Starting /dee2/code/volunteer_pipeline.sh SRR12690134 current disk space = 3057937965056 free memory = 1017518348 SRR12690134 SRAfilesize 592d40b8479b89100d7a4f40077bd87d SRR12690134.sra SRR12690134.sra file validated SRR12690134 is paired end SRR12690134 is conventional basespace SRR12690134 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690134_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.616 37.0 37.0 37.0 37.0 37.0 2 36.4535 37.0 37.0 37.0 37.0 37.0 3 36.6685 37.0 37.0 37.0 37.0 37.0 4 36.617 37.0 37.0 37.0 37.0 37.0 5 36.646 37.0 37.0 37.0 37.0 37.0 6 36.7315 37.0 37.0 37.0 37.0 37.0 7 36.635 37.0 37.0 37.0 37.0 37.0 8 36.6175 37.0 37.0 37.0 37.0 37.0 9 36.667 37.0 37.0 37.0 37.0 37.0 10-14 36.636900000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.6169 37.0 37.0 37.0 37.0 37.0 20-24 36.6154 37.0 37.0 37.0 37.0 37.0 25-29 36.5662 37.0 37.0 37.0 37.0 37.0 30-34 36.5206 37.0 37.0 37.0 37.0 37.0 35-39 36.4855 37.0 37.0 37.0 37.0 37.0 40-44 36.477999999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.4695 37.0 37.0 37.0 37.0 37.0 50-54 36.4435 37.0 37.0 37.0 37.0 37.0 55-59 36.4302 37.0 37.0 37.0 37.0 37.0 60-64 36.4546 37.0 37.0 37.0 37.0 37.0 65-69 36.401399999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.3671 37.0 37.0 37.0 37.0 37.0 75-79 36.385 37.0 37.0 37.0 37.0 37.0 80-84 36.31529999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.2984 37.0 37.0 37.0 37.0 37.0 90-94 36.262 37.0 37.0 37.0 37.0 37.0 95-99 36.2182 37.0 37.0 37.0 37.0 37.0 100-104 36.1346 37.0 37.0 37.0 37.0 37.0 105-109 36.1532 37.0 37.0 37.0 37.0 37.0 110-114 36.13119999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.1412 37.0 37.0 37.0 37.0 37.0 120-124 36.0532 37.0 37.0 37.0 37.0 37.0 125-129 36.028000000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.9667 37.0 37.0 37.0 37.0 37.0 135-139 36.0187 37.0 37.0 37.0 37.0 37.0 140-144 35.806200000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.828 37.0 37.0 37.0 37.0 37.0 150-151 35.635 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 1.0 25 2.0 26 3.0 27 7.0 28 12.0 29 8.0 30 18.0 31 38.0 32 57.0 33 64.0 34 103.0 35 279.0 36 3021.0 37 384.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.075 13.200000000000001 7.3 39.425 2 19.829317269076306 13.42871485943775 35.8433734939759 30.89859437751004 3 17.25 16.8 27.175 38.775 4 21.349999999999998 24.2 24.5 29.95 5 23.724999999999998 29.475 25.025 21.775 6 20.775 34.0 23.75 21.475 7 17.025000000000002 26.575 39.625 16.775000000000002 8 17.7 26.674999999999997 33.324999999999996 22.3 9 16.950000000000003 24.425 35.675000000000004 22.95 10-14 19.220000000000002 29.709999999999997 27.365000000000002 23.705000000000002 15-19 19.675 28.055000000000003 28.144999999999996 24.125 20-24 20.064999999999998 28.244999999999997 28.125 23.565 25-29 20.24 28.305000000000003 27.83 23.625 30-34 19.915 28.38 27.529999999999998 24.175 35-39 19.585 28.444999999999997 27.860000000000003 24.11 40-44 19.975 28.815 27.975 23.235 45-49 20.02 28.62 27.3 24.060000000000002 50-54 20.119999999999997 28.365000000000002 27.22 24.295 55-59 20.015 28.439999999999998 28.265 23.28 60-64 19.98 29.099999999999998 27.48 23.44 65-69 19.775000000000002 28.449999999999996 28.275 23.5 70-74 20.44 28.444999999999997 27.055 24.060000000000002 75-79 20.150000000000002 28.16 27.634999999999998 24.055 80-84 20.365 28.825 27.595 23.215 85-89 20.78 28.405 27.61 23.205000000000002 90-94 21.0 28.22 27.450000000000003 23.330000000000002 95-99 20.4 28.075 27.950000000000003 23.575 100-104 21.18 28.249999999999996 27.525 23.044999999999998 105-109 20.630000000000003 27.91 27.994999999999997 23.465 110-114 20.330000000000002 27.97 28.105000000000004 23.595 115-119 20.64 28.255000000000003 27.644999999999996 23.46 120-124 21.335 28.12 27.474999999999998 23.07 125-129 21.19 28.199999999999996 27.060000000000002 23.549999999999997 130-134 20.75 28.305000000000003 27.595 23.35 135-139 21.14 28.050000000000004 27.284999999999997 23.525 140-144 21.029999999999998 28.345 26.72 23.905 145-149 21.38 28.349999999999998 27.185 23.085 150-151 21.175 29.062500000000004 26.3125 23.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 1.0 24 2.0 25 3.0 26 3.5 27 9.0 28 12.5 29 13.0 30 14.5 31 25.5 32 31.0 33 34.5 34 51.5 35 71.5 36 94.5 37 107.5 38 119.0 39 148.5 40 190.0 41 223.0 42 236.5 43 256.5 44 276.5 45 262.5 46 259.0 47 255.0 48 223.0 49 209.0 50 183.5 51 150.5 52 120.0 53 98.5 54 86.0 55 59.5 56 43.0 57 30.0 58 21.0 59 17.5 60 15.0 61 12.5 62 9.0 63 4.5 64 2.0 65 1.5 66 1.0 67 0.5 68 1.0 69 1.0 70 0.5 71 0.5 72 1.5 73 1.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.725 #Duplication Level Percentage of deduplicated Percentage of total 1 89.85789913624966 80.625 2 8.97185845639454 16.1 3 1.058790749512399 2.85 4 0.08358874338255781 0.3 5 0.02786291446085261 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGTCGAATCCGATTATACGGATAAAGGCGTTAGGGTAAGCTTTCTTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.7875000000000001 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 0.9624999999999999 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.2875 0.0 0.0 0.0 0.0 108-109 1.5125 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 2.0875000000000004 0.0 0.0 0.0 0.0 114-115 2.375 0.0 0.0 0.0 0.0 116-117 2.7375 0.0 0.0 0.0 0.0 118-119 3.2375 0.0 0.0 0.0 0.0 120-121 3.475 0.0 0.0 0.0 0.0 122-123 3.7375 0.0 0.0 0.0 0.0 124-125 4.025 0.0 0.0 0.0 0.0 126-127 4.3375 0.0 0.0 0.0 0.0 128-129 4.925000000000001 0.0 0.0 0.0 0.0 130-131 5.362500000000001 0.0 0.0 0.0 0.0 132-133 5.8125 0.0 0.0 0.0 0.0 134-135 6.2875 0.0 0.0 0.0 0.0 136-137 6.7875 0.0 0.0 0.0 0.0 138-139 7.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12690134 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690134_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3835 37.0 37.0 37.0 37.0 37.0 2 36.186 37.0 37.0 37.0 37.0 37.0 3 36.2285 37.0 37.0 37.0 37.0 37.0 4 36.213 37.0 37.0 37.0 37.0 37.0 5 36.3175 37.0 37.0 37.0 37.0 37.0 6 36.3495 37.0 37.0 37.0 37.0 37.0 7 36.247 37.0 37.0 37.0 37.0 37.0 8 36.3435 37.0 37.0 37.0 37.0 37.0 9 36.4085 37.0 37.0 37.0 37.0 37.0 10-14 36.3702 37.0 37.0 37.0 37.0 37.0 15-19 36.315999999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.328500000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.2778 37.0 37.0 37.0 37.0 37.0 30-34 36.2359 37.0 37.0 37.0 37.0 37.0 35-39 36.271699999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.1766 37.0 37.0 37.0 37.0 37.0 45-49 36.2001 37.0 37.0 37.0 37.0 37.0 50-54 36.1437 37.0 37.0 37.0 37.0 37.0 55-59 36.1188 37.0 37.0 37.0 37.0 37.0 60-64 36.062200000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.132200000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.0243 37.0 37.0 37.0 37.0 37.0 75-79 36.0402 37.0 37.0 37.0 37.0 37.0 80-84 36.0424 37.0 37.0 37.0 37.0 37.0 85-89 36.0467 37.0 37.0 37.0 37.0 37.0 90-94 35.9366 37.0 37.0 37.0 37.0 37.0 95-99 35.9354 37.0 37.0 37.0 37.0 37.0 100-104 35.9863 37.0 37.0 37.0 37.0 37.0 105-109 35.9811 37.0 37.0 37.0 37.0 37.0 110-114 35.84420000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.7689 37.0 37.0 37.0 37.0 37.0 120-124 35.6786 37.0 37.0 37.0 37.0 37.0 125-129 35.6865 37.0 37.0 37.0 37.0 37.0 130-134 35.5584 37.0 37.0 37.0 37.0 37.0 135-139 35.5532 37.0 37.0 37.0 37.0 37.0 140-144 35.4683 37.0 37.0 37.0 37.0 37.0 145-149 35.3155 37.0 37.0 37.0 32.2 37.0 150-151 34.782 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 2.0 15 1.0 16 3.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.0 22 3.0 23 1.0 24 6.0 25 5.0 26 1.0 27 10.0 28 13.0 29 19.0 30 25.0 31 32.0 32 55.0 33 112.0 34 183.0 35 518.0 36 2730.0 37 274.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.525 23.625 11.15 26.700000000000003 2 28.15 26.075 29.45 16.325 3 19.7 28.549999999999997 31.825 19.925 4 22.125 34.775 23.674999999999997 19.425 5 24.825 35.675000000000004 22.55 16.950000000000003 6 20.200000000000003 40.35 22.475 16.975 7 18.575 24.65 38.25 18.525 8 21.65 25.575 28.775000000000002 24.0 9 21.65 25.7 30.025000000000002 22.625 10-14 23.485 29.439999999999998 26.99 20.085 15-19 22.84 28.83 27.425 20.905 20-24 22.895 28.725 27.315 21.065 25-29 22.400000000000002 28.59 28.115000000000002 20.895 30-34 22.805 28.675 28.185 20.335 35-39 22.785 28.310000000000002 28.53 20.375 40-44 23.24 27.825 28.305000000000003 20.630000000000003 45-49 23.34 28.384999999999998 27.445000000000004 20.830000000000002 50-54 22.63 28.744999999999997 27.589999999999996 21.035 55-59 22.96 27.455000000000002 28.9 20.685000000000002 60-64 22.61 27.61 28.175 21.605 65-69 23.28 28.01 28.03 20.68 70-74 22.67 27.905 27.82 21.605 75-79 23.07 27.66 27.815 21.455 80-84 23.14 28.165000000000003 27.58 21.115000000000002 85-89 22.900000000000002 28.455000000000002 27.889999999999997 20.755000000000003 90-94 22.735 27.785 28.415000000000003 21.065 95-99 22.759999999999998 27.839999999999996 28.225 21.175 100-104 23.580000000000002 27.744999999999997 27.66 21.015 105-109 23.515 27.839999999999996 28.000000000000004 20.645 110-114 23.865 28.115000000000002 27.944999999999997 20.075000000000003 115-119 24.08 28.810000000000002 26.505000000000003 20.605 120-124 23.96 27.85 27.805000000000003 20.385 125-129 24.45 27.750000000000004 27.3 20.5 130-134 24.575 28.04 27.355 20.03 135-139 24.925 27.950000000000003 27.04 20.085 140-144 25.1 28.15 26.590000000000003 20.16 145-149 25.25 28.110000000000003 26.674999999999997 19.965 150-151 26.025 28.3375 26.1 19.537499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 1.5 21 2.0 22 1.5 23 2.0 24 4.0 25 5.0 26 4.0 27 7.0 28 10.0 29 13.0 30 20.5 31 32.5 32 40.5 33 45.0 34 50.0 35 58.5 36 83.0 37 112.0 38 123.5 39 154.5 40 217.0 41 240.0 42 261.0 43 284.0 44 268.0 45 262.0 46 258.0 47 239.0 48 223.0 49 205.5 50 179.0 51 146.0 52 110.0 53 75.5 54 60.5 55 52.0 56 34.0 57 30.0 58 28.0 59 18.0 60 11.5 61 5.0 62 3.5 63 5.0 64 2.5 65 1.0 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.85 #Duplication Level Percentage of deduplicated Percentage of total 1 90.15025041736226 81.0 2 8.597662771285476 15.45 3 1.05731775180857 2.85 4 0.19476905954368393 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.7124999999999999 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.2875 0.0 0.0 0.0 0.0 108-109 1.5125 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 2.0875000000000004 0.0 0.0 0.0 0.0 114-115 2.3875 0.0 0.0 0.0 0.0 116-117 2.75 0.0 0.0 0.0 0.0 118-119 3.2625 0.0 0.0 0.0 0.0 120-121 3.5 0.0 0.0 0.0 0.0 122-123 3.7625 0.0 0.0 0.0 0.0 124-125 4.05 0.0 0.0 0.0 0.0 126-127 4.387499999999999 0.0 0.0 0.0 0.0 128-129 5.0 0.0 0.0 0.0 0.0 130-131 5.4375 0.0 0.0 0.0 0.0 132-133 5.8875 0.0 0.0 0.0 0.0 134-135 6.3625 0.0 0.0 0.0 0.0 136-137 6.8625 0.0 0.0 0.0 0.0 138-139 7.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTCCAA 10 0.006830828 145.0 145 >>END_MODULE Read 847273 spots for SRR12690134.sra Written 847273 spots for SRR12690134.sra Read 847273 spots for SRR12690134.sra Written 847273 spots for SRR12690134.sra Read 847273 spots for SRR12690134.sra Written 847273 spots for SRR12690134.sra Read 847273 spots for SRR12690134.sra Written 847273 spots for SRR12690134.sra Read 847273 spots for SRR12690134.sra Written 847273 spots for SRR12690134.sra Read 847273 spots for SRR12690134.sra Written 847273 spots for SRR12690134.sra Read 847273 spots for SRR12690134.sra Written 847273 spots for SRR12690134.sra Read 847273 spots for SRR12690134.sra Written 847273 spots for SRR12690134.sra Read 847274 spots for SRR12690134.sra Written 847274 spots for SRR12690134.sra Read 847273 spots for SRR12690134.sra Written 847273 spots for SRR12690134.sra Read 847273 spots for SRR12690134.sra Written 847273 spots for SRR12690134.sra Read 847273 spots for SRR12690134.sra Written 847273 spots for SRR12690134.sra Read 847273 spots for SRR12690134.sra Written 847273 spots for SRR12690134.sra Read 847273 spots for SRR12690134.sra Written 847273 spots for SRR12690134.sra Read 847273 spots for SRR12690134.sra Written 847273 spots for SRR12690134.sra Read 847273 spots for SRR12690134.sra Written 847273 spots for SRR12690134.sra Read 847273 spots for SRR12690134.sra Written 847273 spots for SRR12690134.sra Read 847273 spots for SRR12690134.sra Written 847273 spots for SRR12690134.sra Read 847273 spots for SRR12690134.sra Written 847273 spots for SRR12690134.sra Read 847273 spots for SRR12690134.sra Written 847273 spots for SRR12690134.sra SRR ids: ['SRR12690134.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_njss88tg SRR12690134.sra spots: 16945461 blocks: [[1, 847273], [847274, 1694546], [1694547, 2541819], [2541820, 3389092], [3389093, 4236365], [4236366, 5083638], [5083639, 5930911], [5930912, 6778184], [6778185, 7625457], [7625458, 8472730], [8472731, 9320003], [9320004, 10167276], [10167277, 11014549], [11014550, 11861822], [11861823, 12709095], [12709096, 13556368], [13556369, 14403641], [14403642, 15250914], [15250915, 16098187], [16098188, 16945461]] SRR12690134 file size 5737108 SRR12690134 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690134 SRR12690134_1.fastq SRR12690134_2.fastq Input file: SRR12690134_1.fastq Paired file: SRR12690134_2.fastq trimmed: SRR12690134-trimmed-pair1.fastq, SRR12690134-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:44:06 2025 >> started Mon Feb 10 17:44:33 2025 >> done (26.836s) 16945461 read pairs processed; of these: 19 ( 0.00%) short read pairs filtered out after trimming by size control 1316 ( 0.01%) empty read pairs filtered out after trimming by size control 16944126 (99.99%) read pairs available; of these: 1992181 (11.76%) trimmed read pairs available after processing 14951945 (88.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 6 0.00% 21 2 0.00% 22 6 0.00% 23 12 0.00% 24 5 0.00% 25 7 0.00% 26 10 0.00% 27 11 0.00% 28 20 0.00% 29 12 0.00% 30 12 0.00% 31 15 0.00% 32 25 0.00% 33 19 0.00% 34 18 0.00% 35 16 0.00% 36 15 0.00% 37 35 0.00% 38 41 0.00% 39 25 0.00% 40 36 0.00% 41 40 0.00% 42 35 0.00% 43 34 0.00% 44 36 0.00% 45 41 0.00% 46 40 0.00% 47 56 0.00% 48 71 0.00% 49 57 0.00% 50 80 0.00% 51 92 0.00% 52 115 0.00% 53 128 0.00% 54 122 0.00% 55 146 0.00% 56 130 0.00% 57 151 0.00% 58 194 0.00% 59 191 0.00% 60 288 0.00% 61 308 0.00% 62 309 0.00% 63 374 0.00% 64 417 0.00% 65 435 0.00% 66 513 0.00% 67 577 0.00% 68 663 0.00% 69 745 0.00% 70 851 0.01% 71 919 0.01% 72 1075 0.01% 73 1249 0.01% 74 1368 0.01% 75 1612 0.01% 76 1776 0.01% 77 1986 0.01% 78 2042 0.01% 79 2334 0.01% 80 2515 0.01% 81 2967 0.02% 82 3299 0.02% 83 3762 0.02% 84 4006 0.02% 85 4428 0.03% 86 5018 0.03% 87 5292 0.03% 88 5637 0.03% 89 6131 0.04% 90 6662 0.04% 91 7145 0.04% 92 7750 0.05% 93 8525 0.05% 94 9265 0.05% 95 9934 0.06% 96 10687 0.06% 97 11106 0.07% 98 11703 0.07% 99 12327 0.07% 100 13319 0.08% 101 13673 0.08% 102 14226 0.08% 103 15351 0.09% 104 16254 0.10% 105 17329 0.10% 106 17969 0.11% 107 18679 0.11% 108 19439 0.11% 109 20389 0.12% 110 21061 0.12% 111 21840 0.13% 112 22948 0.14% 113 23393 0.14% 114 24731 0.15% 115 25903 0.15% 116 26725 0.16% 117 27851 0.16% 118 28879 0.17% 119 29572 0.17% 120 30397 0.18% 121 31489 0.19% 122 32300 0.19% 123 33315 0.20% 124 34735 0.20% 125 35425 0.21% 126 36851 0.22% 127 37700 0.22% 128 38818 0.23% 129 40353 0.24% 130 40985 0.24% 131 41543 0.25% 132 43155 0.25% 133 43492 0.26% 134 44317 0.26% 135 45593 0.27% 136 46183 0.27% 137 47058 0.28% 138 48517 0.29% 139 49884 0.29% 140 51098 0.30% 141 51432 0.30% 142 53207 0.31% 143 53806 0.32% 144 54735 0.32% 145 55373 0.33% 146 56360 0.33% 147 57123 0.34% 148 58266 0.34% 149 59053 0.35% 150 59972 0.35% 151 14951945 88.24% 16944126 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=20 prefix-density=0.33 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=25 fanout-score=22.27 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=4.4 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=30 prefix-density=0.43 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=59.23 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.4 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR12690134 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:45:21 Started mapping on | Feb 10 17:45:21 Finished on | Feb 10 17:47:06 Mapping speed, Million of reads per hour | 580.94 Number of input reads | 16944126 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16039438 Uniquely mapped reads % | 94.66% Average mapped length | 295.32 Number of splices: Total | 15646042 Number of splices: Annotated (sjdb) | 15288063 Number of splices: GT/AG | 15338639 Number of splices: GC/AG | 249180 Number of splices: AT/AC | 10901 Number of splices: Non-canonical | 47322 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 438035 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 58984 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.27% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 466653 466653 466653 N_multimapping 438035 438035 438035 N_noFeature 631627 15874889 689442 N_ambiguous 208610 951 101278 UnstrandedReadsAssigned:15199201 PositiveStrandReadsAssigned:163598 NegativeStrandReadsAssigned:15248718 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690134 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690134-trimmed-pair1.fastq SRR12690134-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,944,126 reads, 15,287,572 reads pseudoaligned [quant] estimated average fragment length: 243.383 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,242 rounds 52401 SRR12690134.ke.tsv 34699 SRR12690134.se.tsv 87100 total ==> SRR12690134.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.62 835 31.5591 Potri.005G024800.1.v4.1 1035 792.617 370 31.3275 Potri.004G059700.1.v4.1 961 718.722 70 6.5362 Potri.007G009000.2.v4.1 1416 1173.62 0 0 Potri.003G141000.2.v4.1 2943 2700.62 783.738 19.4758 Potri.016G087400.1.v4.1 270 85.1149 620.48 489.227 Potri.015G069301.1.v4.1 564 330.629 0 0 Potri.010G195200.1.v4.1 1773 1530.62 23 1.00844 Potri.012G127500.1.v4.1 977 734.647 292 26.6742 ==> SRR12690134.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 692 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 221 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 9 SRR12690134 completed mapping pipeline successfully