Starting /dee2/code/volunteer_pipeline.sh SRR12690133 current disk space = 3057522413568 free memory = 1572615052 SRR12690133 SRAfilesize 22d46c71780ca87d0d9ee009b8489365 SRR12690133.sra SRR12690133.sra file validated SRR12690133 is paired end SRR12690133 is conventional basespace SRR12690133 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690133_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.574 37.0 37.0 37.0 37.0 37.0 2 36.44525 37.0 37.0 37.0 37.0 37.0 3 36.598 37.0 37.0 37.0 37.0 37.0 4 36.582 37.0 37.0 37.0 37.0 37.0 5 36.6 37.0 37.0 37.0 37.0 37.0 6 36.6185 37.0 37.0 37.0 37.0 37.0 7 36.504 37.0 37.0 37.0 37.0 37.0 8 36.6325 37.0 37.0 37.0 37.0 37.0 9 36.5415 37.0 37.0 37.0 37.0 37.0 10-14 36.599599999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.5656 37.0 37.0 37.0 37.0 37.0 20-24 36.596199999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.5274 37.0 37.0 37.0 37.0 37.0 30-34 36.4884 37.0 37.0 37.0 37.0 37.0 35-39 36.45309999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.4259 37.0 37.0 37.0 37.0 37.0 45-49 36.4031 37.0 37.0 37.0 37.0 37.0 50-54 36.4245 37.0 37.0 37.0 37.0 37.0 55-59 36.3678 37.0 37.0 37.0 37.0 37.0 60-64 36.339600000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.322199999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.31230000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.3134 37.0 37.0 37.0 37.0 37.0 80-84 36.22840000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.2553 37.0 37.0 37.0 37.0 37.0 90-94 36.20100000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.1774 37.0 37.0 37.0 37.0 37.0 100-104 36.138000000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.128400000000006 37.0 37.0 37.0 37.0 37.0 110-114 36.123200000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.0167 37.0 37.0 37.0 37.0 37.0 120-124 35.949799999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.9736 37.0 37.0 37.0 37.0 37.0 130-134 35.929199999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.8865 37.0 37.0 37.0 37.0 37.0 140-144 35.7428 37.0 37.0 37.0 37.0 37.0 145-149 35.741200000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.515249999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 1.0 24 4.0 25 1.0 26 8.0 27 5.0 28 7.0 29 10.0 30 30.0 31 30.0 32 47.0 33 68.0 34 113.0 35 348.0 36 3005.0 37 321.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.35 10.925 8.0 44.725 2 18.332081141998497 13.17305284247433 37.79113448534936 30.703731530177812 3 16.2 15.0 27.3 41.5 4 20.724999999999998 24.4 23.925 30.95 5 22.95 28.825 25.35 22.875 6 18.75 33.525 25.5 22.225 7 15.575 28.175 39.85 16.400000000000002 8 18.425 25.95 31.674999999999997 23.95 9 16.8 23.200000000000003 36.325 23.674999999999997 10-14 19.939999999999998 28.599999999999998 28.615000000000002 22.845 15-19 19.73 28.12 28.08 24.07 20-24 19.655 28.07 28.155 24.12 25-29 19.82 28.055000000000003 28.28 23.845 30-34 19.445 27.88 28.18 24.495 35-39 20.05 28.299999999999997 28.12 23.53 40-44 19.45 28.09 28.535 23.925 45-49 19.645000000000003 28.12 27.834999999999997 24.4 50-54 20.424999999999997 28.025 27.82 23.73 55-59 20.18 28.444999999999997 27.860000000000003 23.515 60-64 20.225 27.445000000000004 27.560000000000002 24.77 65-69 20.335 27.965 27.839999999999996 23.86 70-74 20.24 28.08 28.444999999999997 23.235 75-79 20.419999999999998 27.775 28.095 23.71 80-84 20.325 28.24 27.650000000000002 23.785 85-89 19.3 28.59 28.194999999999997 23.915 90-94 20.115 28.645 27.435 23.805 95-99 19.89 28.465 28.035 23.61 100-104 20.055 27.935 27.61 24.4 105-109 20.23 28.365000000000002 26.87 24.535 110-114 20.02 27.705000000000002 28.815 23.46 115-119 20.4 28.21 27.52 23.87 120-124 19.509999999999998 28.345 27.744999999999997 24.4 125-129 20.955 27.544999999999998 27.595 23.905 130-134 20.23 28.084999999999997 28.12 23.565 135-139 21.005 27.58 27.49 23.925 140-144 20.62 28.084999999999997 27.589999999999996 23.705000000000002 145-149 20.24 27.975 27.125 24.66 150-151 19.8625 27.474999999999998 28.287499999999998 24.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.5 25 5.0 26 8.0 27 7.0 28 8.0 29 12.5 30 20.0 31 19.5 32 26.0 33 37.0 34 51.0 35 69.0 36 76.5 37 98.5 38 120.5 39 157.5 40 203.0 41 226.5 42 260.0 43 269.5 44 267.0 45 263.5 46 260.5 47 262.5 48 232.5 49 202.5 50 180.5 51 135.0 52 98.0 53 100.0 54 87.5 55 57.5 56 42.0 57 34.5 58 31.0 59 24.0 60 13.5 61 8.0 62 8.0 63 5.5 64 1.0 65 1.0 66 1.0 67 0.0 68 1.5 69 2.5 70 1.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.425 #Duplication Level Percentage of deduplicated Percentage of total 1 91.85124418922615 83.975 2 7.136997538966367 13.05 3 0.8750341810226961 2.4 4 0.08203445447087777 0.3 5 0.027344818156959255 0.125 6 0.027344818156959255 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCT 6 0.15 No Hit CTCCTGTGCCTTCAGGGTCTGAAAGTCCGAGTGGGTCGAATCCGAAGTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.07500000000000001 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 0.9875 0.0 0.0 0.0 0.0 108-109 1.2625 0.0 0.0 0.0 0.0 110-111 1.4874999999999998 0.0 0.0 0.0 0.0 112-113 1.65 0.0 0.0 0.0 0.0 114-115 1.775 0.0 0.0 0.0 0.0 116-117 2.0375 0.0 0.0 0.0 0.0 118-119 2.3125 0.0 0.0 0.0 0.0 120-121 2.45 0.0 0.0 0.0 0.0 122-123 2.6375 0.0 0.0 0.0 0.0 124-125 2.8499999999999996 0.0 0.0 0.0 0.0 126-127 3.2125000000000004 0.0 0.0 0.0 0.0 128-129 3.7125 0.0 0.0 0.0 0.0 130-131 4.15 0.0 0.0 0.0 0.0 132-133 4.5375 0.0 0.0 0.0 0.0 134-135 5.05 0.0 0.0 0.0 0.0 136-137 5.5125 0.0 0.0 0.0 0.0 138-139 6.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12690133 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690133_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.43 37.0 37.0 37.0 37.0 37.0 2 36.193 37.0 37.0 37.0 37.0 37.0 3 36.2565 37.0 37.0 37.0 37.0 37.0 4 36.33 37.0 37.0 37.0 37.0 37.0 5 36.333 37.0 37.0 37.0 37.0 37.0 6 36.299 37.0 37.0 37.0 37.0 37.0 7 36.403 37.0 37.0 37.0 37.0 37.0 8 36.4325 37.0 37.0 37.0 37.0 37.0 9 36.431 37.0 37.0 37.0 37.0 37.0 10-14 36.34440000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.3839 37.0 37.0 37.0 37.0 37.0 20-24 36.3423 37.0 37.0 37.0 37.0 37.0 25-29 36.345099999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.3052 37.0 37.0 37.0 37.0 37.0 35-39 36.260200000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.1917 37.0 37.0 37.0 37.0 37.0 45-49 36.221500000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.1885 37.0 37.0 37.0 37.0 37.0 55-59 36.1491 37.0 37.0 37.0 37.0 37.0 60-64 36.1135 37.0 37.0 37.0 37.0 37.0 65-69 36.1161 37.0 37.0 37.0 37.0 37.0 70-74 36.0538 37.0 37.0 37.0 37.0 37.0 75-79 36.0813 37.0 37.0 37.0 37.0 37.0 80-84 36.0527 37.0 37.0 37.0 37.0 37.0 85-89 36.003699999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.9447 37.0 37.0 37.0 37.0 37.0 95-99 35.915499999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.937599999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.936600000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.9246 37.0 37.0 37.0 37.0 37.0 115-119 35.8291 37.0 37.0 37.0 37.0 37.0 120-124 35.7633 37.0 37.0 37.0 37.0 37.0 125-129 35.660900000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.612700000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.6233 37.0 37.0 37.0 37.0 37.0 140-144 35.6075 37.0 37.0 37.0 37.0 37.0 145-149 35.476000000000006 37.0 37.0 37.0 37.0 37.0 150-151 34.89 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 0.0 16 0.0 17 1.0 18 2.0 19 0.0 20 0.0 21 1.0 22 2.0 23 6.0 24 4.0 25 6.0 26 9.0 27 3.0 28 14.0 29 25.0 30 31.0 31 39.0 32 48.0 33 92.0 34 165.0 35 495.0 36 2750.0 37 305.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.75 22.875 12.025 29.349999999999998 2 25.624999999999996 28.749999999999996 29.5 16.125 3 19.525000000000002 29.525000000000002 30.7 20.25 4 23.724999999999998 33.175 23.25 19.85 5 22.45 37.0 23.775 16.775000000000002 6 19.85 39.525 23.724999999999998 16.900000000000002 7 20.375 21.725 39.775 18.125 8 22.7 24.9 29.15 23.25 9 22.925 25.3 29.799999999999997 21.975 10-14 23.535 29.445 26.22 20.8 15-19 22.99 29.015 27.55 20.445 20-24 22.509999999999998 29.310000000000002 27.700000000000003 20.48 25-29 23.205000000000002 29.49 27.185 20.119999999999997 30-34 22.605 28.335 28.439999999999998 20.62 35-39 23.39 28.465 28.035 20.11 40-44 22.45 28.335 28.144999999999996 21.07 45-49 23.22 28.244999999999997 27.939999999999998 20.595 50-54 22.535 28.535 27.38 21.55 55-59 22.6 28.62 27.735 21.044999999999998 60-64 22.45 28.444999999999997 27.68 21.425 65-69 23.005 27.38 28.165000000000003 21.45 70-74 23.73 28.26 27.235 20.775 75-79 23.71 27.455000000000002 27.735 21.099999999999998 80-84 22.720000000000002 28.494999999999997 28.365000000000002 20.419999999999998 85-89 24.195 27.97 26.99 20.845 90-94 23.76 27.57 27.750000000000004 20.919999999999998 95-99 23.46 27.905 27.525 21.11 100-104 24.38 27.675 27.384999999999998 20.560000000000002 105-109 23.405 27.61 28.315 20.669999999999998 110-114 24.335 27.589999999999996 27.43 20.645 115-119 23.849999999999998 27.705000000000002 28.555000000000003 19.89 120-124 23.325000000000003 28.595 27.560000000000002 20.52 125-129 24.01 28.095 27.38 20.515 130-134 24.585 28.595 27.04 19.78 135-139 24.265 28.1 27.465 20.169999999999998 140-144 25.374999999999996 27.435 27.05 20.14 145-149 24.955 27.925 27.66 19.46 150-151 26.187500000000004 27.775 26.900000000000002 19.1375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.0 23 3.5 24 3.5 25 1.0 26 1.5 27 3.0 28 8.5 29 15.5 30 21.5 31 28.0 32 35.5 33 39.0 34 47.5 35 76.0 36 106.5 37 116.5 38 145.5 39 185.5 40 203.5 41 217.0 42 224.0 43 238.0 44 263.5 45 297.0 46 272.5 47 240.5 48 233.5 49 188.5 50 161.0 51 135.5 52 92.0 53 83.5 54 78.0 55 53.5 56 43.5 57 31.0 58 22.0 59 22.5 60 19.5 61 11.5 62 6.0 63 5.0 64 3.5 65 2.0 66 1.0 67 1.0 68 1.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.925 #Duplication Level Percentage of deduplicated Percentage of total 1 91.44899642562552 83.15 2 7.451196040692879 13.55 3 0.9073412152873247 2.475 4 0.10998075336816059 0.4 5 0.05499037668408029 0.25 6 0.0 0.0 7 0.027495188342040146 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 7 0.17500000000000002 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2125 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.8500000000000001 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.2875 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.625 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 2.0125 0.0 0.0 0.0 0.0 118-119 2.2875 0.0 0.0 0.0 0.0 120-121 2.425 0.0 0.0 0.0 0.0 122-123 2.6125 0.0 0.0 0.0 0.0 124-125 2.825 0.0 0.0 0.0 0.0 126-127 3.2125000000000004 0.0 0.0 0.0 0.0 128-129 3.7 0.0 0.0 0.0 0.0 130-131 4.125 0.0 0.0 0.0 0.0 132-133 4.512499999999999 0.0 0.0 0.0 0.0 134-135 5.025 0.0 0.0 0.0 0.0 136-137 5.4875 0.0 0.0 0.0 0.0 138-139 5.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 697624 spots for SRR12690133.sra Written 697624 spots for SRR12690133.sra Read 697624 spots for SRR12690133.sra Written 697624 spots for SRR12690133.sra Read 697624 spots for SRR12690133.sra Written 697624 spots for SRR12690133.sra Read 697624 spots for SRR12690133.sra Written 697624 spots for SRR12690133.sra Read 697624 spots for SRR12690133.sra Written 697624 spots for SRR12690133.sra Read 697624 spots for SRR12690133.sra Written 697624 spots for SRR12690133.sra Read 697624 spots for SRR12690133.sra Written 697624 spots for SRR12690133.sra Read 697624 spots for SRR12690133.sra Written 697624 spots for SRR12690133.sra Read 697624 spots for SRR12690133.sra Written 697624 spots for SRR12690133.sra Read 697624 spots for SRR12690133.sra Written 697624 spots for SRR12690133.sra Read 697624 spots for SRR12690133.sra Written 697624 spots for SRR12690133.sra Read 697624 spots for SRR12690133.sra Written 697624 spots for SRR12690133.sra Read 697624 spots for SRR12690133.sra Written 697624 spots for SRR12690133.sra Read 697625 spots for SRR12690133.sra Written 697625 spots for SRR12690133.sra Read 697624 spots for SRR12690133.sra Written 697624 spots for SRR12690133.sra Read 697624 spots for SRR12690133.sra Written 697624 spots for SRR12690133.sra Read 697624 spots for SRR12690133.sra Written 697624 spots for SRR12690133.sra Read 697624 spots for SRR12690133.sra Written 697624 spots for SRR12690133.sra Read 697624 spots for SRR12690133.sra Written 697624 spots for SRR12690133.sra Read 697624 spots for SRR12690133.sra Written 697624 spots for SRR12690133.sra SRR ids: ['SRR12690133.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pb60k2yw SRR12690133.sra spots: 13952481 blocks: [[1, 697624], [697625, 1395248], [1395249, 2092872], [2092873, 2790496], [2790497, 3488120], [3488121, 4185744], [4185745, 4883368], [4883369, 5580992], [5580993, 6278616], [6278617, 6976240], [6976241, 7673864], [7673865, 8371488], [8371489, 9069112], [9069113, 9766736], [9766737, 10464360], [10464361, 11161984], [11161985, 11859608], [11859609, 12557232], [12557233, 13254856], [13254857, 13952481]] SRR12690133 file size 4719963 SRR12690133 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690133 SRR12690133_1.fastq SRR12690133_2.fastq Input file: SRR12690133_1.fastq Paired file: SRR12690133_2.fastq trimmed: SRR12690133-trimmed-pair1.fastq, SRR12690133-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:27:45 2025 >> started Mon Feb 10 18:28:04 2025 >> done (19.701s) 13952481 read pairs processed; of these: 14 ( 0.00%) short read pairs filtered out after trimming by size control 1317 ( 0.01%) empty read pairs filtered out after trimming by size control 13951150 (99.99%) read pairs available; of these: 1291439 ( 9.26%) trimmed read pairs available after processing 12659711 (90.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 1 0.00% 22 5 0.00% 23 5 0.00% 24 7 0.00% 25 4 0.00% 26 7 0.00% 27 6 0.00% 28 8 0.00% 29 7 0.00% 30 7 0.00% 31 7 0.00% 32 9 0.00% 33 11 0.00% 34 12 0.00% 35 8 0.00% 36 13 0.00% 37 14 0.00% 38 14 0.00% 39 12 0.00% 40 18 0.00% 41 22 0.00% 42 20 0.00% 43 25 0.00% 44 14 0.00% 45 25 0.00% 46 33 0.00% 47 43 0.00% 48 46 0.00% 49 40 0.00% 50 51 0.00% 51 48 0.00% 52 66 0.00% 53 51 0.00% 54 56 0.00% 55 78 0.00% 56 84 0.00% 57 70 0.00% 58 100 0.00% 59 119 0.00% 60 164 0.00% 61 195 0.00% 62 185 0.00% 63 235 0.00% 64 234 0.00% 65 271 0.00% 66 354 0.00% 67 362 0.00% 68 405 0.00% 69 507 0.00% 70 512 0.00% 71 639 0.00% 72 674 0.00% 73 754 0.01% 74 866 0.01% 75 993 0.01% 76 1128 0.01% 77 1178 0.01% 78 1289 0.01% 79 1403 0.01% 80 1568 0.01% 81 1783 0.01% 82 1976 0.01% 83 2212 0.02% 84 2312 0.02% 85 2756 0.02% 86 2924 0.02% 87 3244 0.02% 88 3457 0.02% 89 3703 0.03% 90 3983 0.03% 91 4353 0.03% 92 4553 0.03% 93 5045 0.04% 94 5525 0.04% 95 5945 0.04% 96 6184 0.04% 97 6665 0.05% 98 7029 0.05% 99 7514 0.05% 100 7976 0.06% 101 8314 0.06% 102 9014 0.06% 103 9404 0.07% 104 9912 0.07% 105 10490 0.08% 106 10785 0.08% 107 11530 0.08% 108 11971 0.09% 109 12625 0.09% 110 12895 0.09% 111 13032 0.09% 112 13992 0.10% 113 14509 0.10% 114 15123 0.11% 115 15609 0.11% 116 16465 0.12% 117 16904 0.12% 118 17699 0.13% 119 18297 0.13% 120 19182 0.14% 121 20182 0.14% 122 20361 0.15% 123 21130 0.15% 124 21903 0.16% 125 22550 0.16% 126 23250 0.17% 127 24374 0.17% 128 24975 0.18% 129 25535 0.18% 130 26605 0.19% 131 26864 0.19% 132 27777 0.20% 133 28885 0.21% 134 29110 0.21% 135 30307 0.22% 136 30745 0.22% 137 31400 0.23% 138 32226 0.23% 139 33405 0.24% 140 34372 0.25% 141 34940 0.25% 142 35702 0.26% 143 36580 0.26% 144 37835 0.27% 145 38272 0.27% 146 38564 0.28% 147 38851 0.28% 148 40101 0.29% 149 40585 0.29% 150 42078 0.30% 151 12659711 90.74% 13951150 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=10 prefix-density=0.44 prefix-fanout=2.3 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=22 fanout-score=39.63 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.7 sequence=CCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=27 prefix-density=0.60 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=83.41 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.1 sequence=CAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACT SRR12690133 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:28:52 Started mapping on | Feb 10 18:28:53 Finished on | Feb 10 18:30:38 Mapping speed, Million of reads per hour | 478.33 Number of input reads | 13951150 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13245540 Uniquely mapped reads % | 94.94% Average mapped length | 296.67 Number of splices: Total | 13398229 Number of splices: Annotated (sjdb) | 13091045 Number of splices: GT/AG | 13145919 Number of splices: GC/AG | 203367 Number of splices: AT/AC | 9664 Number of splices: Non-canonical | 39279 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 320050 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 154588 % of reads mapped to too many loci | 1.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.47% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 385560 385560 385560 N_multimapping 320050 320050 320050 N_noFeature 613085 13084015 663783 N_ambiguous 193326 1073 81761 UnstrandedReadsAssigned:12439129 PositiveStrandReadsAssigned:160452 NegativeStrandReadsAssigned:12499996 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690133 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690133-trimmed-pair1.fastq SRR12690133-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,951,150 reads, 12,541,436 reads pseudoaligned [quant] estimated average fragment length: 259.227 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,029 rounds 52401 SRR12690133.ke.tsv 34699 SRR12690133.se.tsv 87100 total ==> SRR12690133.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.77 524 21.6147 Potri.005G024800.1.v4.1 1035 776.773 310 28.9695 Potri.004G059700.1.v4.1 961 702.938 63 6.50575 Potri.007G009000.2.v4.1 1416 1157.77 0 0 Potri.003G141000.2.v4.1 2943 2684.77 567.736 15.3501 Potri.016G087400.1.v4.1 270 80.5013 593 534.719 Potri.015G069301.1.v4.1 564 319.487 0 0 Potri.010G195200.1.v4.1 1773 1514.77 13 0.622974 Potri.012G127500.1.v4.1 977 718.874 300 30.293 ==> SRR12690133.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 362 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 218 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 29 SRR12690133 completed mapping pipeline successfully