718 spots for SRR12690127.sra Written 748718 spots for SRR12690127.sra Read 748718 spots for SRR12690127.sra Written 748718 spots for SRR12690127.sra Read 748718 spots for SRR12690127.sra Written 748718 spots for SRR12690127.sra Read 748728 spots for SRR12690127.sra Written 748728 spots for SRR12690127.sra SRR ids: ['SRR12690127.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_94_63g25 SRR12690127.sra spots: 14974370 blocks: [[1, 748718], [748719, 1497436], [1497437, 2246154], [2246155, 2994872], [2994873, 3743590], [3743591, 4492308], [4492309, 5241026], [5241027, 5989744], [5989745, 6738462], [6738463, 7487180], [7487181, 8235898], [8235899, 8984616], [8984617, 9733334], [9733335, 10482052], [10482053, 11230770], [11230771, 11979488], [11979489, 12728206], [12728207, 13476924], [13476925, 14225642], [14225643, 14974370]] SRR12690127 file size 5067245 SRR12690127 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690127 SRR12690127_1.fastq SRR12690127_2.fastq Input file: SRR12690127_1.fastq Paired file: SRR12690127_2.fastq trimmed: SRR12690127-trimmed-pair1.fastq, SRR12690127-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:56:59 2025 >> started Mon Feb 10 16:57:20 2025 >> done (21.395s) 14974370 read pairs processed; of these: 35 ( 0.00%) short read pairs filtered out after trimming by size control 12377 ( 0.08%) empty read pairs filtered out after trimming by size control 14961958 (99.92%) read pairs available; of these: 1968333 (13.16%) trimmed read pairs available after processing 12993625 (86.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 12 0.00% 20 12 0.00% 21 5 0.00% 22 12 0.00% 23 12 0.00% 24 23 0.00% 25 19 0.00% 26 31 0.00% 27 34 0.00% 28 34 0.00% 29 36 0.00% 30 37 0.00% 31 44 0.00% 32 37 0.00% 33 31 0.00% 34 45 0.00% 35 29 0.00% 36 49 0.00% 37 35 0.00% 38 31 0.00% 39 43 0.00% 40 41 0.00% 41 55 0.00% 42 55 0.00% 43 52 0.00% 44 65 0.00% 45 71 0.00% 46 51 0.00% 47 64 0.00% 48 89 0.00% 49 105 0.00% 50 117 0.00% 51 128 0.00% 52 118 0.00% 53 128 0.00% 54 145 0.00% 55 143 0.00% 56 175 0.00% 57 187 0.00% 58 237 0.00% 59 276 0.00% 60 318 0.00% 61 311 0.00% 62 382 0.00% 63 436 0.00% 64 473 0.00% 65 441 0.00% 66 572 0.00% 67 612 0.00% 68 697 0.00% 69 769 0.01% 70 929 0.01% 71 1000 0.01% 72 1124 0.01% 73 1300 0.01% 74 1557 0.01% 75 1579 0.01% 76 1780 0.01% 77 2016 0.01% 78 2269 0.02% 79 2506 0.02% 80 2764 0.02% 81 3239 0.02% 82 3450 0.02% 83 3891 0.03% 84 4457 0.03% 85 4762 0.03% 86 5059 0.03% 87 5619 0.04% 88 5978 0.04% 89 6316 0.04% 90 6961 0.05% 91 7622 0.05% 92 8171 0.05% 93 9085 0.06% 94 9510 0.06% 95 10303 0.07% 96 10665 0.07% 97 11640 0.08% 98 12010 0.08% 99 12576 0.08% 100 13367 0.09% 101 14188 0.09% 102 15252 0.10% 103 16002 0.11% 104 16983 0.11% 105 17377 0.12% 106 18426 0.12% 107 18837 0.13% 108 19733 0.13% 109 20370 0.14% 110 20996 0.14% 111 21953 0.15% 112 23294 0.16% 113 24086 0.16% 114 25098 0.17% 115 25872 0.17% 116 26475 0.18% 117 27836 0.19% 118 28687 0.19% 119 28975 0.19% 120 30101 0.20% 121 31617 0.21% 122 32423 0.22% 123 33985 0.23% 124 34886 0.23% 125 35695 0.24% 126 36659 0.25% 127 37749 0.25% 128 38027 0.25% 129 38739 0.26% 130 39859 0.27% 131 40079 0.27% 132 41821 0.28% 133 43246 0.29% 134 44053 0.29% 135 44480 0.30% 136 45992 0.31% 137 46162 0.31% 138 46763 0.31% 139 48389 0.32% 140 48190 0.32% 141 49643 0.33% 142 50944 0.34% 143 51382 0.34% 144 53895 0.36% 145 54323 0.36% 146 54754 0.37% 147 54645 0.37% 148 55940 0.37% 149 55250 0.37% 150 56769 0.38% 151 12993625 86.84% 14961958 reads passed initial QC criterion=sequence-density sequence-density=0.96 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=19 prefix-density=0.97 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=23 fanout-score=9.37 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=3.2 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=1.03 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=14 prefix-density=1.46 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=21.36 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=2.1 sequence=GCCAAAACTCTGCATTTGCTAGCTAGAAGTCACTCTACCCTTCGCATTACTTCCTCAATCAACCACTGCTGTTTGATCATGGCAGCAACCATCTCAACCGTTGGAGCTGTCAACACAGCACCGCTGGCTTTGAATGGCTCTGGCGCTGGATCCACAGTCCCAAATTCAGCTTTCTTTGGCAACAGCTTGAAGAAAGTGAGCTCATCAAGGTTCACAAACTCCAAAATTTCACCAGGGAGCTTCAAGGTTGTTGCAGAGTACGATGAGAAGAAGCAGACCGACAAGGACAGATGGGGAGGCCTTGTTACAGACATGTCTGATGACCAACAAGATATCAGCAGAGGAAAGGGTATGGTGGACTCTCTTTTCCAAGCCCCCCAGGGAACTGGAACTCACAACCCCGTTTTGAATTCTTATGAGTATCTCAGTCAAGGTCTTCGTACGTACAACTTGGACAACAACATGGATGGTTTCTACATTGCTCCTGCTTTCATGGACAAGCTTGTTGTTC SRR12690127 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:58:03 Started mapping on | Feb 10 16:58:03 Finished on | Feb 10 16:59:32 Mapping speed, Million of reads per hour | 605.20 Number of input reads | 14961958 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13991045 Uniquely mapped reads % | 93.51% Average mapped length | 294.60 Number of splices: Total | 15279263 Number of splices: Annotated (sjdb) | 15037692 Number of splices: GT/AG | 14951924 Number of splices: GC/AG | 280013 Number of splices: AT/AC | 12853 Number of splices: Non-canonical | 34473 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 327131 % of reads mapped to multiple loci | 2.19% Number of reads mapped to too many loci | 155806 % of reads mapped to too many loci | 1.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.00% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 643782 643782 643782 N_multimapping 327131 327131 327131 N_noFeature 297833 13802964 334303 N_ambiguous 240056 816 87941 UnstrandedReadsAssigned:13453156 PositiveStrandReadsAssigned:187265 NegativeStrandReadsAssigned:13568801 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690127 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690127-trimmed-pair1.fastq SRR12690127-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,961,958 reads, 13,721,175 reads pseudoaligned [quant] estimated average fragment length: 243.803 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52401 SRR12690127.ke.tsv 34699 SRR12690127.se.tsv 87100 total ==> SRR12690127.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.2 441 14.1047 Potri.005G024800.1.v4.1 1035 792.197 337 24.1529 Potri.004G059700.1.v4.1 961 718.279 20 1.58092 Potri.007G009000.2.v4.1 1416 1173.2 0 0 Potri.003G141000.2.v4.1 2943 2700.2 365.437 7.68404 Potri.016G087400.1.v4.1 270 87.974 718 463.386 Potri.015G069301.1.v4.1 564 331.841 0 0 Potri.010G195200.1.v4.1 1773 1530.2 4 0.148418 Potri.012G127500.1.v4.1 977 734.225 77 5.95436 ==> SRR12690127.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 94 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 286 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 17 SRR12690127 completed mapping pipeline successfully