Starting /dee2/code/volunteer_pipeline.sh SRR12690128 current disk space = 3058215620608 free memory = 1294788920 SRR12690128 SRAfilesize b42b9f1d4be6ba199ed0e2f04963dbb4 SRR12690128.sra SRR12690128.sra file validated SRR12690128 is paired end SRR12690128 is conventional basespace SRR12690128 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690128_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5985 37.0 37.0 37.0 37.0 37.0 2 36.419 37.0 37.0 37.0 37.0 37.0 3 36.6495 37.0 37.0 37.0 37.0 37.0 4 36.6645 37.0 37.0 37.0 37.0 37.0 5 36.642 37.0 37.0 37.0 37.0 37.0 6 36.6705 37.0 37.0 37.0 37.0 37.0 7 36.599 37.0 37.0 37.0 37.0 37.0 8 36.5935 37.0 37.0 37.0 37.0 37.0 9 36.6155 37.0 37.0 37.0 37.0 37.0 10-14 36.6086 37.0 37.0 37.0 37.0 37.0 15-19 36.572399999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.5844 37.0 37.0 37.0 37.0 37.0 25-29 36.5446 37.0 37.0 37.0 37.0 37.0 30-34 36.5192 37.0 37.0 37.0 37.0 37.0 35-39 36.4918 37.0 37.0 37.0 37.0 37.0 40-44 36.511 37.0 37.0 37.0 37.0 37.0 45-49 36.4533 37.0 37.0 37.0 37.0 37.0 50-54 36.4213 37.0 37.0 37.0 37.0 37.0 55-59 36.323800000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.4117 37.0 37.0 37.0 37.0 37.0 65-69 36.33240000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.3412 37.0 37.0 37.0 37.0 37.0 75-79 36.3875 37.0 37.0 37.0 37.0 37.0 80-84 36.291700000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.320800000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.2919 37.0 37.0 37.0 37.0 37.0 95-99 36.231700000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.1714 37.0 37.0 37.0 37.0 37.0 105-109 36.2097 37.0 37.0 37.0 37.0 37.0 110-114 36.1816 37.0 37.0 37.0 37.0 37.0 115-119 36.116 37.0 37.0 37.0 37.0 37.0 120-124 36.0084 37.0 37.0 37.0 37.0 37.0 125-129 36.0484 37.0 37.0 37.0 37.0 37.0 130-134 36.03869999999999 37.0 37.0 37.0 37.0 37.0 135-139 36.00750000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.8468 37.0 37.0 37.0 37.0 37.0 145-149 35.7315 37.0 37.0 37.0 37.0 37.0 150-151 35.56325 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 0.0 23 1.0 24 0.0 25 1.0 26 4.0 27 5.0 28 11.0 29 14.0 30 18.0 31 38.0 32 52.0 33 64.0 34 116.0 35 291.0 36 3012.0 37 371.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.85 14.674999999999999 7.249999999999999 35.225 2 21.245605223505777 12.481165243596184 34.70617780010045 31.56705173279759 3 18.075 14.524999999999999 28.475 38.925 4 21.349999999999998 21.325 26.0 31.324999999999996 5 22.95 28.575 23.075000000000003 25.4 6 23.599999999999998 30.9 22.7 22.8 7 18.3 27.750000000000004 37.425000000000004 16.525000000000002 8 18.5 28.625 29.875 23.0 9 18.5 24.675 33.074999999999996 23.75 10-14 20.07 28.660000000000004 27.045 24.224999999999998 15-19 20.645 28.249999999999996 26.865 24.240000000000002 20-24 20.865000000000002 27.96 27.305 23.87 25-29 21.33 27.725 26.584999999999997 24.36 30-34 20.09 27.900000000000002 27.139999999999997 24.87 35-39 20.544999999999998 27.24 27.76 24.455 40-44 19.869999999999997 28.110000000000003 26.779999999999998 25.240000000000002 45-49 21.11 27.639999999999997 27.07 24.18 50-54 20.974999999999998 27.224999999999998 27.250000000000004 24.55 55-59 20.945 27.61 26.889999999999997 24.555 60-64 21.87 27.35 26.465 24.315 65-69 21.029999999999998 27.425 26.82 24.725 70-74 21.2 27.37 26.340000000000003 25.09 75-79 20.685000000000002 27.08 27.21 25.025 80-84 21.07 27.810000000000002 26.72 24.4 85-89 21.415 27.105 26.465 25.014999999999997 90-94 21.215 27.63 26.99 24.165 95-99 21.505 26.125 27.505000000000003 24.865000000000002 100-104 21.560000000000002 27.13 27.065 24.245 105-109 22.05 27.42 26.009999999999998 24.52 110-114 21.61 27.750000000000004 26.974999999999998 23.665 115-119 21.990000000000002 27.505000000000003 26.419999999999998 24.085 120-124 22.225 27.165 26.55 24.060000000000002 125-129 21.57 27.515 26.384999999999998 24.529999999999998 130-134 21.54 27.47 26.855 24.135 135-139 22.57 27.055 26.484999999999996 23.89 140-144 21.89 27.48 25.779999999999998 24.85 145-149 21.87 26.5 26.905 24.725 150-151 22.9625 26.3125 26.275 24.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 0.5 25 3.0 26 6.5 27 6.5 28 5.5 29 9.5 30 10.5 31 19.0 32 32.0 33 32.5 34 38.0 35 46.0 36 59.0 37 72.5 38 86.0 39 108.0 40 142.0 41 156.5 42 174.5 43 218.0 44 240.5 45 239.0 46 238.0 47 257.5 48 278.5 49 265.0 50 234.0 51 200.5 52 172.0 53 150.5 54 115.5 55 81.5 56 67.5 57 61.5 58 42.5 59 32.0 60 27.0 61 18.0 62 11.5 63 9.5 64 8.0 65 5.5 66 3.5 67 1.0 68 1.0 69 1.5 70 1.5 71 1.0 72 0.5 73 1.0 74 1.0 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.44999999999999996 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.275 #Duplication Level Percentage of deduplicated Percentage of total 1 90.66740515092772 81.85 2 8.224868457491 14.85 3 0.8584879534754916 2.325 4 0.1938521185267239 0.7000000000000001 5 0.027693159789531983 0.125 6 0.027693159789531983 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGTAGCTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGTGAGCT 6 0.15 No Hit GTCCAGTAGCGTCCATCATAGTACCCTGGTGAGCTGTGGTGCTCACGGTA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5249999999999999 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.1375 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.4249999999999998 0.0 0.0 0.0 0.0 106-107 1.5625 0.0 0.0 0.0 0.0 108-109 1.7875 0.0 0.0 0.0 0.0 110-111 2.0125 0.0 0.0 0.0 0.0 112-113 2.2 0.0 0.0 0.0 0.0 114-115 2.3625 0.0 0.0 0.0 0.0 116-117 2.6125 0.0 0.0 0.0 0.0 118-119 3.0375 0.0 0.0 0.0 0.0 120-121 3.425 0.0 0.0 0.0 0.0 122-123 3.9875000000000003 0.0 0.0 0.0 0.0 124-125 4.4375 0.0 0.0 0.0 0.0 126-127 4.7625 0.0 0.0 0.0 0.0 128-129 5.237500000000001 0.0 0.0 0.0 0.0 130-131 5.8375 0.0 0.0 0.0 0.0 132-133 6.4375 0.0 0.0 0.0 0.0 134-135 7.1 0.0 0.0 0.0 0.0 136-137 7.5875 0.0 0.0 0.0 0.0 138-139 8.087499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTGTC 10 0.006830828 145.0 1 TTGTCCC 10 0.006830828 145.0 3 GTCCCAG 10 0.006830828 145.0 5 CAGGACG 10 0.006830828 145.0 9 TTTGTCC 10 0.006830828 145.0 2 CCAGGAC 10 0.006830828 145.0 8 AAAAAAA 40 0.0076550315 18.125 40-44 >>END_MODULE SRR12690128 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690128_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.443 37.0 37.0 37.0 37.0 37.0 2 36.226 37.0 37.0 37.0 37.0 37.0 3 36.357 37.0 37.0 37.0 37.0 37.0 4 36.3335 37.0 37.0 37.0 37.0 37.0 5 36.3895 37.0 37.0 37.0 37.0 37.0 6 36.3595 37.0 37.0 37.0 37.0 37.0 7 36.4005 37.0 37.0 37.0 37.0 37.0 8 36.3955 37.0 37.0 37.0 37.0 37.0 9 36.389 37.0 37.0 37.0 37.0 37.0 10-14 36.3169 37.0 37.0 37.0 37.0 37.0 15-19 36.319599999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.3501 37.0 37.0 37.0 37.0 37.0 25-29 36.297200000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.2447 37.0 37.0 37.0 37.0 37.0 35-39 36.221199999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.194900000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.1376 37.0 37.0 37.0 37.0 37.0 50-54 36.1282 37.0 37.0 37.0 37.0 37.0 55-59 36.129200000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.0948 37.0 37.0 37.0 37.0 37.0 65-69 36.1002 37.0 37.0 37.0 37.0 37.0 70-74 35.9953 37.0 37.0 37.0 37.0 37.0 75-79 36.017399999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.0313 37.0 37.0 37.0 37.0 37.0 85-89 36.0299 37.0 37.0 37.0 37.0 37.0 90-94 35.915099999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.0401 37.0 37.0 37.0 37.0 37.0 100-104 36.039300000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.9799 37.0 37.0 37.0 37.0 37.0 110-114 35.9105 37.0 37.0 37.0 37.0 37.0 115-119 35.8852 37.0 37.0 37.0 37.0 37.0 120-124 35.7638 37.0 37.0 37.0 37.0 37.0 125-129 35.7532 37.0 37.0 37.0 37.0 37.0 130-134 35.661500000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.61710000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.463499999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.3254 37.0 37.0 37.0 32.2 37.0 150-151 34.864 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 3.0 14 1.0 15 2.0 16 1.0 17 3.0 18 0.0 19 4.0 20 0.0 21 3.0 22 3.0 23 5.0 24 4.0 25 5.0 26 9.0 27 6.0 28 6.0 29 23.0 30 30.0 31 27.0 32 61.0 33 77.0 34 154.0 35 447.0 36 2798.0 37 325.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.675 25.35 8.4 25.575 2 28.875 27.925 26.85 16.35 3 21.375 28.4 28.825 21.4 4 23.200000000000003 34.300000000000004 22.7 19.8 5 26.125 36.575 21.3 16.0 6 22.3 37.3 21.775 18.625 7 23.0 24.65 33.625 18.725 8 22.650000000000002 26.974999999999998 25.874999999999996 24.5 9 22.75 24.65 27.250000000000004 25.35 10-14 24.485 28.910000000000004 25.169999999999998 21.435000000000002 15-19 24.345 28.395 25.75 21.51 20-24 23.98 28.315 25.679999999999996 22.025 25-29 23.785 28.199999999999996 26.16 21.855 30-34 23.674999999999997 28.249999999999996 26.279999999999998 21.795 35-39 23.885 27.435 26.735 21.945 40-44 24.035 27.57 26.52 21.875 45-49 23.385 27.58 26.729999999999997 22.305 50-54 24.01 27.215 26.575 22.2 55-59 24.515 26.945000000000004 26.450000000000003 22.09 60-64 24.205 27.255000000000003 26.6 21.94 65-69 24.490000000000002 26.945000000000004 26.56 22.005 70-74 24.67 27.35 26.26 21.72 75-79 24.495 27.0 26.63 21.875 80-84 24.725 27.639999999999997 25.455 22.18 85-89 24.125 27.305 26.490000000000002 22.08 90-94 24.87 26.1 26.945000000000004 22.085 95-99 24.5 27.084999999999997 26.85 21.565 100-104 25.185000000000002 27.474999999999998 26.064999999999998 21.275 105-109 24.099999999999998 27.115000000000002 27.125 21.66 110-114 24.365000000000002 27.215 26.47 21.95 115-119 24.455 27.800000000000004 26.529999999999998 21.215 120-124 25.275 27.334999999999997 26.179999999999996 21.21 125-129 25.52 27.175 25.795 21.51 130-134 26.025 27.18 26.005 20.79 135-139 25.46 26.974999999999998 26.674999999999997 20.89 140-144 26.279999999999998 27.125 25.56 21.035 145-149 26.345000000000002 27.029999999999998 25.535000000000004 21.09 150-151 26.4125 26.650000000000002 25.887500000000003 21.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 1.0 11 1.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 1.0 25 0.5 26 1.0 27 2.0 28 6.5 29 6.5 30 3.5 31 6.0 32 9.0 33 16.0 34 24.5 35 31.0 36 47.0 37 70.0 38 87.5 39 111.0 40 138.0 41 168.0 42 207.5 43 241.0 44 269.0 45 287.0 46 294.0 47 292.0 48 267.0 49 247.0 50 228.5 51 188.5 52 154.0 53 127.5 54 114.5 55 84.0 56 56.0 57 54.5 58 36.5 59 23.0 60 22.5 61 19.0 62 11.5 63 5.5 64 4.0 65 2.0 66 0.0 67 1.0 68 2.5 69 2.0 70 2.0 71 2.5 72 1.5 73 1.0 74 1.0 75 1.0 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.5 98 1.5 99 1.0 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.7 #Duplication Level Percentage of deduplicated Percentage of total 1 90.57971014492753 81.25 2 8.138238573021182 14.6 3 0.919732441471572 2.475 4 0.2229654403567447 0.8 5 0.027870680044593088 0.125 6 0.027870680044593088 0.15 7 0.055741360089186176 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.027870680044593088 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit CTGCATAGCTTACAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 7 0.17500000000000002 No Hit GGGAGCACTGCATAGCTTACAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 7 0.17500000000000002 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit CACCACACCACAGGGCTAGAATGGCAACAATAGCTGGTCTTAACCTCTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.8500000000000001 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.2999999999999998 0.0 0.0 0.0 0.0 104-105 1.4500000000000002 0.0 0.0 0.0 0.0 106-107 1.6125 0.0 0.0 0.0 0.0 108-109 1.8250000000000002 0.0 0.0 0.0 0.0 110-111 2.0375 0.0 0.0 0.0 0.0 112-113 2.225 0.0 0.0 0.0 0.0 114-115 2.3875 0.0 0.0 0.0 0.0 116-117 2.625 0.0 0.0 0.0 0.0 118-119 3.0 0.0 0.0 0.0 0.0 120-121 3.375 0.0 0.0 0.0 0.0 122-123 3.9375 0.0 0.0 0.0 0.0 124-125 4.387499999999999 0.0 0.0 0.0 0.0 126-127 4.7125 0.0 0.0 0.0 0.0 128-129 5.15 0.0 0.0 0.0 0.0 130-131 5.7375 0.0 0.0 0.0 0.0 132-133 6.3375 0.0 0.0 0.0 0.0 134-135 7.0 0.0 0.0 0.0 0.0 136-137 7.5125 0.0 0.0 0.0 0.0 138-139 8.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTCC 10 0.006830828 145.0 8 CATTCAC 10 0.006830828 145.0 9 ACATTCA 10 0.006830828 145.0 8 AGCGCCC 10 0.006830828 145.0 7 GCTCAAC 10 0.006830828 145.0 3 CTCAACA 10 0.006830828 145.0 4 AACATTC 10 0.006830828 145.0 7 TTTTTTT 40 0.0076550315 18.125 130-134 >>END_MODULE Read 690586 spots for SRR12690128.sra Written 690586 spots for SRR12690128.sra Read 690586 spots for SRR12690128.sra Written 690586 spots for SRR12690128.sra Read 690586 spots for SRR12690128.sra Written 690586 spots for SRR12690128.sra Read 690586 spots for SRR12690128.sra Written 690586 spots for SRR12690128.sra Read 690586 spots for SRR12690128.sra Written 690586 spots for SRR12690128.sra Read 690586 spots for SRR12690128.sra Written 690586 spots for SRR12690128.sra Read 690586 spots for SRR12690128.sra Written 690586 spots for SRR12690128.sra Read 690587 spots for SRR12690128.sra Written 690587 spots for SRR12690128.sra Read 690586 spots for SRR12690128.sra Written 690586 spots for SRR12690128.sra Read 690586 spots for SRR12690128.sra Written 690586 spots for SRR12690128.sra Read 690586 spots for SRR12690128.sra Written 690586 spots for SRR12690128.sra Read 690586 spots for SRR12690128.sra Written 690586 spots for SRR12690128.sra Read 690586 spots for SRR12690128.sra Written 690586 spots for SRR12690128.sra Read 690586 spots for SRR12690128.sra Written 690586 spots for SRR12690128.sra Read 690586 spots for SRR12690128.sra Written 690586 spots for SRR12690128.sra Read 690586 spots for SRR12690128.sra Written 690586 spots for SRR12690128.sra Read 690586 spots for SRR12690128.sra Written 690586 spots for SRR12690128.sra Read 690586 spots for SRR12690128.sra Written 690586 spots for SRR12690128.sra Read 690586 spots for SRR12690128.sra Written 690586 spots for SRR12690128.sra Read 690586 spots for SRR12690128.sra Written 690586 spots for SRR12690128.sra SRR ids: ['SRR12690128.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6q8dkt4w SRR12690128.sra spots: 13811721 blocks: [[1, 690586], [690587, 1381172], [1381173, 2071758], [2071759, 2762344], [2762345, 3452930], [3452931, 4143516], [4143517, 4834102], [4834103, 5524688], [5524689, 6215274], [6215275, 6905860], [6905861, 7596446], [7596447, 8287032], [8287033, 8977618], [8977619, 9668204], [9668205, 10358790], [10358791, 11049376], [11049377, 11739962], [11739963, 12430548], [12430549, 13121134], [13121135, 13811721]] SRR12690128 file size 4672126 SRR12690128 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690128 SRR12690128_1.fastq SRR12690128_2.fastq Input file: SRR12690128_1.fastq Paired file: SRR12690128_2.fastq trimmed: SRR12690128-trimmed-pair1.fastq, SRR12690128-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:02:12 2025 >> started Mon Feb 10 17:02:35 2025 >> done (23.284s) 13811721 read pairs processed; of these: 32 ( 0.00%) short read pairs filtered out after trimming by size control 20403 ( 0.15%) empty read pairs filtered out after trimming by size control 13791286 (99.85%) read pairs available; of these: 1849037 (13.41%) trimmed read pairs available after processing 11942249 (86.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 7 0.00% 21 8 0.00% 22 15 0.00% 23 14 0.00% 24 23 0.00% 25 27 0.00% 26 38 0.00% 27 40 0.00% 28 38 0.00% 29 37 0.00% 30 37 0.00% 31 50 0.00% 32 55 0.00% 33 54 0.00% 34 68 0.00% 35 57 0.00% 36 61 0.00% 37 50 0.00% 38 67 0.00% 39 79 0.00% 40 84 0.00% 41 89 0.00% 42 98 0.00% 43 102 0.00% 44 109 0.00% 45 102 0.00% 46 109 0.00% 47 118 0.00% 48 124 0.00% 49 120 0.00% 50 185 0.00% 51 163 0.00% 52 207 0.00% 53 231 0.00% 54 226 0.00% 55 225 0.00% 56 249 0.00% 57 248 0.00% 58 314 0.00% 59 316 0.00% 60 371 0.00% 61 389 0.00% 62 444 0.00% 63 480 0.00% 64 492 0.00% 65 525 0.00% 66 606 0.00% 67 659 0.00% 68 703 0.01% 69 809 0.01% 70 906 0.01% 71 1061 0.01% 72 1110 0.01% 73 1345 0.01% 74 1524 0.01% 75 1498 0.01% 76 1800 0.01% 77 1911 0.01% 78 2031 0.01% 79 2321 0.02% 80 2615 0.02% 81 2931 0.02% 82 3247 0.02% 83 3436 0.02% 84 3848 0.03% 85 4394 0.03% 86 4749 0.03% 87 4895 0.04% 88 5473 0.04% 89 5915 0.04% 90 6502 0.05% 91 6994 0.05% 92 7581 0.05% 93 8142 0.06% 94 8567 0.06% 95 9334 0.07% 96 9540 0.07% 97 10287 0.07% 98 11030 0.08% 99 11679 0.08% 100 12509 0.09% 101 12807 0.09% 102 13638 0.10% 103 14368 0.10% 104 14853 0.11% 105 15467 0.11% 106 16317 0.12% 107 17053 0.12% 108 17803 0.13% 109 18970 0.14% 110 19305 0.14% 111 19929 0.14% 112 20927 0.15% 113 21031 0.15% 114 22164 0.16% 115 23409 0.17% 116 24145 0.18% 117 25458 0.18% 118 26259 0.19% 119 26771 0.19% 120 27761 0.20% 121 28699 0.21% 122 29264 0.21% 123 31083 0.23% 124 31864 0.23% 125 32687 0.24% 126 33552 0.24% 127 35010 0.25% 128 35609 0.26% 129 36663 0.27% 130 37746 0.27% 131 38340 0.28% 132 39173 0.28% 133 41016 0.30% 134 41324 0.30% 135 42967 0.31% 136 43360 0.31% 137 44082 0.32% 138 44670 0.32% 139 46804 0.34% 140 46055 0.33% 141 48169 0.35% 142 49010 0.36% 143 50012 0.36% 144 51141 0.37% 145 52787 0.38% 146 52629 0.38% 147 52612 0.38% 148 54718 0.40% 149 55018 0.40% 150 55634 0.40% 151 11942249 86.59% 13791286 reads passed initial QC criterion=sequence-density sequence-density=1.51 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=16 prefix-density=1.52 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.22 sequence-density-rank=18 fanout-score=8.53 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=3.5 sequence=GAGCTTCACCGTGTATGCTGCCATTGCTTTAACACGTCCTCCTCGACTGGCTTTCAAGCCAAGAAGAGACTCCCCCACGTTGGGAAGTGCCCGTAGGCTTGTCACTGGCACCCGGCGAGTAAACGATGTGCTGACCATGGCGCTGGAGAGGGCTGCTGTGGTGGCCATTCTCTCTGTC criterion=sequence-density sequence-density=1.26 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=24 prefix-density=1.25 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.28 sequence-density-rank=18 fanout-score=16.29 fanout-score-rank=1 prefix-density=1.10 prefix-fanout=4.1 sequence=AATGGCAGCCTCAGTTATGGCTTCACTGAACCTGAAACCATCTCCATTCACGGTTGAGAAGTCTTCAGTGAGAGGCCTCCCAACTCTTTCAAGGAGATCTTTCAAGATT SRR12690128 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:03:53 Started mapping on | Feb 10 17:03:53 Finished on | Feb 10 17:05:36 Mapping speed, Million of reads per hour | 482.03 Number of input reads | 13791286 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 12845841 Uniquely mapped reads % | 93.14% Average mapped length | 294.72 Number of splices: Total | 13047147 Number of splices: Annotated (sjdb) | 12837855 Number of splices: GT/AG | 12775667 Number of splices: GC/AG | 230572 Number of splices: AT/AC | 10845 Number of splices: Non-canonical | 30063 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.69 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 425900 % of reads mapped to multiple loci | 3.09% Number of reads mapped to too many loci | 188406 % of reads mapped to too many loci | 1.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.13% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 519545 519545 519545 N_multimapping 425900 425900 425900 N_noFeature 264267 12701905 294667 N_ambiguous 212351 701 98335 UnstrandedReadsAssigned:12369223 PositiveStrandReadsAssigned:143235 NegativeStrandReadsAssigned:12452839 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690128 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690128-trimmed-pair1.fastq SRR12690128-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,791,286 reads, 12,653,682 reads pseudoaligned [quant] estimated average fragment length: 230.335 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52401 SRR12690128.ke.tsv 34699 SRR12690128.se.tsv 87100 total ==> SRR12690128.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.66 307 10.5987 Potri.005G024800.1.v4.1 1035 805.665 67 5.13526 Potri.004G059700.1.v4.1 961 731.674 56 4.7262 Potri.007G009000.2.v4.1 1416 1186.66 0 0 Potri.003G141000.2.v4.1 2943 2713.66 178 4.05048 Potri.016G087400.1.v4.1 270 85.9082 979.797 704.278 Potri.015G069301.1.v4.1 564 338.55 0 0 Potri.010G195200.1.v4.1 1773 1543.66 0 0 Potri.012G127500.1.v4.1 977 747.67 1332 110.011 ==> SRR12690128.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 211 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR12690128 completed mapping pipeline successfully