Starting /dee2/code/volunteer_pipeline.sh SRR12690130 current disk space = 3058195046400 free memory = 1160764548 SRR12690130 SRAfilesize ad6f3c7374a47dbc952a3e7c17ca6135 SRR12690130.sra SRR12690130.sra file validated SRR12690130 is paired end SRR12690130 is conventional basespace SRR12690130 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690130_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6335 37.0 37.0 37.0 37.0 37.0 2 36.36825 37.0 37.0 37.0 37.0 37.0 3 36.6275 37.0 37.0 37.0 37.0 37.0 4 36.6655 37.0 37.0 37.0 37.0 37.0 5 36.6665 37.0 37.0 37.0 37.0 37.0 6 36.611 37.0 37.0 37.0 37.0 37.0 7 36.5985 37.0 37.0 37.0 37.0 37.0 8 36.5955 37.0 37.0 37.0 37.0 37.0 9 36.5775 37.0 37.0 37.0 37.0 37.0 10-14 36.6149 37.0 37.0 37.0 37.0 37.0 15-19 36.5654 37.0 37.0 37.0 37.0 37.0 20-24 36.598400000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.5259 37.0 37.0 37.0 37.0 37.0 30-34 36.5209 37.0 37.0 37.0 37.0 37.0 35-39 36.4858 37.0 37.0 37.0 37.0 37.0 40-44 36.4839 37.0 37.0 37.0 37.0 37.0 45-49 36.4401 37.0 37.0 37.0 37.0 37.0 50-54 36.4461 37.0 37.0 37.0 37.0 37.0 55-59 36.387299999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.423899999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.3544 37.0 37.0 37.0 37.0 37.0 70-74 36.3677 37.0 37.0 37.0 37.0 37.0 75-79 36.343900000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.2784 37.0 37.0 37.0 37.0 37.0 85-89 36.2862 37.0 37.0 37.0 37.0 37.0 90-94 36.2789 37.0 37.0 37.0 37.0 37.0 95-99 36.191500000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.172399999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.1548 37.0 37.0 37.0 37.0 37.0 110-114 36.1489 37.0 37.0 37.0 37.0 37.0 115-119 36.0887 37.0 37.0 37.0 37.0 37.0 120-124 36.0661 37.0 37.0 37.0 37.0 37.0 125-129 36.0322 37.0 37.0 37.0 37.0 37.0 130-134 36.0045 37.0 37.0 37.0 37.0 37.0 135-139 36.0233 37.0 37.0 37.0 37.0 37.0 140-144 35.8196 37.0 37.0 37.0 37.0 37.0 145-149 35.6988 37.0 37.0 37.0 37.0 37.0 150-151 35.581999999999994 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 0.0 25 3.0 26 6.0 27 3.0 28 6.0 29 16.0 30 20.0 31 37.0 32 37.0 33 64.0 34 113.0 35 359.0 36 2987.0 37 347.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.699999999999996 12.775 6.550000000000001 38.975 2 20.58159939834545 11.381298571070444 37.35271997994485 30.684382050639257 3 16.5 15.075 28.075 40.35 4 21.075 23.325000000000003 25.3 30.3 5 24.825 28.575 24.85 21.75 6 21.6 32.5 23.625 22.275 7 15.925 26.75 39.725 17.599999999999998 8 16.7 26.775 32.625 23.9 9 17.675 24.625 35.05 22.650000000000002 10-14 19.855 29.21 27.500000000000004 23.435 15-19 20.14 27.889999999999997 27.875 24.095 20-24 20.085 28.055000000000003 27.97 23.89 25-29 19.885 28.26 28.105000000000004 23.75 30-34 19.869999999999997 28.76 27.389999999999997 23.98 35-39 20.23 28.04 27.715 24.015 40-44 20.200000000000003 27.915 27.715 24.169999999999998 45-49 20.665 28.09 27.22 24.025 50-54 20.485 27.860000000000003 27.395000000000003 24.26 55-59 20.235 28.425 27.145000000000003 24.195 60-64 20.87 27.38 27.845 23.905 65-69 20.635 27.68 27.295 24.39 70-74 20.36 28.08 27.500000000000004 24.060000000000002 75-79 20.395 27.87 27.705000000000002 24.03 80-84 20.21 28.34 27.47 23.98 85-89 20.465 27.77 27.584999999999997 24.18 90-94 20.61 28.060000000000002 27.57 23.76 95-99 20.615 27.68 27.76 23.945 100-104 20.805 28.18 27.66 23.355 105-109 20.625 28.335 27.245 23.794999999999998 110-114 20.22 28.110000000000003 27.55 24.12 115-119 21.095 27.860000000000003 27.200000000000003 23.845 120-124 21.355 27.58 27.125 23.94 125-129 20.735 27.54 27.13 24.595 130-134 20.78 27.450000000000003 27.67 24.099999999999998 135-139 21.61 27.705000000000002 26.655 24.03 140-144 20.765 27.41 27.400000000000002 24.425 145-149 21.060000000000002 28.395 26.83 23.715 150-151 22.275 27.6 26.5 23.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.0 24 0.5 25 1.5 26 3.5 27 5.5 28 7.5 29 11.5 30 15.0 31 20.5 32 29.5 33 31.0 34 41.0 35 59.5 36 77.5 37 99.5 38 118.0 39 138.5 40 174.0 41 206.0 42 229.5 43 245.0 44 264.0 45 279.5 46 272.5 47 253.5 48 237.5 49 225.5 50 195.0 51 150.5 52 128.5 53 115.0 54 91.0 55 69.5 56 47.5 57 36.5 58 31.0 59 23.0 60 17.0 61 13.5 62 9.5 63 7.5 64 4.0 65 1.5 66 2.0 67 1.5 68 0.5 69 1.0 70 1.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.175 #Duplication Level Percentage of deduplicated Percentage of total 1 92.4871168972064 85.25 2 6.672091131000814 12.3 3 0.7594250067805803 2.1 4 0.054244643341470035 0.2 5 0.0 0.0 6 0.027122321670735017 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCAGTAGCGTCCATCATAGTACCCTGGTGAGCTGTGGTGCTCACGGTA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 0.9625 0.0 0.0 0.0 0.0 104-105 1.1124999999999998 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.6375 0.0 0.0 0.0 0.0 112-113 1.7875 0.0 0.0 0.0 0.0 114-115 2.025 0.0 0.0 0.0 0.0 116-117 2.3375 0.0 0.0 0.0 0.0 118-119 2.5625 0.0 0.0 0.0 0.0 120-121 2.7125 0.0 0.0 0.0 0.0 122-123 2.8625 0.0 0.0 0.0 0.0 124-125 3.125 0.0 0.0 0.0 0.0 126-127 3.5 0.0 0.0 0.0 0.0 128-129 3.9000000000000004 0.0 0.0 0.0 0.0 130-131 4.262499999999999 0.0 0.0 0.0 0.0 132-133 4.5625 0.0 0.0 0.0 0.0 134-135 4.9875 0.0 0.0 0.0 0.0 136-137 5.3375 0.0 0.0 0.0 0.0 138-139 5.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATATCAA 10 0.006830828 145.0 8 >>END_MODULE SRR12690130 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690130_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.168 37.0 37.0 37.0 37.0 37.0 2 35.7805 37.0 37.0 37.0 37.0 37.0 3 36.0595 37.0 37.0 37.0 37.0 37.0 4 36.1 37.0 37.0 37.0 37.0 37.0 5 36.1875 37.0 37.0 37.0 37.0 37.0 6 36.1755 37.0 37.0 37.0 37.0 37.0 7 36.258 37.0 37.0 37.0 37.0 37.0 8 36.2435 37.0 37.0 37.0 37.0 37.0 9 36.225 37.0 37.0 37.0 37.0 37.0 10-14 36.1594 37.0 37.0 37.0 37.0 37.0 15-19 36.18300000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.1976 37.0 37.0 37.0 37.0 37.0 25-29 36.146 37.0 37.0 37.0 37.0 37.0 30-34 36.0604 37.0 37.0 37.0 37.0 37.0 35-39 36.0678 37.0 37.0 37.0 37.0 37.0 40-44 36.0629 37.0 37.0 37.0 37.0 37.0 45-49 35.9955 37.0 37.0 37.0 37.0 37.0 50-54 35.9901 37.0 37.0 37.0 37.0 37.0 55-59 35.9811 37.0 37.0 37.0 37.0 37.0 60-64 35.898399999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.8981 37.0 37.0 37.0 37.0 37.0 70-74 35.861200000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.8724 37.0 37.0 37.0 37.0 37.0 80-84 35.838800000000006 37.0 37.0 37.0 37.0 37.0 85-89 35.8603 37.0 37.0 37.0 37.0 37.0 90-94 35.78159999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.7111 37.0 37.0 37.0 37.0 37.0 100-104 35.7686 37.0 37.0 37.0 37.0 37.0 105-109 35.7467 37.0 37.0 37.0 37.0 37.0 110-114 35.66330000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.6035 37.0 37.0 37.0 37.0 37.0 120-124 35.5119 37.0 37.0 37.0 37.0 37.0 125-129 35.4593 37.0 37.0 37.0 37.0 37.0 130-134 35.467400000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.354 37.0 37.0 37.0 37.0 37.0 140-144 35.3329 37.0 37.0 37.0 32.2 37.0 145-149 35.1663 37.0 37.0 37.0 29.8 37.0 150-151 34.8565 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 1.0 15 1.0 16 1.0 17 1.0 18 4.0 19 3.0 20 1.0 21 3.0 22 2.0 23 3.0 24 6.0 25 8.0 26 4.0 27 9.0 28 15.0 29 19.0 30 35.0 31 42.0 32 78.0 33 135.0 34 238.0 35 595.0 36 2556.0 37 237.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.3 25.6 10.35 25.75 2 29.475 26.85 27.650000000000002 16.025 3 19.875 29.5 31.374999999999996 19.25 4 23.625 34.575 23.599999999999998 18.2 5 25.5 36.875 21.175 16.45 6 20.5 40.0 22.275 17.224999999999998 7 21.2 21.825 38.074999999999996 18.9 8 22.125 26.025 27.575 24.275 9 20.7 24.375 30.975 23.95 10-14 23.35 29.505 25.855 21.29 15-19 23.29 28.715000000000003 26.8 21.195 20-24 21.935 28.994999999999997 27.47 21.6 25-29 22.655 28.68 27.415 21.25 30-34 22.455 29.385 27.22 20.94 35-39 22.855 27.935 28.07 21.14 40-44 22.689999999999998 28.485 27.63 21.195 45-49 23.345 28.12 27.145000000000003 21.39 50-54 23.86 28.015 27.32 20.805 55-59 23.150000000000002 28.439999999999998 27.435 20.974999999999998 60-64 23.41 28.49 26.97 21.13 65-69 23.244999999999997 28.025 27.195000000000004 21.535 70-74 23.724999999999998 28.275 27.3 20.7 75-79 23.525 27.779999999999998 27.169999999999998 21.525 80-84 23.265 28.165000000000003 26.884999999999998 21.685 85-89 23.669999999999998 28.155 26.57 21.605 90-94 23.24 27.685 27.43 21.645 95-99 23.86 27.634999999999998 26.845000000000002 21.66 100-104 23.66 27.400000000000002 27.705000000000002 21.235 105-109 23.7 27.900000000000002 27.63 20.77 110-114 23.5 27.87 27.405 21.224999999999998 115-119 24.2 28.299999999999997 26.939999999999998 20.560000000000002 120-124 24.385 27.950000000000003 26.915 20.75 125-129 24.44 28.015 26.540000000000003 21.005 130-134 24.68 27.400000000000002 27.0 20.919999999999998 135-139 24.7 27.255000000000003 26.875 21.17 140-144 24.51 27.445000000000004 26.810000000000002 21.235 145-149 25.245 27.250000000000004 27.084999999999997 20.419999999999998 150-151 25.025 28.125 26.0 20.849999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 1.5 18 1.5 19 1.5 20 1.5 21 0.5 22 1.0 23 0.5 24 0.5 25 1.5 26 3.0 27 4.5 28 6.5 29 8.0 30 12.0 31 20.0 32 25.5 33 29.0 34 44.0 35 63.0 36 88.0 37 112.0 38 137.0 39 157.5 40 175.0 41 212.5 42 243.0 43 268.0 44 270.0 45 262.5 46 267.5 47 257.0 48 237.5 49 210.5 50 177.0 51 151.5 52 114.0 53 94.0 54 88.5 55 63.0 56 41.5 57 30.0 58 26.5 59 25.0 60 19.0 61 11.0 62 7.5 63 6.5 64 4.5 65 1.0 66 1.0 67 2.0 68 1.0 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.95 #Duplication Level Percentage of deduplicated Percentage of total 1 92.4415443175639 85.0 2 6.579662860250137 12.1 3 0.7884719956498096 2.175 4 0.1631321370309951 0.6 5 0.02718868950516585 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAAAGGCTAATGACATTACTTCCATTGCAAGCAATGGTGGACGAGTTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 0.9874999999999999 0.0 0.0 0.0 0.0 104-105 1.1375000000000002 0.0 0.0 0.0 0.0 106-107 1.3 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 1.8125 0.0 0.0 0.0 0.0 114-115 2.05 0.0 0.0 0.0 0.0 116-117 2.3625 0.0 0.0 0.0 0.0 118-119 2.5875 0.0 0.0 0.0 0.0 120-121 2.7375 0.0 0.0 0.0 0.0 122-123 2.8875 0.0 0.0 0.0 0.0 124-125 3.15 0.0 0.0 0.0 0.0 126-127 3.5 0.0 0.0 0.0 0.0 128-129 3.9124999999999996 0.0 0.0 0.0 0.0 130-131 4.2875 0.0 0.0 0.0 0.0 132-133 4.5875 0.0 0.0 0.0 0.0 134-135 5.0125 0.0 0.0 0.0 0.0 136-137 5.35 0.0 0.0 0.0 0.0 138-139 5.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 656289 spots for SRR12690130.sra Written 656289 spots for SRR12690130.sra Read 656289 spots for SRR12690130.sra Written 656289 spots for SRR12690130.sra Read 656289 spots for SRR12690130.sra Written 656289 spots for SRR12690130.sra Read 656289 spots for SRR12690130.sra Written 656289 spots for SRR12690130.sra Read 656289 spots for SRR12690130.sra Written 656289 spots for SRR12690130.sra Read 656289 spots for SRR12690130.sra Written 656289 spots for SRR12690130.sra Read 656289 spots for SRR12690130.sra Written 656289 spots for SRR12690130.sra Read 656289 spots for SRR12690130.sra Written 656289 spots for SRR12690130.sra Read 656289 spots for SRR12690130.sra Written 656289 spots for SRR12690130.sra Read 656289 spots for SRR12690130.sra Written 656289 spots for SRR12690130.sra Read 656289 spots for SRR12690130.sra Written 656289 spots for SRR12690130.sra Read 656289 spots for SRR12690130.sra Written 656289 spots for SRR12690130.sra Read 656289 spots for SRR12690130.sra Written 656289 spots for SRR12690130.sra Read 656289 spots for SRR12690130.sra Written 656289 spots for SRR12690130.sra Read 656289 spots for SRR12690130.sra Written 656289 spots for SRR12690130.sra Read 656292 spots for SRR12690130.sra Written 656292 spots for SRR12690130.sra Read 656289 spots for SRR12690130.sra Written 656289 spots for SRR12690130.sra Read 656289 spots for SRR12690130.sra Written 656289 spots for SRR12690130.sra Read 656289 spots for SRR12690130.sra Written 656289 spots for SRR12690130.sra Read 656289 spots for SRR12690130.sra Written 656289 spots for SRR12690130.sra SRR ids: ['SRR12690130.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qiro2ofs SRR12690130.sra spots: 13125783 blocks: [[1, 656289], [656290, 1312578], [1312579, 1968867], [1968868, 2625156], [2625157, 3281445], [3281446, 3937734], [3937735, 4594023], [4594024, 5250312], [5250313, 5906601], [5906602, 6562890], [6562891, 7219179], [7219180, 7875468], [7875469, 8531757], [8531758, 9188046], [9188047, 9844335], [9844336, 10500624], [10500625, 11156913], [11156914, 11813202], [11813203, 12469491], [12469492, 13125783]] SRR12690130 file size 4439014 SRR12690130 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690130 SRR12690130_1.fastq SRR12690130_2.fastq Input file: SRR12690130_1.fastq Paired file: SRR12690130_2.fastq trimmed: SRR12690130-trimmed-pair1.fastq, SRR12690130-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:11:55 2025 >> started Mon Feb 10 17:12:12 2025 >> done (16.395s) 13125783 read pairs processed; of these: 19 ( 0.00%) short read pairs filtered out after trimming by size control 2088 ( 0.02%) empty read pairs filtered out after trimming by size control 13123676 (99.98%) read pairs available; of these: 1103157 ( 8.41%) trimmed read pairs available after processing 12020519 (91.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 6 0.00% 20 3 0.00% 21 5 0.00% 22 8 0.00% 23 11 0.00% 24 13 0.00% 25 17 0.00% 26 12 0.00% 27 16 0.00% 28 20 0.00% 29 22 0.00% 30 13 0.00% 31 13 0.00% 32 18 0.00% 33 16 0.00% 34 29 0.00% 35 24 0.00% 36 17 0.00% 37 25 0.00% 38 31 0.00% 39 26 0.00% 40 17 0.00% 41 26 0.00% 42 32 0.00% 43 27 0.00% 44 33 0.00% 45 31 0.00% 46 26 0.00% 47 33 0.00% 48 44 0.00% 49 57 0.00% 50 59 0.00% 51 53 0.00% 52 46 0.00% 53 75 0.00% 54 70 0.00% 55 92 0.00% 56 75 0.00% 57 103 0.00% 58 115 0.00% 59 122 0.00% 60 151 0.00% 61 157 0.00% 62 172 0.00% 63 189 0.00% 64 197 0.00% 65 257 0.00% 66 273 0.00% 67 320 0.00% 68 343 0.00% 69 388 0.00% 70 437 0.00% 71 557 0.00% 72 579 0.00% 73 751 0.01% 74 734 0.01% 75 750 0.01% 76 916 0.01% 77 952 0.01% 78 1070 0.01% 79 1234 0.01% 80 1344 0.01% 81 1523 0.01% 82 1674 0.01% 83 1847 0.01% 84 2061 0.02% 85 2321 0.02% 86 2464 0.02% 87 2735 0.02% 88 2834 0.02% 89 3192 0.02% 90 3353 0.03% 91 3731 0.03% 92 3982 0.03% 93 4256 0.03% 94 4465 0.03% 95 4892 0.04% 96 5280 0.04% 97 5632 0.04% 98 5837 0.04% 99 6024 0.05% 100 6533 0.05% 101 6811 0.05% 102 7408 0.06% 103 7872 0.06% 104 8175 0.06% 105 8510 0.06% 106 9158 0.07% 107 9443 0.07% 108 9916 0.08% 109 10329 0.08% 110 10552 0.08% 111 10855 0.08% 112 11564 0.09% 113 11802 0.09% 114 12549 0.10% 115 13273 0.10% 116 13759 0.10% 117 14388 0.11% 118 14596 0.11% 119 15115 0.12% 120 15925 0.12% 121 16518 0.13% 122 17194 0.13% 123 17925 0.14% 124 18561 0.14% 125 18880 0.14% 126 19657 0.15% 127 20358 0.16% 128 20843 0.16% 129 21633 0.16% 130 22174 0.17% 131 23255 0.18% 132 23611 0.18% 133 24470 0.19% 134 25536 0.19% 135 25874 0.20% 136 26794 0.20% 137 27193 0.21% 138 27989 0.21% 139 29087 0.22% 140 29430 0.22% 141 29876 0.23% 142 31160 0.24% 143 31724 0.24% 144 32905 0.25% 145 33710 0.26% 146 34144 0.26% 147 34843 0.27% 148 35310 0.27% 149 35616 0.27% 150 36998 0.28% 151 12020519 91.59% 13123676 reads passed initial QC criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=20 prefix-density=0.87 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=22 fanout-score=11.08 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.4 sequence=AAGGAAGAAAAACTTGGGACAAATTAAATTACATGCTCAGTAACAGTAGAGATAACAATCATAAAATCCACCCCCCCTGCCGGAACACCACCGACGACACAAACAGAAAGAGATCTTATTTAACCGCTAAACTCTTCCTCTTTGTGTGTCTCGATGACAACATCAGACGTAGGATAAGCAACACAGGTGAGAACCCAGCCTTCCTCTATCTGGTCATCATCAAGGAAGCTAGCATCAGACTGATCCACAGTCCCCTTCACAATCTTGCCAAGACATGAAGAGCATGAGCCAGCCCTGCATGAGTAGGGGAGGTCAATCTCTTCTGCCTCCTCAGCATGGTCAAGGATGTAGATGTCATCGGGGCATGCAAACTCCTTCTCACCATCAGGAGTGATGAGCTTCACCGTGTATGCTGCCATTGCTTTAACACGTCCTCCTCGACTGGCTTTCAAGCCAAGAAGAGACTCCCCCACGTTGGGAAGTGCCCGTAGGCTTGTCACTGGCACCCGGC criterion=sequence-density sequence-density=1.06 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=18 prefix-density=1.07 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=88.19 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.5 sequence=ACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTAGAATAAAAGGGGTGCTCGAGCATGTTTGAGCTAGT SRR12690130 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:12:59 Started mapping on | Feb 10 17:12:59 Finished on | Feb 10 17:14:23 Mapping speed, Million of reads per hour | 562.44 Number of input reads | 13123676 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 12356772 Uniquely mapped reads % | 94.16% Average mapped length | 297.10 Number of splices: Total | 12545227 Number of splices: Annotated (sjdb) | 12297133 Number of splices: GT/AG | 12300956 Number of splices: GC/AG | 202985 Number of splices: AT/AC | 11230 Number of splices: Non-canonical | 30056 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 327467 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 82350 % of reads mapped to too many loci | 0.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.59% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 439437 439437 439437 N_multimapping 327467 327467 327467 N_noFeature 323322 12239414 356419 N_ambiguous 164848 561 80243 UnstrandedReadsAssigned:11868602 PositiveStrandReadsAssigned:116797 NegativeStrandReadsAssigned:11920110 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690130 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690130-trimmed-pair1.fastq SRR12690130-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,123,676 reads, 12,000,924 reads pseudoaligned [quant] estimated average fragment length: 261.012 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,138 rounds 52401 SRR12690130.ke.tsv 34699 SRR12690130.se.tsv 87100 total ==> SRR12690130.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1757.99 285 11.6988 Potri.005G024800.1.v4.1 1035 774.988 120 11.1738 Potri.004G059700.1.v4.1 961 701.11 45 4.63169 Potri.007G009000.2.v4.1 1416 1155.99 0 0 Potri.003G141000.2.v4.1 2943 2682.99 289 7.77306 Potri.016G087400.1.v4.1 270 79.5819 967 876.849 Potri.015G069301.1.v4.1 564 317.337 0 0 Potri.010G195200.1.v4.1 1773 1512.99 5 0.238478 Potri.012G127500.1.v4.1 977 717.057 1884 189.601 ==> SRR12690130.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 57 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 190 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12690130 completed mapping pipeline successfully