Starting /dee2/code/volunteer_pipeline.sh SRR12690135 current disk space = 3057891811328 free memory = 1109610864 SRR12690135 SRAfilesize 9fe3ccea54d54007acfa5ce718546484 SRR12690135.sra SRR12690135.sra file validated SRR12690135 is paired end SRR12690135 is conventional basespace SRR12690135 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690135_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5005 37.0 37.0 37.0 37.0 37.0 2 36.403 37.0 37.0 37.0 37.0 37.0 3 36.595 37.0 37.0 37.0 37.0 37.0 4 36.6105 37.0 37.0 37.0 37.0 37.0 5 36.6235 37.0 37.0 37.0 37.0 37.0 6 36.6055 37.0 37.0 37.0 37.0 37.0 7 36.5155 37.0 37.0 37.0 37.0 37.0 8 36.593 37.0 37.0 37.0 37.0 37.0 9 36.6285 37.0 37.0 37.0 37.0 37.0 10-14 36.599000000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.5971 37.0 37.0 37.0 37.0 37.0 20-24 36.59830000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.543000000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.5389 37.0 37.0 37.0 37.0 37.0 35-39 36.5064 37.0 37.0 37.0 37.0 37.0 40-44 36.4776 37.0 37.0 37.0 37.0 37.0 45-49 36.4612 37.0 37.0 37.0 37.0 37.0 50-54 36.4088 37.0 37.0 37.0 37.0 37.0 55-59 36.363899999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.3466 37.0 37.0 37.0 37.0 37.0 65-69 36.2694 37.0 37.0 37.0 37.0 37.0 70-74 36.308299999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.325599999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.2555 37.0 37.0 37.0 37.0 37.0 85-89 36.28699999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.24980000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.2709 37.0 37.0 37.0 37.0 37.0 100-104 36.2133 37.0 37.0 37.0 37.0 37.0 105-109 36.140699999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.1842 37.0 37.0 37.0 37.0 37.0 115-119 36.0871 37.0 37.0 37.0 37.0 37.0 120-124 36.0064 37.0 37.0 37.0 37.0 37.0 125-129 36.0395 37.0 37.0 37.0 37.0 37.0 130-134 36.0043 37.0 37.0 37.0 37.0 37.0 135-139 35.9982 37.0 37.0 37.0 37.0 37.0 140-144 35.8078 37.0 37.0 37.0 37.0 37.0 145-149 35.7732 37.0 37.0 37.0 37.0 37.0 150-151 35.5435 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 0.0 26 3.0 27 6.0 28 7.0 29 10.0 30 25.0 31 30.0 32 43.0 33 85.0 34 137.0 35 341.0 36 2946.0 37 366.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.525 12.825000000000001 6.125 35.525 2 19.67871485943775 12.625502008032127 34.61345381526104 33.08232931726908 3 18.4 15.675 28.925 37.0 4 21.375 23.775 25.874999999999996 28.975 5 23.1 30.375000000000004 24.525 22.0 6 21.575 34.0 22.45 21.975 7 14.7 27.275 40.375 17.65 8 17.150000000000002 27.425 32.2 23.225 9 18.175 24.0 34.025 23.799999999999997 10-14 19.925 29.59 27.465 23.02 15-19 20.424999999999997 28.305000000000003 27.165 24.104999999999997 20-24 20.3 27.794999999999998 27.775 24.13 25-29 19.85 28.485 27.63 24.035 30-34 20.560000000000002 28.000000000000004 27.255000000000003 24.185000000000002 35-39 19.814999999999998 28.26 28.015 23.91 40-44 20.235 27.939999999999998 27.505000000000003 24.32 45-49 19.89 28.305000000000003 27.99 23.815 50-54 20.535 27.775 27.875 23.815 55-59 20.355 28.01 27.825 23.810000000000002 60-64 20.555 27.47 27.944999999999997 24.03 65-69 20.875 27.98 27.68 23.465 70-74 20.474999999999998 27.91 27.61 24.005000000000003 75-79 20.65 27.389999999999997 28.215 23.745 80-84 20.665 28.12 27.63 23.585 85-89 21.13 27.685 27.700000000000003 23.485 90-94 21.47 27.625 27.24 23.665 95-99 20.875 27.98 28.015 23.13 100-104 20.380000000000003 28.825 26.93 23.865 105-109 21.36 28.18 27.339999999999996 23.119999999999997 110-114 21.490000000000002 27.27 27.915 23.325000000000003 115-119 21.68 27.800000000000004 27.415 23.105 120-124 21.695 28.01 27.089999999999996 23.205000000000002 125-129 20.885 28.305000000000003 26.669999999999998 24.14 130-134 21.42 28.4 27.250000000000004 22.93 135-139 21.759999999999998 27.339999999999996 27.134999999999998 23.765 140-144 21.865000000000002 28.025 27.12 22.99 145-149 21.42 27.88 27.04 23.66 150-151 21.6875 27.6 27.150000000000002 23.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 1.5 24 2.0 25 2.5 26 3.0 27 6.0 28 8.5 29 14.5 30 18.0 31 17.5 32 21.0 33 27.0 34 38.0 35 59.5 36 78.5 37 86.5 38 120.5 39 157.0 40 183.0 41 218.5 42 227.0 43 244.0 44 271.5 45 284.0 46 266.5 47 251.5 48 238.5 49 221.5 50 203.5 51 155.0 52 128.5 53 103.5 54 79.0 55 64.0 56 43.0 57 37.0 58 34.5 59 24.0 60 13.5 61 9.5 62 7.0 63 3.0 64 2.5 65 3.0 66 5.0 67 5.0 68 2.5 69 0.5 70 0.5 71 2.0 72 2.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.875 #Duplication Level Percentage of deduplicated Percentage of total 1 91.71939477303988 83.35000000000001 2 7.015130674002751 12.75 3 0.9903713892709767 2.7 4 0.2200825309491059 0.8 5 0.027510316368638238 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027510316368638238 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTAGTCCATCTCGTAT 11 0.27499999999999997 TruSeq Adapter, Index 22 (97% over 37bp) GCCCATCAACTTCAGAGGATTCTGTCCTGAAGATCAGTTATGAAGGTTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.225 0.0 0.0 0.0 0.0 110-111 1.4 0.0 0.0 0.0 0.0 112-113 1.6124999999999998 0.0 0.0 0.0 0.0 114-115 1.825 0.0 0.0 0.0 0.0 116-117 2.0625 0.0 0.0 0.0 0.0 118-119 2.3125 0.0 0.0 0.0 0.0 120-121 2.6125 0.0 0.0 0.0 0.0 122-123 2.8625 0.0 0.0 0.0 0.0 124-125 3.0875 0.0 0.0 0.0 0.0 126-127 3.25 0.0 0.0 0.0 0.0 128-129 3.6125 0.0 0.0 0.0 0.0 130-131 4.1875 0.0 0.0 0.0 0.0 132-133 4.5 0.0 0.0 0.0 0.0 134-135 4.825 0.0 0.0 0.0 0.0 136-137 5.1625 0.0 0.0 0.0 0.0 138-139 5.512499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGATCT 10 0.006830828 145.0 7 >>END_MODULE SRR12690135 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690135_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.44 37.0 37.0 37.0 37.0 37.0 2 36.224 37.0 37.0 37.0 37.0 37.0 3 36.161 37.0 37.0 37.0 37.0 37.0 4 36.2115 37.0 37.0 37.0 37.0 37.0 5 36.344 37.0 37.0 37.0 37.0 37.0 6 36.304 37.0 37.0 37.0 37.0 37.0 7 36.217 37.0 37.0 37.0 37.0 37.0 8 36.317 37.0 37.0 37.0 37.0 37.0 9 36.263 37.0 37.0 37.0 37.0 37.0 10-14 36.25449999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.2541 37.0 37.0 37.0 37.0 37.0 20-24 36.2069 37.0 37.0 37.0 37.0 37.0 25-29 36.1531 37.0 37.0 37.0 37.0 37.0 30-34 36.1131 37.0 37.0 37.0 37.0 37.0 35-39 36.11990000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.095 37.0 37.0 37.0 37.0 37.0 45-49 36.1142 37.0 37.0 37.0 37.0 37.0 50-54 36.0416 37.0 37.0 37.0 37.0 37.0 55-59 36.0198 37.0 37.0 37.0 37.0 37.0 60-64 36.0267 37.0 37.0 37.0 37.0 37.0 65-69 35.933499999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.934099999999994 37.0 37.0 37.0 37.0 37.0 75-79 35.9232 37.0 37.0 37.0 37.0 37.0 80-84 35.9125 37.0 37.0 37.0 37.0 37.0 85-89 35.9257 37.0 37.0 37.0 37.0 37.0 90-94 35.839099999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.8581 37.0 37.0 37.0 37.0 37.0 100-104 35.9113 37.0 37.0 37.0 37.0 37.0 105-109 35.921800000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.866 37.0 37.0 37.0 37.0 37.0 115-119 35.7628 37.0 37.0 37.0 37.0 37.0 120-124 35.6334 37.0 37.0 37.0 37.0 37.0 125-129 35.632799999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.5757 37.0 37.0 37.0 37.0 37.0 135-139 35.4661 37.0 37.0 37.0 37.0 37.0 140-144 35.4825 37.0 37.0 37.0 37.0 37.0 145-149 35.301 37.0 37.0 37.0 34.6 37.0 150-151 34.836749999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 5.0 15 1.0 16 1.0 17 3.0 18 3.0 19 0.0 20 3.0 21 4.0 22 6.0 23 3.0 24 5.0 25 8.0 26 8.0 27 11.0 28 16.0 29 23.0 30 25.0 31 46.0 32 48.0 33 97.0 34 178.0 35 484.0 36 2714.0 37 306.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.075 26.125 9.9 23.9 2 27.975 28.199999999999996 27.35 16.475 3 21.099999999999998 29.175 30.475 19.25 4 24.075 35.05 22.6 18.275 5 23.925 37.75 20.625 17.7 6 21.075 40.725 21.0 17.2 7 20.525 22.8 37.3 19.375 8 20.200000000000003 27.325 27.150000000000002 25.324999999999996 9 20.825 24.65 30.525000000000002 24.0 10-14 23.18 29.575000000000003 26.095000000000002 21.15 15-19 23.16 28.585 27.265 20.990000000000002 20-24 22.275 28.625 27.93 21.17 25-29 22.5 28.485 27.85 21.165 30-34 23.400000000000002 27.775 28.065 20.76 35-39 22.455 28.28 28.110000000000003 21.154999999999998 40-44 22.915 27.915 27.865000000000002 21.305 45-49 22.695 28.08 27.805000000000003 21.42 50-54 22.689999999999998 28.15 27.744999999999997 21.415 55-59 22.73 27.794999999999998 27.965 21.51 60-64 23.275000000000002 28.185 27.189999999999998 21.349999999999998 65-69 23.13 27.900000000000002 27.250000000000004 21.72 70-74 23.34 27.51 27.400000000000002 21.75 75-79 22.965 27.529999999999998 27.61 21.895 80-84 23.085 28.03 27.33 21.555 85-89 22.81 27.994999999999997 27.029999999999998 22.165000000000003 90-94 23.96 28.125 26.919999999999998 20.995 95-99 23.165 28.215 27.185 21.435000000000002 100-104 24.63 27.85 26.384999999999998 21.135 105-109 23.735 27.465 27.384999999999998 21.415 110-114 23.549999999999997 28.115000000000002 27.529999999999998 20.805 115-119 24.305 27.950000000000003 26.855 20.89 120-124 24.474999999999998 27.775 27.200000000000003 20.549999999999997 125-129 24.785 27.944999999999997 27.07 20.200000000000003 130-134 24.77 28.345 26.75 20.135 135-139 24.705 27.810000000000002 27.155 20.330000000000002 140-144 24.895 28.165000000000003 26.305 20.635 145-149 25.27 28.29 26.224999999999998 20.215 150-151 26.787499999999998 28.0625 26.0125 19.1375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.5 13 1.0 14 0.5 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 2.0 24 2.5 25 2.0 26 2.0 27 4.5 28 7.0 29 13.0 30 17.0 31 18.0 32 24.0 33 31.5 34 40.5 35 57.0 36 79.5 37 101.5 38 124.5 39 171.5 40 205.5 41 223.0 42 251.0 43 279.0 44 281.5 45 267.0 46 264.5 47 253.0 48 224.5 49 205.5 50 183.0 51 151.5 52 113.5 53 85.5 54 72.5 55 50.0 56 44.0 57 34.5 58 26.5 59 22.5 60 13.0 61 7.5 62 6.5 63 5.5 64 2.0 65 0.0 66 1.0 67 1.5 68 0.5 69 0.0 70 1.0 71 1.0 72 0.5 73 1.0 74 1.0 75 0.5 76 0.0 77 0.5 78 1.0 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 1.0 89 1.5 90 0.5 91 1.0 92 1.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.5 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.825 #Duplication Level Percentage of deduplicated Percentage of total 1 91.68731076245528 83.275 2 7.046518029176989 12.8 3 0.9358656757500688 2.55 4 0.27525461051472616 1.0 5 0.027525461051472612 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027525461051472612 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 10 0.25 No Hit GCTACGAAGCCTAGTGAAAATCTCTATGACCAGAAGCCTGAAGAACCAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.8999999999999999 0.0 0.0 0.0 0.0 106-107 1.1124999999999998 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.4249999999999998 0.0 0.0 0.0 0.0 112-113 1.6375000000000002 0.0 0.0 0.0 0.0 114-115 1.85 0.0 0.0 0.0 0.0 116-117 2.0875 0.0 0.0 0.0 0.0 118-119 2.3375000000000004 0.0 0.0 0.0 0.0 120-121 2.6375 0.0 0.0 0.0 0.0 122-123 2.8875 0.0 0.0 0.0 0.0 124-125 3.1125 0.0 0.0 0.0 0.0 126-127 3.2750000000000004 0.0 0.0 0.0 0.0 128-129 3.6375 0.0 0.0 0.0 0.0 130-131 4.2125 0.0 0.0 0.0 0.0 132-133 4.55 0.0 0.0 0.0 0.0 134-135 4.875 0.0 0.0 0.0 0.0 136-137 5.2125 0.0 0.0 0.0 0.0 138-139 5.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAGTCT 10 0.006830828 145.0 3 GGGGGGG 125 0.005090842 9.28 125-129 >>END_MODULE Read 573542 spots for SRR12690135.sra Written 573542 spots for SRR12690135.sra Read 573542 spots for SRR12690135.sra Written 573542 spots for SRR12690135.sra Read 573542 spots for SRR12690135.sra Written 573542 spots for SRR12690135.sra Read 573542 spots for SRR12690135.sra Written 573542 spots for SRR12690135.sra Read 573542 spots for SRR12690135.sra Written 573542 spots for SRR12690135.sra Read 573542 spots for SRR12690135.sra Written 573542 spots for SRR12690135.sra Read 573542 spots for SRR12690135.sra Written 573542 spots for SRR12690135.sra Read 573542 spots for SRR12690135.sra Written 573542 spots for SRR12690135.sra Read 573542 spots for SRR12690135.sra Written 573542 spots for SRR12690135.sra Read 573542 spots for SRR12690135.sra Written 573542 spots for SRR12690135.sra Read 573542 spots for SRR12690135.sra Written 573542 spots for SRR12690135.sra Read 573542 spots for SRR12690135.sra Written 573542 spots for SRR12690135.sra Read 573542 spots for SRR12690135.sra Written 573542 spots for SRR12690135.sra Read 573542 spots for SRR12690135.sra Written 573542 spots for SRR12690135.sra Read 573542 spots for SRR12690135.sra Written 573542 spots for SRR12690135.sra Read 573554 spots for SRR12690135.sra Written 573554 spots for SRR12690135.sra Read 573542 spots for SRR12690135.sra Written 573542 spots for SRR12690135.sra Read 573542 spots for SRR12690135.sra Written 573542 spots for SRR12690135.sra Read 573542 spots for SRR12690135.sra Written 573542 spots for SRR12690135.sra Read 573542 spots for SRR12690135.sra Written 573542 spots for SRR12690135.sra SRR ids: ['SRR12690135.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3l8unr2q SRR12690135.sra spots: 11470852 blocks: [[1, 573542], [573543, 1147084], [1147085, 1720626], [1720627, 2294168], [2294169, 2867710], [2867711, 3441252], [3441253, 4014794], [4014795, 4588336], [4588337, 5161878], [5161879, 5735420], [5735421, 6308962], [6308963, 6882504], [6882505, 7456046], [7456047, 8029588], [8029589, 8603130], [8603131, 9176672], [9176673, 9750214], [9750215, 10323756], [10323757, 10897298], [10897299, 11470852]] SRR12690135 file size 3876596 SRR12690135 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690135 SRR12690135_1.fastq SRR12690135_2.fastq Input file: SRR12690135_1.fastq Paired file: SRR12690135_2.fastq trimmed: SRR12690135-trimmed-pair1.fastq, SRR12690135-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:51:15 2025 >> started Mon Feb 10 17:51:34 2025 >> done (18.204s) 11470852 read pairs processed; of these: 26 ( 0.00%) short read pairs filtered out after trimming by size control 19211 ( 0.17%) empty read pairs filtered out after trimming by size control 11451615 (99.83%) read pairs available; of these: 1082490 ( 9.45%) trimmed read pairs available after processing 10369125 (90.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 5 0.00% 20 4 0.00% 21 8 0.00% 22 10 0.00% 23 6 0.00% 24 14 0.00% 25 12 0.00% 26 13 0.00% 27 12 0.00% 28 15 0.00% 29 15 0.00% 30 28 0.00% 31 15 0.00% 32 18 0.00% 33 15 0.00% 34 19 0.00% 35 5 0.00% 36 17 0.00% 37 17 0.00% 38 20 0.00% 39 20 0.00% 40 19 0.00% 41 26 0.00% 42 26 0.00% 43 25 0.00% 44 23 0.00% 45 31 0.00% 46 38 0.00% 47 36 0.00% 48 40 0.00% 49 29 0.00% 50 55 0.00% 51 48 0.00% 52 61 0.00% 53 65 0.00% 54 48 0.00% 55 72 0.00% 56 79 0.00% 57 86 0.00% 58 100 0.00% 59 126 0.00% 60 121 0.00% 61 154 0.00% 62 140 0.00% 63 189 0.00% 64 195 0.00% 65 255 0.00% 66 254 0.00% 67 283 0.00% 68 290 0.00% 69 347 0.00% 70 385 0.00% 71 437 0.00% 72 532 0.00% 73 611 0.01% 74 711 0.01% 75 705 0.01% 76 853 0.01% 77 1009 0.01% 78 975 0.01% 79 1137 0.01% 80 1186 0.01% 81 1458 0.01% 82 1532 0.01% 83 1736 0.02% 84 1887 0.02% 85 2174 0.02% 86 2333 0.02% 87 2456 0.02% 88 2761 0.02% 89 2918 0.03% 90 3200 0.03% 91 3392 0.03% 92 3784 0.03% 93 4074 0.04% 94 4552 0.04% 95 4822 0.04% 96 5083 0.04% 97 5268 0.05% 98 5574 0.05% 99 6017 0.05% 100 6361 0.06% 101 6581 0.06% 102 7117 0.06% 103 7675 0.07% 104 8063 0.07% 105 8581 0.07% 106 8973 0.08% 107 9189 0.08% 108 9613 0.08% 109 9965 0.09% 110 10546 0.09% 111 11174 0.10% 112 11591 0.10% 113 12104 0.11% 114 12599 0.11% 115 13202 0.12% 116 13685 0.12% 117 14131 0.12% 118 14923 0.13% 119 15375 0.13% 120 15917 0.14% 121 16675 0.15% 122 17074 0.15% 123 18087 0.16% 124 18671 0.16% 125 19044 0.17% 126 19825 0.17% 127 20080 0.18% 128 20817 0.18% 129 21458 0.19% 130 22082 0.19% 131 22495 0.20% 132 23033 0.20% 133 24085 0.21% 134 24733 0.22% 135 25284 0.22% 136 26021 0.23% 137 26813 0.23% 138 27037 0.24% 139 28633 0.25% 140 28787 0.25% 141 29381 0.26% 142 29836 0.26% 143 30788 0.27% 144 32361 0.28% 145 32696 0.29% 146 33406 0.29% 147 34019 0.30% 148 34478 0.30% 149 34476 0.30% 150 35839 0.31% 151 10369125 90.55% 11451615 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=21 prefix-density=0.53 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=20.07 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.6 sequence=TTCAATTGTTCTTACAGTCACAATATCTTATTCTCTGACTGCTTATTAGACAATCGTCTTCACCATCAGAGCTGGGCATGTTTGATATCGTAAGCATCAGAATCATCAAGCTTCAGCTTAACTAGTTCGCTGATATCATATGGATAAGCGTCCTTTGGTGACTGACGTTTATATGCTCTTTTTCCGAAGGCCCAAGCTTTAGCTTCAGTAAAATGGGCTCCATCCCAGTACACATAGTCACTCCTGTTGCTACATGGGAAGGAGAGAGATTTACATGGGACTGAACCAGGTTCTACCTCGCAACAGCTCTTACGGGTTTGTGTAAAACCTGTATTTGTCTGATCATCAGAATCAATTTCGTAAGAGTTTATGTAGGTAAACACAGCATCAGAATGCCTATTATTAAGTTTTCTGAGTAGTTTTCGAAGCTTGTCGTTGAAAATTTGAACATCATCATTGAGCTTGTATGCACATGAAGATGCATCTAGTTCATTGGGATTTTTTTGTATGT criterion=sequence-density sequence-density=1.19 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=32 prefix-density=1.17 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=56.74 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=5.3 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGACTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTA SRR12690135 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:52:20 Started mapping on | Feb 10 17:52:20 Finished on | Feb 10 17:53:40 Mapping speed, Million of reads per hour | 515.32 Number of input reads | 11451615 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 10779913 Uniquely mapped reads % | 94.13% Average mapped length | 296.55 Number of splices: Total | 10799626 Number of splices: Annotated (sjdb) | 10577166 Number of splices: GT/AG | 10582795 Number of splices: GC/AG | 172665 Number of splices: AT/AC | 6722 Number of splices: Non-canonical | 37444 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 3.08 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 283187 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 35225 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.95% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 388515 388515 388515 N_multimapping 283187 283187 283187 N_noFeature 345207 10634004 383553 N_ambiguous 175111 515 67247 UnstrandedReadsAssigned:10259595 PositiveStrandReadsAssigned:145394 NegativeStrandReadsAssigned:10329113 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690135 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690135-trimmed-pair1.fastq SRR12690135-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,451,615 reads, 10,328,476 reads pseudoaligned [quant] estimated average fragment length: 257.703 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 992 rounds 52401 SRR12690135.ke.tsv 34699 SRR12690135.se.tsv 87100 total ==> SRR12690135.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.3 326 14.4403 Potri.005G024800.1.v4.1 1035 778.297 157 15.7379 Potri.004G059700.1.v4.1 961 704.536 30 3.32208 Potri.007G009000.2.v4.1 1416 1159.3 0 0 Potri.003G141000.2.v4.1 2943 2686.3 568 16.4963 Potri.016G087400.1.v4.1 270 80.9604 336.724 324.483 Potri.015G069301.1.v4.1 564 321.914 0 0 Potri.010G195200.1.v4.1 1773 1516.3 10 0.514526 Potri.012G127500.1.v4.1 977 720.426 255 27.6148 ==> SRR12690135.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 541 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 128 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR12690135 completed mapping pipeline successfully