Starting /dee2/code/volunteer_pipeline.sh SRR12690131 current disk space = 3058113216512 free memory = 1087967928 SRR12690131 SRAfilesize cadfcfc8ca70278ad6c3c2626fac6d94 SRR12690131.sra SRR12690131.sra file validated SRR12690131 is paired end SRR12690131 is conventional basespace SRR12690131 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690131_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6045 37.0 37.0 37.0 37.0 37.0 2 36.39875 37.0 37.0 37.0 37.0 37.0 3 36.6555 37.0 37.0 37.0 37.0 37.0 4 36.6545 37.0 37.0 37.0 37.0 37.0 5 36.657 37.0 37.0 37.0 37.0 37.0 6 36.6715 37.0 37.0 37.0 37.0 37.0 7 36.5815 37.0 37.0 37.0 37.0 37.0 8 36.625 37.0 37.0 37.0 37.0 37.0 9 36.6065 37.0 37.0 37.0 37.0 37.0 10-14 36.60850000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.641999999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.5706 37.0 37.0 37.0 37.0 37.0 25-29 36.57189999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.5109 37.0 37.0 37.0 37.0 37.0 35-39 36.4608 37.0 37.0 37.0 37.0 37.0 40-44 36.472899999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.4587 37.0 37.0 37.0 37.0 37.0 50-54 36.4534 37.0 37.0 37.0 37.0 37.0 55-59 36.4307 37.0 37.0 37.0 37.0 37.0 60-64 36.388099999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.33460000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.310199999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.340999999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.2878 37.0 37.0 37.0 37.0 37.0 85-89 36.273399999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.2389 37.0 37.0 37.0 37.0 37.0 95-99 36.198899999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.15650000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.1693 37.0 37.0 37.0 37.0 37.0 110-114 36.1674 37.0 37.0 37.0 37.0 37.0 115-119 36.0919 37.0 37.0 37.0 37.0 37.0 120-124 36.0271 37.0 37.0 37.0 37.0 37.0 125-129 35.9865 37.0 37.0 37.0 37.0 37.0 130-134 35.8859 37.0 37.0 37.0 37.0 37.0 135-139 35.967 37.0 37.0 37.0 37.0 37.0 140-144 35.78680000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.689 37.0 37.0 37.0 37.0 37.0 150-151 35.545 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 4.0 24 2.0 25 3.0 26 7.0 27 7.0 28 5.0 29 14.0 30 31.0 31 40.0 32 45.0 33 66.0 34 110.0 35 288.0 36 2975.0 37 401.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.725 13.700000000000001 7.875 35.699999999999996 2 22.233375156838143 12.396486825595986 33.048933500627356 32.321204516938515 3 16.925 15.975 28.025 39.074999999999996 4 20.8 21.775 26.325 31.1 5 22.85 27.400000000000002 24.975 24.775 6 22.025 33.25 23.425 21.3 7 16.725 26.724999999999998 38.75 17.8 8 18.975 27.625 29.125 24.275 9 17.224999999999998 23.925 34.300000000000004 24.55 10-14 20.135 28.095 28.025 23.745 15-19 20.62 26.88 27.925 24.575 20-24 20.44 27.625 27.67 24.265 25-29 20.595 27.450000000000003 27.650000000000002 24.305 30-34 20.225 27.224999999999998 27.925 24.625 35-39 20.59 27.85 27.36 24.2 40-44 20.405 27.639999999999997 27.305 24.65 45-49 21.085 27.18 27.675 24.060000000000002 50-54 20.86 26.784999999999997 27.975 24.38 55-59 20.04 26.91 28.485 24.565 60-64 20.560000000000002 27.93 27.525 23.985 65-69 20.89 26.41 27.985 24.715 70-74 21.215 27.35 27.35 24.085 75-79 21.27 27.389999999999997 26.895000000000003 24.445 80-84 21.495 27.474999999999998 27.195000000000004 23.835 85-89 21.224999999999998 27.284999999999997 27.045 24.445 90-94 21.165 27.29 27.474999999999998 24.07 95-99 21.67 26.855 27.565 23.91 100-104 21.91 27.095000000000002 27.169999999999998 23.825 105-109 21.13 27.24 27.565 24.065 110-114 21.67 26.72 27.315 24.295 115-119 21.525 27.57 27.474999999999998 23.43 120-124 21.435000000000002 27.88 26.615 24.07 125-129 22.35 27.150000000000002 27.034999999999997 23.465 130-134 21.97 27.015 27.034999999999997 23.98 135-139 22.66 27.125 26.584999999999997 23.630000000000003 140-144 22.245 27.235 26.064999999999998 24.455 145-149 21.945 27.04 26.705000000000002 24.310000000000002 150-151 22.912499999999998 26.987499999999997 25.5375 24.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 2.0 20 2.0 21 0.5 22 1.0 23 2.0 24 4.0 25 5.0 26 4.0 27 4.0 28 4.5 29 7.5 30 12.5 31 14.5 32 20.0 33 25.0 34 26.5 35 40.5 36 66.5 37 81.5 38 97.0 39 118.5 40 145.0 41 185.0 42 218.5 43 235.5 44 236.0 45 262.5 46 280.5 47 287.5 48 267.0 49 224.0 50 212.5 51 191.0 52 145.5 53 115.5 54 104.0 55 83.5 56 70.0 57 52.5 58 39.5 59 40.0 60 25.0 61 7.5 62 7.5 63 6.0 64 4.5 65 3.5 66 2.5 67 2.5 68 1.5 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.95 #Duplication Level Percentage of deduplicated Percentage of total 1 90.21678710394664 81.15 2 8.643690939410783 15.55 3 0.9727626459143969 2.625 4 0.11117287381878821 0.4 5 0.027793218454697052 0.125 6 0.027793218454697052 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCTCGAACTTCTTCAATCCAGTTGGAGGCCACACCTGCATGCATTGAAC 6 0.15 No Hit CCCTGACCTCACAACCTCAGTGACCGAATCTTTAGCTGGTTTTGCAATTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 90-91 0.875 0.0 0.0 0.0 0.0 92-93 1.0125 0.0 0.0 0.0 0.0 94-95 1.025 0.0 0.0 0.0 0.0 96-97 1.1125 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.3625 0.0 0.0 0.0 0.0 102-103 1.5499999999999998 0.0 0.0 0.0 0.0 104-105 1.7375 0.0 0.0 0.0 0.0 106-107 1.875 0.0 0.0 0.0 0.0 108-109 2.175 0.0 0.0 0.0 0.0 110-111 2.4749999999999996 0.0 0.0 0.0 0.0 112-113 2.675 0.0 0.0 0.0 0.0 114-115 2.9124999999999996 0.0 0.0 0.0 0.0 116-117 3.2249999999999996 0.0 0.0 0.0 0.0 118-119 3.7625 0.0 0.0 0.0 0.0 120-121 4.4625 0.0 0.0 0.0 0.0 122-123 4.85 0.0 0.0 0.0 0.0 124-125 5.3375 0.0 0.0 0.0 0.0 126-127 5.925 0.0 0.0 0.0 0.0 128-129 6.6375 0.0 0.0 0.0 0.0 130-131 7.2 0.0 0.0 0.0 0.0 132-133 7.7875 0.0 0.0 0.0 0.0 134-135 8.525 0.0 0.0 0.0 0.0 136-137 9.275 0.0 0.0 0.0 0.0 138-139 9.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCACCA 10 0.006830828 145.0 8 TGTAACA 10 0.006830828 145.0 7 >>END_MODULE SRR12690131 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690131_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5655 37.0 37.0 37.0 37.0 37.0 2 36.2885 37.0 37.0 37.0 37.0 37.0 3 36.2255 37.0 37.0 37.0 37.0 37.0 4 36.292 37.0 37.0 37.0 37.0 37.0 5 36.425 37.0 37.0 37.0 37.0 37.0 6 36.308 37.0 37.0 37.0 37.0 37.0 7 36.267 37.0 37.0 37.0 37.0 37.0 8 36.305 37.0 37.0 37.0 37.0 37.0 9 36.347 37.0 37.0 37.0 37.0 37.0 10-14 36.304899999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.3243 37.0 37.0 37.0 37.0 37.0 20-24 36.3119 37.0 37.0 37.0 37.0 37.0 25-29 36.2746 37.0 37.0 37.0 37.0 37.0 30-34 36.208299999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.223400000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.134 37.0 37.0 37.0 37.0 37.0 45-49 36.179 37.0 37.0 37.0 37.0 37.0 50-54 36.1543 37.0 37.0 37.0 37.0 37.0 55-59 36.1754 37.0 37.0 37.0 37.0 37.0 60-64 36.1214 37.0 37.0 37.0 37.0 37.0 65-69 36.0792 37.0 37.0 37.0 37.0 37.0 70-74 36.0178 37.0 37.0 37.0 37.0 37.0 75-79 36.0522 37.0 37.0 37.0 37.0 37.0 80-84 36.0948 37.0 37.0 37.0 37.0 37.0 85-89 36.0669 37.0 37.0 37.0 37.0 37.0 90-94 35.915000000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.9337 37.0 37.0 37.0 37.0 37.0 100-104 35.937400000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.9328 37.0 37.0 37.0 37.0 37.0 110-114 35.8532 37.0 37.0 37.0 37.0 37.0 115-119 35.790600000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.7477 37.0 37.0 37.0 37.0 37.0 125-129 35.5888 37.0 37.0 37.0 37.0 37.0 130-134 35.571400000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.4143 37.0 37.0 37.0 37.0 37.0 140-144 35.3733 37.0 37.0 37.0 37.0 37.0 145-149 35.228899999999996 37.0 37.0 37.0 29.8 37.0 150-151 34.833 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 6.0 14 4.0 15 2.0 16 2.0 17 2.0 18 1.0 19 3.0 20 1.0 21 4.0 22 5.0 23 6.0 24 5.0 25 3.0 26 4.0 27 7.0 28 14.0 29 27.0 30 19.0 31 34.0 32 45.0 33 78.0 34 149.0 35 474.0 36 2836.0 37 269.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.375 24.275 10.625 23.724999999999998 2 29.825000000000003 27.1 26.0 17.075000000000003 3 22.575 28.925 28.95 19.55 4 23.65 35.3 22.2 18.85 5 25.85 35.5 20.8 17.849999999999998 6 21.8 38.125 20.8 19.275000000000002 7 21.425 25.374999999999996 34.875 18.325 8 23.3 26.700000000000003 25.4 24.6 9 22.35 24.95 28.025 24.675 10-14 24.535 29.044999999999998 24.98 21.44 15-19 24.3 27.715 26.36 21.625 20-24 23.61 28.52 26.450000000000003 21.42 25-29 23.935000000000002 28.735 25.81 21.52 30-34 23.925 27.744999999999997 26.515 21.815 35-39 24.055 27.845 26.6 21.5 40-44 23.32 28.53 26.855 21.295 45-49 23.674999999999997 28.175 26.450000000000003 21.7 50-54 24.46 27.425 26.810000000000002 21.305 55-59 24.245 27.18 26.465 22.11 60-64 23.705000000000002 27.785 26.845000000000002 21.665 65-69 23.835 26.825 27.125 22.215 70-74 24.099999999999998 27.639999999999997 26.215 22.045 75-79 24.13 26.705000000000002 26.915 22.25 80-84 24.490000000000002 27.445000000000004 26.195 21.87 85-89 23.54 27.62 26.35 22.49 90-94 24.72 27.235 25.965 22.08 95-99 24.465 27.694999999999997 25.929999999999996 21.91 100-104 24.875 27.939999999999998 26.07 21.115000000000002 105-109 24.975 27.224999999999998 26.939999999999998 20.86 110-114 24.575 27.83 26.63 20.965 115-119 24.560000000000002 28.025 26.085 21.33 120-124 25.255 28.13 26.240000000000002 20.375 125-129 25.95 28.105000000000004 25.230000000000004 20.715 130-134 26.31 27.18 25.765 20.745 135-139 26.215 27.345000000000002 26.284999999999997 20.155 140-144 27.229999999999997 27.12 25.205 20.445 145-149 27.515 28.125 24.695 19.665 150-151 27.675 27.625 25.3125 19.3875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 0.5 16 0.5 17 1.0 18 2.0 19 1.5 20 0.0 21 0.5 22 1.0 23 1.0 24 0.5 25 2.0 26 2.0 27 2.5 28 4.0 29 2.5 30 4.0 31 8.0 32 11.5 33 15.5 34 26.0 35 36.5 36 48.0 37 64.5 38 87.5 39 123.5 40 158.0 41 204.5 42 234.0 43 258.5 44 277.5 45 275.5 46 281.0 47 281.0 48 250.0 49 227.0 50 203.0 51 179.5 52 163.0 53 115.0 54 93.5 55 82.5 56 66.5 57 48.5 58 33.5 59 26.5 60 15.5 61 10.0 62 13.0 63 12.0 64 4.5 65 2.0 66 2.0 67 1.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 2.0 74 2.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.5 81 1.0 82 0.5 83 0.5 84 1.0 85 0.5 86 0.0 87 0.5 88 1.0 89 1.5 90 1.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.5 96 0.5 97 0.0 98 0.5 99 1.5 100 5.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.14999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 90.1570386988222 80.375 2 8.160403813796972 14.549999999999999 3 1.2899607403252944 3.45 4 0.3084688726864835 1.0999999999999999 5 0.028042624789680313 0.125 6 0.028042624789680313 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.028042624789680313 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit GGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 6 0.15 No Hit CTCAGTACAAGGTTCAAGCTTGTAATCAGGAAGAGGTTAACAAAGTGATG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 90-91 0.875 0.0 0.0 0.0 0.0 92-93 1.0125 0.0 0.0 0.0 0.0 94-95 1.025 0.0 0.0 0.0 0.0 96-97 1.1125 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.3625 0.0 0.0 0.0 0.0 102-103 1.5499999999999998 0.0 0.0 0.0 0.0 104-105 1.7375 0.0 0.0 0.0 0.0 106-107 1.875 0.0 0.0 0.0 0.0 108-109 2.2 0.0 0.0 0.0 0.0 110-111 2.5 0.0 0.0 0.0 0.0 112-113 2.7 0.0 0.0 0.0 0.0 114-115 2.9124999999999996 0.0 0.0 0.0 0.0 116-117 3.2249999999999996 0.0 0.0 0.0 0.0 118-119 3.75 0.0 0.0 0.0 0.0 120-121 4.45 0.0 0.0 0.0 0.0 122-123 4.85 0.0 0.0 0.0 0.0 124-125 5.3125 0.0 0.0 0.0 0.0 126-127 5.9 0.0 0.0 0.0 0.0 128-129 6.6125 0.0 0.0 0.0 0.0 130-131 7.15 0.0 0.0 0.0 0.0 132-133 7.725 0.0 0.0 0.0 0.0 134-135 8.45 0.0 0.0 0.0 0.0 136-137 9.225 0.0 0.0 0.0 0.0 138-139 9.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 100 3.245983E-6 14.5 140-144 >>END_MODULE Read 905053 spots for SRR12690131.sra Written 905053 spots for SRR12690131.sra Read 905053 spots for SRR12690131.sra Written 905053 spots for SRR12690131.sra Read 905053 spots for SRR12690131.sra Written 905053 spots for SRR12690131.sra Read 905053 spots for SRR12690131.sra Written 905053 spots for SRR12690131.sra Read 905053 spots for SRR12690131.sra Written 905053 spots for SRR12690131.sra Read 905053 spots for SRR12690131.sra Written 905053 spots for SRR12690131.sra Read 905053 spots for SRR12690131.sra Written 905053 spots for SRR12690131.sra Read 905053 spots for SRR12690131.sra Written 905053 spots for SRR12690131.sra Read 905053 spots for SRR12690131.sra Written 905053 spots for SRR12690131.sra Read 905053 spots for SRR12690131.sra Written 905053 spots for SRR12690131.sra Read 905053 spots for SRR12690131.sra Written 905053 spots for SRR12690131.sra Read 905053 spots for SRR12690131.sra Written 905053 spots for SRR12690131.sra Read 905053 spots for SRR12690131.sra Written 905053 spots for SRR12690131.sra Read 905053 spots for SRR12690131.sra Written 905053 spots for SRR12690131.sra Read 905053 spots for SRR12690131.sra Written 905053 spots for SRR12690131.sra Read 905053 spots for SRR12690131.sra Written 905053 spots for SRR12690131.sra Read 905053 spots for SRR12690131.sra Written 905053 spots for SRR12690131.sra Read 905053 spots for SRR12690131.sra Written 905053 spots for SRR12690131.sra Read 905053 spots for SRR12690131.sra Written 905053 spots for SRR12690131.sra Read 905053 spots for SRR12690131.sra Written 905053 spots for SRR12690131.sra SRR ids: ['SRR12690131.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uu1z04sm SRR12690131.sra spots: 18101060 blocks: [[1, 905053], [905054, 1810106], [1810107, 2715159], [2715160, 3620212], [3620213, 4525265], [4525266, 5430318], [5430319, 6335371], [6335372, 7240424], [7240425, 8145477], [8145478, 9050530], [9050531, 9955583], [9955584, 10860636], [10860637, 11765689], [11765690, 12670742], [12670743, 13575795], [13575796, 14480848], [14480849, 15385901], [15385902, 16290954], [16290955, 17196007], [17196008, 18101060]] SRR12690131 file size 6129831 SRR12690131 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690131 SRR12690131_1.fastq SRR12690131_2.fastq Input file: SRR12690131_1.fastq Paired file: SRR12690131_2.fastq trimmed: SRR12690131-trimmed-pair1.fastq, SRR12690131-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:26:27 2025 >> started Mon Feb 10 17:26:48 2025 >> done (21.255s) 18101060 read pairs processed; of these: 37 ( 0.00%) short read pairs filtered out after trimming by size control 35090 ( 0.19%) empty read pairs filtered out after trimming by size control 18065933 (99.81%) read pairs available; of these: 2760955 (15.28%) trimmed read pairs available after processing 15304978 (84.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 16 0.00% 21 11 0.00% 22 11 0.00% 23 21 0.00% 24 21 0.00% 25 26 0.00% 26 27 0.00% 27 26 0.00% 28 33 0.00% 29 35 0.00% 30 38 0.00% 31 39 0.00% 32 35 0.00% 33 33 0.00% 34 49 0.00% 35 40 0.00% 36 44 0.00% 37 54 0.00% 38 61 0.00% 39 64 0.00% 40 94 0.00% 41 76 0.00% 42 83 0.00% 43 78 0.00% 44 96 0.00% 45 93 0.00% 46 113 0.00% 47 108 0.00% 48 125 0.00% 49 138 0.00% 50 147 0.00% 51 154 0.00% 52 193 0.00% 53 206 0.00% 54 199 0.00% 55 239 0.00% 56 258 0.00% 57 278 0.00% 58 257 0.00% 59 359 0.00% 60 375 0.00% 61 408 0.00% 62 563 0.00% 63 595 0.00% 64 624 0.00% 65 658 0.00% 66 735 0.00% 67 872 0.00% 68 892 0.00% 69 1050 0.01% 70 1175 0.01% 71 1412 0.01% 72 1548 0.01% 73 1776 0.01% 74 2003 0.01% 75 2153 0.01% 76 2364 0.01% 77 2630 0.01% 78 2892 0.02% 79 3391 0.02% 80 3670 0.02% 81 4081 0.02% 82 4562 0.03% 83 5044 0.03% 84 5708 0.03% 85 6243 0.03% 86 6754 0.04% 87 7397 0.04% 88 7797 0.04% 89 8524 0.05% 90 8977 0.05% 91 9903 0.05% 92 10715 0.06% 93 11594 0.06% 94 12637 0.07% 95 13762 0.08% 96 14174 0.08% 97 15275 0.08% 98 16154 0.09% 99 17156 0.09% 100 17943 0.10% 101 19160 0.11% 102 20184 0.11% 103 21312 0.12% 104 22462 0.12% 105 23335 0.13% 106 24833 0.14% 107 25715 0.14% 108 26834 0.15% 109 27946 0.15% 110 29308 0.16% 111 29795 0.16% 112 31479 0.17% 113 32641 0.18% 114 33705 0.19% 115 35249 0.20% 116 36651 0.20% 117 38019 0.21% 118 39571 0.22% 119 40399 0.22% 120 42470 0.24% 121 43594 0.24% 122 44910 0.25% 123 46365 0.26% 124 48199 0.27% 125 49213 0.27% 126 50455 0.28% 127 52388 0.29% 128 53606 0.30% 129 54921 0.30% 130 56847 0.31% 131 57736 0.32% 132 59696 0.33% 133 61459 0.34% 134 62501 0.35% 135 64232 0.36% 136 65159 0.36% 137 66057 0.37% 138 67207 0.37% 139 69021 0.38% 140 69262 0.38% 141 71584 0.40% 142 73290 0.41% 143 75169 0.42% 144 77005 0.43% 145 77828 0.43% 146 78644 0.44% 147 79316 0.44% 148 80890 0.45% 149 80604 0.45% 150 82552 0.46% 151 15304978 84.72% 18065933 reads passed initial QC criterion=sequence-density sequence-density=1.02 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=12 prefix-density=1.02 prefix-fanout=2.1 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=154.89 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=2.0 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=1.46 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=17 prefix-density=1.47 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=27.15 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.1 sequence=ACTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAA SRR12690131 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:27:41 Started mapping on | Feb 10 17:27:41 Finished on | Feb 10 17:29:57 Mapping speed, Million of reads per hour | 478.22 Number of input reads | 18065933 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 16864322 Uniquely mapped reads % | 93.35% Average mapped length | 293.75 Number of splices: Total | 17317074 Number of splices: Annotated (sjdb) | 17001979 Number of splices: GT/AG | 16961236 Number of splices: GC/AG | 305825 Number of splices: AT/AC | 11190 Number of splices: Non-canonical | 38823 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 493264 % of reads mapped to multiple loci | 2.73% Number of reads mapped to too many loci | 207574 % of reads mapped to too many loci | 1.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.45% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 708347 708347 708347 N_multimapping 493264 493264 493264 N_noFeature 421575 16652009 475738 N_ambiguous 280766 787 122111 UnstrandedReadsAssigned:16161981 PositiveStrandReadsAssigned:211526 NegativeStrandReadsAssigned:16266473 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690131 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690131-trimmed-pair1.fastq SRR12690131-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,065,933 reads, 16,520,254 reads pseudoaligned [quant] estimated average fragment length: 218.911 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,100 rounds 52401 SRR12690131.ke.tsv 34699 SRR12690131.se.tsv 87100 total ==> SRR12690131.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.09 424 12.0252 Potri.005G024800.1.v4.1 1035 817.089 143 8.93482 Potri.004G059700.1.v4.1 961 743.089 56 3.84739 Potri.007G009000.2.v4.1 1416 1198.09 0 0 Potri.003G141000.2.v4.1 2943 2725.09 556 10.4163 Potri.016G087400.1.v4.1 270 88.3409 720 416.093 Potri.015G069301.1.v4.1 564 348.213 0 0 Potri.010G195200.1.v4.1 1773 1555.09 16 0.525272 Potri.012G127500.1.v4.1 977 759.089 1360 91.4672 ==> SRR12690131.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 535 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 265 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 11 SRR12690131 completed mapping pipeline successfully