Starting /dee2/code/volunteer_pipeline.sh SRR12690132 current disk space = 3058013741056 free memory = 1021249512 SRR12690132 SRAfilesize 9bf8221206555bff41b1901a724bf050 SRR12690132.sra SRR12690132.sra file validated SRR12690132 is paired end SRR12690132 is conventional basespace SRR12690132 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690132_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6405 37.0 37.0 37.0 37.0 37.0 2 36.38325 37.0 37.0 37.0 37.0 37.0 3 36.5725 37.0 37.0 37.0 37.0 37.0 4 36.599 37.0 37.0 37.0 37.0 37.0 5 36.6555 37.0 37.0 37.0 37.0 37.0 6 36.6595 37.0 37.0 37.0 37.0 37.0 7 36.518 37.0 37.0 37.0 37.0 37.0 8 36.642 37.0 37.0 37.0 37.0 37.0 9 36.5675 37.0 37.0 37.0 37.0 37.0 10-14 36.6406 37.0 37.0 37.0 37.0 37.0 15-19 36.616200000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.61280000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.5732 37.0 37.0 37.0 37.0 37.0 30-34 36.547799999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.560500000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.4948 37.0 37.0 37.0 37.0 37.0 45-49 36.463499999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.445100000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.4206 37.0 37.0 37.0 37.0 37.0 60-64 36.382999999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.378600000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.3572 37.0 37.0 37.0 37.0 37.0 75-79 36.3848 37.0 37.0 37.0 37.0 37.0 80-84 36.276300000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.273700000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.264 37.0 37.0 37.0 37.0 37.0 95-99 36.2207 37.0 37.0 37.0 37.0 37.0 100-104 36.1348 37.0 37.0 37.0 37.0 37.0 105-109 36.1466 37.0 37.0 37.0 37.0 37.0 110-114 36.113099999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.0815 37.0 37.0 37.0 37.0 37.0 120-124 35.9723 37.0 37.0 37.0 37.0 37.0 125-129 35.966300000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.9798 37.0 37.0 37.0 37.0 37.0 135-139 36.0454 37.0 37.0 37.0 37.0 37.0 140-144 35.8176 37.0 37.0 37.0 37.0 37.0 145-149 35.7844 37.0 37.0 37.0 37.0 37.0 150-151 35.65475 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 3.0 26 4.0 27 2.0 28 7.0 29 20.0 30 28.0 31 34.0 32 42.0 33 63.0 34 115.0 35 282.0 36 3049.0 37 350.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.95 10.95 8.525 40.575 2 20.960040211108318 12.163860266398592 36.56697662729329 30.309122895199796 3 18.25 16.225 27.025 38.5 4 21.8 22.875 24.8 30.525000000000002 5 22.45 30.175 25.374999999999996 22.0 6 21.7 33.650000000000006 24.425 20.225 7 15.35 25.674999999999997 41.3 17.675 8 17.25 27.275 31.1 24.375 9 17.599999999999998 25.974999999999998 35.475 20.95 10-14 19.205 29.7 27.465 23.630000000000003 15-19 19.985 27.125 28.46 24.43 20-24 19.39 27.965 28.895 23.75 25-29 20.405 27.48 28.105000000000004 24.01 30-34 19.96 28.28 27.485 24.275 35-39 19.98 28.21 28.470000000000002 23.34 40-44 19.875 27.955000000000002 28.155 24.015 45-49 20.625 28.625 27.325 23.425 50-54 20.13 27.884999999999998 28.294999999999998 23.69 55-59 19.885 28.215 28.01 23.89 60-64 20.615 28.42 27.405 23.56 65-69 20.04 28.9 27.435 23.625 70-74 20.349999999999998 28.244999999999997 27.805000000000003 23.599999999999998 75-79 20.46 28.285 27.900000000000002 23.355 80-84 20.424999999999997 28.325 27.52 23.73 85-89 20.064999999999998 28.59 27.560000000000002 23.785 90-94 20.77 27.450000000000003 28.115000000000002 23.665 95-99 20.9 28.77 27.55 22.78 100-104 20.9 28.470000000000002 27.425 23.205000000000002 105-109 20.849999999999998 28.189999999999998 27.915 23.044999999999998 110-114 20.905 27.48 28.48 23.135 115-119 21.0 28.225 27.29 23.485 120-124 21.015 28.485 27.339999999999996 23.16 125-129 21.075 28.24 27.150000000000002 23.535 130-134 20.765 28.17 27.750000000000004 23.315 135-139 21.145 28.23 26.93 23.695 140-144 22.275 28.349999999999998 26.295 23.080000000000002 145-149 21.62 28.27 26.43 23.68 150-151 21.5625 27.6125 26.5125 24.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 1.0 24 2.0 25 4.0 26 2.5 27 5.5 28 10.0 29 13.0 30 16.5 31 23.5 32 35.5 33 45.0 34 51.0 35 64.5 36 89.5 37 116.0 38 126.0 39 161.0 40 192.0 41 204.5 42 231.0 43 243.0 44 246.0 45 252.0 46 255.5 47 252.5 48 240.5 49 229.0 50 193.0 51 148.5 52 131.5 53 99.0 54 71.0 55 63.5 56 61.5 57 38.5 58 15.5 59 16.0 60 15.0 61 10.5 62 6.5 63 3.0 64 1.0 65 0.5 66 2.5 67 3.5 68 1.5 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.525 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.4 #Duplication Level Percentage of deduplicated Percentage of total 1 92.72186147186147 85.675 2 6.412337662337662 11.85 3 0.7846320346320346 2.175 4 0.08116883116883117 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.38749999999999996 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.35 0.0 0.0 0.0 0.0 108-109 1.5625 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 1.975 0.0 0.0 0.0 0.0 114-115 2.2875 0.0 0.0 0.0 0.0 116-117 2.6875 0.0 0.0 0.0 0.0 118-119 2.8625 0.0 0.0 0.0 0.0 120-121 3.2625 0.0 0.0 0.0 0.0 122-123 3.5625 0.0 0.0 0.0 0.0 124-125 3.875 0.0 0.0 0.0 0.0 126-127 4.1875 0.0 0.0 0.0 0.0 128-129 4.574999999999999 0.0 0.0 0.0 0.0 130-131 5.0875 0.0 0.0 0.0 0.0 132-133 5.6875 0.0 0.0 0.0 0.0 134-135 6.2125 0.0 0.0 0.0 0.0 136-137 6.75 0.0 0.0 0.0 0.0 138-139 7.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12690132 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690132_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.464 37.0 37.0 37.0 37.0 37.0 2 36.21 37.0 37.0 37.0 37.0 37.0 3 36.293 37.0 37.0 37.0 37.0 37.0 4 36.3785 37.0 37.0 37.0 37.0 37.0 5 36.357 37.0 37.0 37.0 37.0 37.0 6 36.3175 37.0 37.0 37.0 37.0 37.0 7 36.387 37.0 37.0 37.0 37.0 37.0 8 36.505 37.0 37.0 37.0 37.0 37.0 9 36.366 37.0 37.0 37.0 37.0 37.0 10-14 36.3667 37.0 37.0 37.0 37.0 37.0 15-19 36.3269 37.0 37.0 37.0 37.0 37.0 20-24 36.3255 37.0 37.0 37.0 37.0 37.0 25-29 36.308499999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.2541 37.0 37.0 37.0 37.0 37.0 35-39 36.2191 37.0 37.0 37.0 37.0 37.0 40-44 36.15650000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.1514 37.0 37.0 37.0 37.0 37.0 50-54 36.1105 37.0 37.0 37.0 37.0 37.0 55-59 36.16360000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.0395 37.0 37.0 37.0 37.0 37.0 65-69 36.099000000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.027300000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.001 37.0 37.0 37.0 37.0 37.0 80-84 36.025800000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.049 37.0 37.0 37.0 37.0 37.0 90-94 35.911 37.0 37.0 37.0 37.0 37.0 95-99 35.9726 37.0 37.0 37.0 37.0 37.0 100-104 35.9611 37.0 37.0 37.0 37.0 37.0 105-109 35.9207 37.0 37.0 37.0 37.0 37.0 110-114 35.84069999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.8969 37.0 37.0 37.0 37.0 37.0 120-124 35.696000000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.7148 37.0 37.0 37.0 37.0 37.0 130-134 35.595699999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.5505 37.0 37.0 37.0 37.0 37.0 140-144 35.51649999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.443799999999996 37.0 37.0 37.0 37.0 37.0 150-151 34.94375 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 7.0 15 1.0 16 2.0 17 3.0 18 0.0 19 0.0 20 4.0 21 4.0 22 4.0 23 4.0 24 4.0 25 7.0 26 5.0 27 6.0 28 13.0 29 19.0 30 18.0 31 37.0 32 35.0 33 87.0 34 167.0 35 472.0 36 2816.0 37 283.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.575 24.224999999999998 12.1 27.1 2 26.625 29.099999999999998 27.725 16.55 3 20.5 28.95 30.8 19.75 4 23.724999999999998 34.1 23.674999999999997 18.5 5 24.05 36.9 21.85 17.2 6 20.424999999999997 39.95 22.125 17.5 7 21.075 21.6 37.875 19.45 8 21.099999999999998 25.224999999999998 28.275 25.4 9 19.975 26.55 29.375 24.099999999999998 10-14 23.04 29.470000000000002 26.640000000000004 20.849999999999998 15-19 22.84 28.24 27.665 21.255 20-24 22.465 29.654999999999998 26.685 21.195 25-29 22.955000000000002 28.360000000000003 28.46 20.225 30-34 22.685 28.15 28.395 20.77 35-39 22.435 28.360000000000003 28.34 20.865000000000002 40-44 22.175 27.875 28.53 21.42 45-49 22.615 28.28 27.994999999999997 21.11 50-54 22.915 28.285 27.694999999999997 21.105 55-59 23.06 27.315 28.365000000000002 21.26 60-64 22.825 27.544999999999998 28.249999999999996 21.38 65-69 23.14 27.534999999999997 28.475 20.849999999999998 70-74 23.23 28.025 26.955000000000002 21.790000000000003 75-79 23.25 27.950000000000003 27.560000000000002 21.240000000000002 80-84 23.16 28.485 27.145000000000003 21.21 85-89 23.395 27.91 27.584999999999997 21.11 90-94 22.85 28.384999999999998 27.575 21.19 95-99 23.244999999999997 27.98 27.235 21.54 100-104 23.39 28.115000000000002 27.275 21.22 105-109 23.380000000000003 28.01 28.125 20.485 110-114 23.46 28.685 27.295 20.560000000000002 115-119 23.695 27.76 27.529999999999998 21.015 120-124 23.995 28.470000000000002 27.55 19.985 125-129 24.235 28.470000000000002 27.245 20.05 130-134 24.37 28.499999999999996 26.935 20.195 135-139 25.145 28.155 27.200000000000003 19.5 140-144 24.895 28.205000000000002 26.650000000000002 20.25 145-149 25.41 27.939999999999998 26.334999999999997 20.315 150-151 25.95 27.925 26.5625 19.5625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 1.0 13 0.5 14 0.0 15 0.5 16 1.0 17 1.0 18 1.0 19 2.0 20 3.0 21 3.0 22 3.0 23 2.5 24 1.0 25 2.5 26 4.5 27 5.5 28 8.5 29 8.5 30 14.5 31 24.0 32 30.5 33 34.5 34 51.0 35 65.0 36 72.5 37 105.5 38 140.0 39 169.5 40 193.5 41 237.0 42 273.5 43 268.0 44 271.5 45 272.0 46 262.0 47 243.5 48 233.0 49 215.0 50 166.0 51 135.5 52 112.0 53 82.5 54 62.0 55 48.0 56 45.0 57 38.0 58 24.0 59 15.0 60 11.0 61 6.5 62 3.0 63 4.0 64 3.5 65 2.5 66 1.0 67 0.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.5 75 1.5 76 1.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.5 92 1.0 93 1.0 94 0.5 95 0.0 96 0.0 97 0.5 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.025 #Duplication Level Percentage of deduplicated Percentage of total 1 92.47487095897854 85.1 2 6.5471339309970125 12.049999999999999 3 0.8693289866883999 2.4 4 0.08149959250203749 0.3 5 0.0 0.0 6 0.027166530834012496 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0125 0.0 90-91 0.2875 0.0 0.0 0.025 0.0 92-93 0.38749999999999996 0.0 0.0 0.025 0.0 94-95 0.5 0.0 0.0 0.025 0.0 96-97 0.5375 0.0 0.0 0.025 0.0 98-99 0.5874999999999999 0.0 0.0 0.025 0.0 100-101 0.725 0.0 0.0 0.025 0.0 102-103 0.8500000000000001 0.0 0.0 0.025 0.0 104-105 1.1375000000000002 0.0 0.0 0.025 0.0 106-107 1.4 0.0 0.0 0.025 0.0 108-109 1.6125 0.0 0.0 0.025 0.0 110-111 1.775 0.0 0.0 0.025 0.0 112-113 2.0250000000000004 0.0 0.0 0.025 0.0 114-115 2.3375 0.0 0.0 0.025 0.0 116-117 2.7375 0.0 0.0 0.025 0.0 118-119 2.9125 0.0 0.0 0.025 0.0 120-121 3.3125 0.0 0.0 0.025 0.0 122-123 3.6125 0.0 0.0 0.025 0.0 124-125 3.9125 0.0 0.0 0.025 0.0 126-127 4.2125 0.0 0.0 0.025 0.0 128-129 4.5875 0.0 0.0 0.025 0.0 130-131 5.1125 0.0 0.0 0.025 0.0 132-133 5.7125 0.0 0.0 0.025 0.0 134-135 6.2625 0.0 0.0 0.025 0.0 136-137 6.8125 0.0 0.0 0.025 0.0 138-139 7.475 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGCTC 10 0.006830828 145.0 2 GGCTTGA 10 0.006830828 145.0 4 AACAGCA 10 0.006830828 145.0 8 CTTGACA 10 0.006830828 145.0 6 GGGCTTG 10 0.006830828 145.0 3 AGAAAGA 25 8.7132835E-4 87.0 2 >>END_MODULE Read 1000772 spots for SRR12690132.sra Written 1000772 spots for SRR12690132.sra Read 1000772 spots for SRR12690132.sra Written 1000772 spots for SRR12690132.sra Read 1000772 spots for SRR12690132.sra Written 1000772 spots for SRR12690132.sra Read 1000772 spots for SRR12690132.sra Written 1000772 spots for SRR12690132.sra Read 1000772 spots for SRR12690132.sra Written 1000772 spots for SRR12690132.sra Read 1000772 spots for SRR12690132.sra Written 1000772 spots for SRR12690132.sra Read 1000772 spots for SRR12690132.sra Written 1000772 spots for SRR12690132.sra Read 1000772 spots for SRR12690132.sra Written 1000772 spots for SRR12690132.sra Read 1000772 spots for SRR12690132.sra Written 1000772 spots for SRR12690132.sra Read 1000772 spots for SRR12690132.sra Written 1000772 spots for SRR12690132.sra Read 1000772 spots for SRR12690132.sra Written 1000772 spots for SRR12690132.sra Read 1000785 spots for SRR12690132.sra Written 1000785 spots for SRR12690132.sra Read 1000772 spots for SRR12690132.sra Written 1000772 spots for SRR12690132.sra Read 1000772 spots for SRR12690132.sra Written 1000772 spots for SRR12690132.sra Read 1000772 spots for SRR12690132.sra Written 1000772 spots for SRR12690132.sra Read 1000772 spots for SRR12690132.sra Written 1000772 spots for SRR12690132.sra Read 1000772 spots for SRR12690132.sra Written 1000772 spots for SRR12690132.sra Read 1000772 spots for SRR12690132.sra Written 1000772 spots for SRR12690132.sra Read 1000772 spots for SRR12690132.sra Written 1000772 spots for SRR12690132.sra Read 1000772 spots for SRR12690132.sra Written 1000772 spots for SRR12690132.sra SRR ids: ['SRR12690132.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7yu3si0z SRR12690132.sra spots: 20015453 blocks: [[1, 1000772], [1000773, 2001544], [2001545, 3002316], [3002317, 4003088], [4003089, 5003860], [5003861, 6004632], [6004633, 7005404], [7005405, 8006176], [8006177, 9006948], [9006949, 10007720], [10007721, 11008492], [11008493, 12009264], [12009265, 13010036], [13010037, 14010808], [14010809, 15011580], [15011581, 16012352], [16012353, 17013124], [17013125, 18013896], [18013897, 19014668], [19014669, 20015453]] SRR12690132 file size 6780426 SRR12690132 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690132 SRR12690132_1.fastq SRR12690132_2.fastq Input file: SRR12690132_1.fastq Paired file: SRR12690132_2.fastq trimmed: SRR12690132-trimmed-pair1.fastq, SRR12690132-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:35:19 2025 >> started Mon Feb 10 17:35:50 2025 >> done (31.119s) 20015453 read pairs processed; of these: 41 ( 0.00%) short read pairs filtered out after trimming by size control 2875 ( 0.01%) empty read pairs filtered out after trimming by size control 20012537 (99.99%) read pairs available; of these: 2224722 (11.12%) trimmed read pairs available after processing 17787815 (88.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 8 0.00% 20 4 0.00% 21 4 0.00% 22 10 0.00% 23 7 0.00% 24 18 0.00% 25 22 0.00% 26 9 0.00% 27 22 0.00% 28 16 0.00% 29 17 0.00% 30 22 0.00% 31 22 0.00% 32 18 0.00% 33 27 0.00% 34 21 0.00% 35 27 0.00% 36 36 0.00% 37 32 0.00% 38 34 0.00% 39 49 0.00% 40 32 0.00% 41 36 0.00% 42 32 0.00% 43 55 0.00% 44 49 0.00% 45 42 0.00% 46 44 0.00% 47 65 0.00% 48 73 0.00% 49 74 0.00% 50 73 0.00% 51 97 0.00% 52 100 0.00% 53 113 0.00% 54 117 0.00% 55 154 0.00% 56 150 0.00% 57 160 0.00% 58 189 0.00% 59 202 0.00% 60 276 0.00% 61 273 0.00% 62 379 0.00% 63 356 0.00% 64 384 0.00% 65 466 0.00% 66 478 0.00% 67 537 0.00% 68 635 0.00% 69 688 0.00% 70 792 0.00% 71 853 0.00% 72 1001 0.01% 73 1126 0.01% 74 1414 0.01% 75 1491 0.01% 76 1618 0.01% 77 1812 0.01% 78 2047 0.01% 79 2257 0.01% 80 2439 0.01% 81 2928 0.01% 82 3160 0.02% 83 3460 0.02% 84 3941 0.02% 85 4389 0.02% 86 4710 0.02% 87 5192 0.03% 88 5523 0.03% 89 6059 0.03% 90 6541 0.03% 91 7110 0.04% 92 7601 0.04% 93 8336 0.04% 94 9124 0.05% 95 9943 0.05% 96 10686 0.05% 97 11428 0.06% 98 11939 0.06% 99 12846 0.06% 100 13507 0.07% 101 14305 0.07% 102 15399 0.08% 103 16266 0.08% 104 17160 0.09% 105 17920 0.09% 106 18967 0.09% 107 19860 0.10% 108 20490 0.10% 109 21450 0.11% 110 22216 0.11% 111 23282 0.12% 112 24259 0.12% 113 25460 0.13% 114 26415 0.13% 115 27753 0.14% 116 29088 0.15% 117 30437 0.15% 118 31592 0.16% 119 32615 0.16% 120 33393 0.17% 121 34714 0.17% 122 36125 0.18% 123 37361 0.19% 124 38240 0.19% 125 39299 0.20% 126 41222 0.21% 127 42508 0.21% 128 43460 0.22% 129 44421 0.22% 130 46485 0.23% 131 46463 0.23% 132 47809 0.24% 133 49662 0.25% 134 50370 0.25% 135 51614 0.26% 136 53051 0.27% 137 54334 0.27% 138 54954 0.27% 139 56992 0.28% 140 57859 0.29% 141 59890 0.30% 142 61185 0.31% 143 63000 0.31% 144 64104 0.32% 145 65082 0.33% 146 66426 0.33% 147 67992 0.34% 148 68774 0.34% 149 69449 0.35% 150 71522 0.36% 151 17787815 88.88% 20012537 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=11 prefix-density=0.54 prefix-fanout=2.3 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=28.40 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=2.7 sequence=AGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGTTGGAAAAGAA criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=22 prefix-density=0.68 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=79.37 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.8 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR12690132 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:36:49 Started mapping on | Feb 10 17:36:49 Finished on | Feb 10 17:38:49 Mapping speed, Million of reads per hour | 600.38 Number of input reads | 20012537 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 19031650 Uniquely mapped reads % | 95.10% Average mapped length | 295.90 Number of splices: Total | 18933836 Number of splices: Annotated (sjdb) | 18521464 Number of splices: GT/AG | 18567463 Number of splices: GC/AG | 290865 Number of splices: AT/AC | 12025 Number of splices: Non-canonical | 63483 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 453665 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 75393 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.13% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 527222 527222 527222 N_multimapping 453665 453665 453665 N_noFeature 748861 18789948 830110 N_ambiguous 274283 1080 113248 UnstrandedReadsAssigned:18008506 PositiveStrandReadsAssigned:240622 NegativeStrandReadsAssigned:18088292 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690132 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690132-trimmed-pair1.fastq SRR12690132-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,012,537 reads, 18,147,247 reads pseudoaligned [quant] estimated average fragment length: 243.61 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,178 rounds 52401 SRR12690132.ke.tsv 34699 SRR12690132.se.tsv 87100 total ==> SRR12690132.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.39 538 14.753 Potri.005G024800.1.v4.1 1035 792.39 420 25.8049 Potri.004G059700.1.v4.1 961 718.459 31 2.10064 Potri.007G009000.2.v4.1 1416 1173.39 0 0 Potri.003G141000.2.v4.1 2943 2700.39 647 11.6646 Potri.016G087400.1.v4.1 270 82.985 724 424.748 Potri.015G069301.1.v4.1 564 329.193 0 0 Potri.010G195200.1.v4.1 1773 1530.39 52 1.65422 Potri.012G127500.1.v4.1 977 734.43 124 8.21984 ==> SRR12690132.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 239 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 359 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 29 SRR12690132 completed mapping pipeline successfully