Starting /dee2/code/volunteer_pipeline.sh SRR12690136 current disk space = 3057890660352 free memory = 1190158496 SRR12690136 SRAfilesize 4cbe364cf5b624a74e269cc17e865014 SRR12690136.sra SRR12690136.sra file validated SRR12690136 is paired end SRR12690136 is conventional basespace SRR12690136 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690136_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.516 37.0 37.0 37.0 37.0 37.0 2 36.3675 37.0 37.0 37.0 37.0 37.0 3 36.594 37.0 37.0 37.0 37.0 37.0 4 36.638 37.0 37.0 37.0 37.0 37.0 5 36.632 37.0 37.0 37.0 37.0 37.0 6 36.5915 37.0 37.0 37.0 37.0 37.0 7 36.518 37.0 37.0 37.0 37.0 37.0 8 36.5985 37.0 37.0 37.0 37.0 37.0 9 36.6165 37.0 37.0 37.0 37.0 37.0 10-14 36.62940000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.5935 37.0 37.0 37.0 37.0 37.0 20-24 36.5522 37.0 37.0 37.0 37.0 37.0 25-29 36.5124 37.0 37.0 37.0 37.0 37.0 30-34 36.494 37.0 37.0 37.0 37.0 37.0 35-39 36.4579 37.0 37.0 37.0 37.0 37.0 40-44 36.488099999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.42719999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.378099999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.3346 37.0 37.0 37.0 37.0 37.0 60-64 36.3435 37.0 37.0 37.0 37.0 37.0 65-69 36.274 37.0 37.0 37.0 37.0 37.0 70-74 36.31439999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.361000000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.2706 37.0 37.0 37.0 37.0 37.0 85-89 36.2547 37.0 37.0 37.0 37.0 37.0 90-94 36.2306 37.0 37.0 37.0 37.0 37.0 95-99 36.197599999999994 37.0 37.0 37.0 37.0 37.0 100-104 36.1609 37.0 37.0 37.0 37.0 37.0 105-109 36.162 37.0 37.0 37.0 37.0 37.0 110-114 36.1134 37.0 37.0 37.0 37.0 37.0 115-119 36.047200000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.9559 37.0 37.0 37.0 37.0 37.0 125-129 35.9087 37.0 37.0 37.0 37.0 37.0 130-134 35.814099999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.7327 37.0 37.0 37.0 37.0 37.0 140-144 35.4654 37.0 37.0 37.0 37.0 37.0 145-149 35.3862 37.0 37.0 37.0 37.0 37.0 150-151 35.14075 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 2.0 22 0.0 23 1.0 24 5.0 25 1.0 26 4.0 27 9.0 28 5.0 29 16.0 30 17.0 31 47.0 32 65.0 33 78.0 34 139.0 35 312.0 36 2956.0 37 342.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.675000000000004 14.649999999999999 6.525 42.15 2 17.853560682046137 12.83851554663992 41.80040120361083 27.50752256770311 3 15.1 16.425 29.875 38.6 4 19.725 23.974999999999998 25.825 30.475 5 22.0 30.425 25.074999999999996 22.5 6 20.150000000000002 33.125 24.325 22.400000000000002 7 15.2 27.700000000000003 40.725 16.375 8 16.075 26.674999999999997 32.875 24.375 9 16.900000000000002 23.3 35.05 24.75 10-14 19.42 27.965 28.665000000000003 23.95 15-19 19.650000000000002 27.544999999999998 27.93 24.875 20-24 20.355 28.139999999999997 27.82 23.685000000000002 25-29 20.115 28.735 27.529999999999998 23.62 30-34 20.330000000000002 28.110000000000003 27.115000000000002 24.445 35-39 19.685 27.950000000000003 27.175 25.19 40-44 20.21 28.075 27.63 24.085 45-49 20.495 27.99 27.450000000000003 24.065 50-54 20.555 27.625 27.93 23.89 55-59 20.285 27.465 27.99 24.26 60-64 20.82 27.115000000000002 27.755000000000003 24.310000000000002 65-69 20.855 27.685 27.500000000000004 23.96 70-74 20.52 27.605 27.139999999999997 24.735 75-79 20.915 27.700000000000003 27.334999999999997 24.05 80-84 20.560000000000002 27.810000000000002 27.694999999999997 23.935000000000002 85-89 20.93 27.855 26.755000000000003 24.46 90-94 21.17 27.155 27.034999999999997 24.64 95-99 21.235 27.1 27.939999999999998 23.724999999999998 100-104 21.675 27.71 26.91 23.705000000000002 105-109 21.51 28.139999999999997 26.179999999999996 24.169999999999998 110-114 21.22 27.98 26.515 24.285 115-119 21.145 27.93 26.76 24.165 120-124 21.25 28.15 26.44 24.16 125-129 21.165 27.935 25.929999999999996 24.97 130-134 21.34 27.435 26.555 24.67 135-139 21.855 27.700000000000003 26.205000000000002 24.240000000000002 140-144 22.06 27.250000000000004 25.94 24.75 145-149 22.175 27.22 25.929999999999996 24.675 150-151 22.275 27.85 26.337500000000002 23.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 1.5 24 3.0 25 4.0 26 3.0 27 5.0 28 9.5 29 14.5 30 17.0 31 19.0 32 25.0 33 36.5 34 47.5 35 55.0 36 71.5 37 98.5 38 122.5 39 137.5 40 151.5 41 172.5 42 209.0 43 243.5 44 270.0 45 268.5 46 264.5 47 271.0 48 245.0 49 218.5 50 201.5 51 176.5 52 136.0 53 101.5 54 89.0 55 74.5 56 53.5 57 46.0 58 37.0 59 26.0 60 20.0 61 9.5 62 6.5 63 5.5 64 4.0 65 3.5 66 2.5 67 3.5 68 2.5 69 1.0 70 2.5 71 2.0 72 0.5 73 0.5 74 1.0 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.725 #Duplication Level Percentage of deduplicated Percentage of total 1 91.04436483879856 82.6 2 7.853403141361256 14.249999999999998 3 0.9644530173601543 2.625 4 0.11022320198401765 0.4 5 0.027555800496004413 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCAGCCTCTTTCCTGTATGTTCCCCTGCCAAAGTCAAGGTTGTAAGAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.2625 0.0 0.0 0.0 0.0 72-73 0.35 0.0 0.0 0.0 0.0 74-75 0.35 0.0 0.0 0.0 0.0 76-77 0.425 0.0 0.0 0.0 0.0 78-79 0.4875 0.0 0.0 0.0 0.0 80-81 0.5875 0.0 0.0 0.0 0.0 82-83 0.725 0.0 0.0 0.0 0.0 84-85 0.8375 0.0 0.0 0.0 0.0 86-87 1.0375 0.0 0.0 0.0 0.0 88-89 1.2875 0.0 0.0 0.0 0.0 90-91 1.5125 0.0 0.0 0.0 0.0 92-93 1.7 0.0 0.0 0.0 0.0 94-95 1.8625 0.0 0.0 0.0 0.0 96-97 2.1875 0.0 0.0 0.0 0.0 98-99 2.4375 0.0 0.0 0.0 0.0 100-101 2.675 0.0 0.0 0.0 0.0 102-103 3.0125 0.0 0.0 0.0 0.0 104-105 3.3125 0.0 0.0 0.0 0.0 106-107 3.7874999999999996 0.0 0.0 0.0 0.0 108-109 4.125 0.0 0.0 0.0 0.0 110-111 4.725 0.0 0.0 0.0 0.0 112-113 5.262499999999999 0.0 0.0 0.0 0.0 114-115 5.75 0.0 0.0 0.0 0.0 116-117 6.225 0.0 0.0 0.0 0.0 118-119 6.725 0.0 0.0 0.0 0.0 120-121 7.2125 0.0 0.0 0.0 0.0 122-123 7.7875 0.0 0.0 0.0 0.0 124-125 8.225000000000001 0.0 0.0 0.0 0.0 126-127 8.55 0.0 0.0 0.0 0.0 128-129 9.225000000000001 0.0 0.0 0.0 0.0 130-131 9.9625 0.0 0.0 0.0 0.0 132-133 10.5125 0.0 0.0 0.0 0.0 134-135 11.0125 0.0 0.0 0.0 0.0 136-137 11.8 0.0 0.0 0.0 0.0 138-139 12.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12690136 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690136_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.41325 37.0 37.0 37.0 37.0 37.0 2 36.24 37.0 37.0 37.0 37.0 37.0 3 36.204 37.0 37.0 37.0 37.0 37.0 4 36.3745 37.0 37.0 37.0 37.0 37.0 5 36.4205 37.0 37.0 37.0 37.0 37.0 6 36.281 37.0 37.0 37.0 37.0 37.0 7 36.38 37.0 37.0 37.0 37.0 37.0 8 36.364 37.0 37.0 37.0 37.0 37.0 9 36.3895 37.0 37.0 37.0 37.0 37.0 10-14 36.2824 37.0 37.0 37.0 37.0 37.0 15-19 36.2871 37.0 37.0 37.0 37.0 37.0 20-24 36.2488 37.0 37.0 37.0 37.0 37.0 25-29 36.2503 37.0 37.0 37.0 37.0 37.0 30-34 36.2428 37.0 37.0 37.0 37.0 37.0 35-39 36.1601 37.0 37.0 37.0 37.0 37.0 40-44 36.0901 37.0 37.0 37.0 37.0 37.0 45-49 36.1041 37.0 37.0 37.0 37.0 37.0 50-54 36.1182 37.0 37.0 37.0 37.0 37.0 55-59 36.143899999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.0769 37.0 37.0 37.0 37.0 37.0 65-69 36.077 37.0 37.0 37.0 37.0 37.0 70-74 36.008799999999994 37.0 37.0 37.0 37.0 37.0 75-79 35.9902 37.0 37.0 37.0 37.0 37.0 80-84 35.9877 37.0 37.0 37.0 37.0 37.0 85-89 36.0115 37.0 37.0 37.0 37.0 37.0 90-94 35.9054 37.0 37.0 37.0 37.0 37.0 95-99 35.91610000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.919200000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.9035 37.0 37.0 37.0 37.0 37.0 110-114 35.845299999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.7856 37.0 37.0 37.0 37.0 37.0 120-124 35.7033 37.0 37.0 37.0 37.0 37.0 125-129 35.528800000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.46 37.0 37.0 37.0 37.0 37.0 135-139 35.3311 37.0 37.0 37.0 37.0 37.0 140-144 35.2695 37.0 37.0 37.0 37.0 37.0 145-149 35.005100000000006 37.0 37.0 37.0 27.4 37.0 150-151 34.59075 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 4.0 13 0.0 14 3.0 15 5.0 16 1.0 17 2.0 18 2.0 19 1.0 20 2.0 21 4.0 22 3.0 23 2.0 24 6.0 25 6.0 26 5.0 27 10.0 28 10.0 29 25.0 30 20.0 31 38.0 32 63.0 33 84.0 34 177.0 35 527.0 36 2734.0 37 266.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.63390847711928 24.356089022255563 9.802450612653162 30.207551887971995 2 27.125 26.625 31.75 14.499999999999998 3 20.0 29.7 30.625000000000004 19.675 4 22.8 33.475 25.074999999999996 18.65 5 25.124999999999996 36.4 20.875 17.599999999999998 6 24.099999999999998 37.724999999999994 21.2 16.975 7 23.3 23.0 34.75 18.95 8 23.075000000000003 25.2 27.3 24.425 9 21.975 24.625 30.4 23.0 10-14 24.55 28.595 25.39 21.465 15-19 24.525 28.765 26.11 20.599999999999998 20-24 24.625 28.754999999999995 26.19 20.43 25-29 24.85 28.144999999999996 25.990000000000002 21.015 30-34 23.799999999999997 27.29 27.32 21.59 35-39 24.055 27.33 27.13 21.485000000000003 40-44 24.165 27.815 26.685 21.335 45-49 24.310000000000002 27.47 26.955000000000002 21.265 50-54 24.044999999999998 26.669999999999998 27.644999999999996 21.64 55-59 24.645 27.589999999999996 26.405 21.36 60-64 24.505 28.52 26.529999999999998 20.445 65-69 24.740000000000002 27.275 27.145000000000003 20.84 70-74 24.295 27.62 26.63 21.455 75-79 24.335 28.000000000000004 26.545 21.12 80-84 24.95 28.01 26.424999999999997 20.615 85-89 24.275 27.99 26.51 21.224999999999998 90-94 24.715 27.834999999999997 26.66 20.79 95-99 25.135 27.384999999999998 25.724999999999998 21.755 100-104 25.230000000000004 27.735 26.275 20.76 105-109 25.06 27.66 26.479999999999997 20.8 110-114 25.230000000000004 27.57 26.950000000000003 20.25 115-119 25.729999999999997 28.189999999999998 25.75 20.330000000000002 120-124 25.88 27.82 26.055 20.244999999999997 125-129 26.1 27.625 25.89 20.385 130-134 26.779999999999998 27.889999999999997 25.674999999999997 19.655 135-139 27.235 27.765 26.22 18.78 140-144 27.465 27.229999999999997 25.83 19.475 145-149 28.4 27.029999999999998 25.790000000000003 18.78 150-151 28.4125 27.05 25.45 19.0875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.5 20 2.5 21 1.5 22 0.0 23 2.0 24 2.5 25 1.0 26 1.0 27 0.5 28 0.5 29 2.5 30 6.5 31 8.0 32 12.5 33 23.0 34 30.0 35 39.5 36 57.5 37 79.5 38 99.5 39 134.0 40 162.5 41 185.5 42 235.5 43 270.5 44 273.0 45 281.0 46 291.5 47 278.0 48 254.5 49 231.5 50 199.5 51 163.5 52 143.5 53 119.5 54 93.5 55 77.0 56 53.0 57 41.0 58 33.0 59 22.0 60 16.5 61 10.5 62 8.0 63 6.5 64 4.5 65 3.5 66 2.5 67 3.0 68 2.0 69 0.0 70 1.0 71 1.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.5 89 1.0 90 1.0 91 0.5 92 0.0 93 0.5 94 1.0 95 0.5 96 1.5 97 2.0 98 1.0 99 0.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 91.49286498353457 83.35000000000001 2 7.5192096597146 13.700000000000001 3 0.823271130625686 2.25 4 0.10976948408342481 0.4 5 0.027442371020856202 0.125 6 0.0 0.0 7 0.027442371020856202 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit AGTGGTTCTTTCATCGGTTGAAAGCAGGCCGCCCGATTCCAATTCCCAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.2625 0.0 0.0 0.0 0.0 72-73 0.35 0.0 0.0 0.0 0.0 74-75 0.35 0.0 0.0 0.0 0.0 76-77 0.425 0.0 0.0 0.0 0.0 78-79 0.4875 0.0 0.0 0.0 0.0 80-81 0.6000000000000001 0.0 0.0 0.0 0.0 82-83 0.75 0.0 0.0 0.0 0.0 84-85 0.8625 0.0 0.0 0.0 0.0 86-87 1.0625 0.0 0.0 0.0 0.0 88-89 1.3125 0.0 0.0 0.0 0.0 90-91 1.55 0.0 0.0 0.0 0.0 92-93 1.75 0.0 0.0 0.0 0.0 94-95 1.9125 0.0 0.0 0.0 0.0 96-97 2.2375 0.0 0.0 0.0 0.0 98-99 2.4875 0.0 0.0 0.0 0.0 100-101 2.7249999999999996 0.0 0.0 0.0 0.0 102-103 3.0625 0.0 0.0 0.0 0.0 104-105 3.3875 0.0 0.0 0.0 0.0 106-107 3.8625 0.0 0.0 0.0 0.0 108-109 4.199999999999999 0.0 0.0 0.0 0.0 110-111 4.8 0.0 0.0 0.0 0.0 112-113 5.3375 0.0 0.0 0.0 0.0 114-115 5.8375 0.0 0.0 0.0 0.0 116-117 6.3125 0.0 0.0 0.0 0.0 118-119 6.8 0.0 0.0 0.0 0.0 120-121 7.2875 0.0 0.0 0.0 0.0 122-123 7.8375 0.0 0.0 0.0 0.0 124-125 8.3 0.0 0.0 0.0 0.0 126-127 8.600000000000001 0.0 0.0 0.0 0.0 128-129 9.2375 0.0 0.0 0.0 0.0 130-131 9.9625 0.0 0.0 0.0 0.0 132-133 10.5125 0.0 0.0 0.0 0.0 134-135 11.024999999999999 0.0 0.0 0.0 0.0 136-137 11.774999999999999 0.0 0.0 0.0 0.0 138-139 12.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGATAT 20 3.5877043E-4 108.75 3 >>END_MODULE Read 800583 spots for SRR12690136.sra Written 800583 spots for SRR12690136.sra Read 800583 spots for SRR12690136.sra Written 800583 spots for SRR12690136.sra Read 800583 spots for SRR12690136.sra Written 800583 spots for SRR12690136.sra Read 800583 spots for SRR12690136.sra Written 800583 spots for SRR12690136.sra Read 800583 spots for SRR12690136.sra Written 800583 spots for SRR12690136.sra Read 800583 spots for SRR12690136.sra Written 800583 spots for SRR12690136.sra Read 800583 spots for SRR12690136.sra Written 800583 spots for SRR12690136.sra Read 800583 spots for SRR12690136.sra Written 800583 spots for SRR12690136.sra Read 800583 spots for SRR12690136.sra Written 800583 spots for SRR12690136.sra Read 800583 spots for SRR12690136.sra Written 800583 spots for SRR12690136.sra Read 800583 spots for SRR12690136.sra Written 800583 spots for SRR12690136.sra Read 800583 spots for SRR12690136.sra Written 800583 spots for SRR12690136.sra Read 800583 spots for SRR12690136.sra Written 800583 spots for SRR12690136.sra Read 800583 spots for SRR12690136.sra Written 800583 spots for SRR12690136.sra Read 800583 spots for SRR12690136.sra Written 800583 spots for SRR12690136.sra Read 800583 spots for SRR12690136.sra Written 800583 spots for SRR12690136.sra Read 800588 spots for SRR12690136.sra Written 800588 spots for SRR12690136.sra Read 800583 spots for SRR12690136.sra Written 800583 spots for SRR12690136.sra Read 800583 spots for SRR12690136.sra Written 800583 spots for SRR12690136.sra Read 800583 spots for SRR12690136.sra Written 800583 spots for SRR12690136.sra SRR ids: ['SRR12690136.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s450inqr SRR12690136.sra spots: 16011665 blocks: [[1, 800583], [800584, 1601166], [1601167, 2401749], [2401750, 3202332], [3202333, 4002915], [4002916, 4803498], [4803499, 5604081], [5604082, 6404664], [6404665, 7205247], [7205248, 8005830], [8005831, 8806413], [8806414, 9606996], [9606997, 10407579], [10407580, 11208162], [11208163, 12008745], [12008746, 12809328], [12809329, 13609911], [13609912, 14410494], [14410495, 15211077], [15211078, 16011665]] SRR12690136 file size 5419763 SRR12690136 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690136 SRR12690136_1.fastq SRR12690136_2.fastq Input file: SRR12690136_1.fastq Paired file: SRR12690136_2.fastq trimmed: SRR12690136-trimmed-pair1.fastq, SRR12690136-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:49:28 2025 >> started Mon Feb 10 17:49:47 2025 >> done (18.549s) 16011665 read pairs processed; of these: 99 ( 0.00%) short read pairs filtered out after trimming by size control 27893 ( 0.17%) empty read pairs filtered out after trimming by size control 15983673 (99.83%) read pairs available; of these: 2621478 (16.40%) trimmed read pairs available after processing 13362195 (83.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 7 0.00% 21 11 0.00% 22 13 0.00% 23 18 0.00% 24 21 0.00% 25 27 0.00% 26 40 0.00% 27 44 0.00% 28 59 0.00% 29 56 0.00% 30 46 0.00% 31 50 0.00% 32 71 0.00% 33 73 0.00% 34 62 0.00% 35 63 0.00% 36 112 0.00% 37 85 0.00% 38 100 0.00% 39 82 0.00% 40 138 0.00% 41 107 0.00% 42 104 0.00% 43 143 0.00% 44 162 0.00% 45 153 0.00% 46 188 0.00% 47 167 0.00% 48 224 0.00% 49 230 0.00% 50 285 0.00% 51 328 0.00% 52 376 0.00% 53 367 0.00% 54 408 0.00% 55 445 0.00% 56 512 0.00% 57 580 0.00% 58 671 0.00% 59 774 0.00% 60 895 0.01% 61 991 0.01% 62 1131 0.01% 63 1275 0.01% 64 1392 0.01% 65 1417 0.01% 66 1657 0.01% 67 1805 0.01% 68 2037 0.01% 69 2383 0.01% 70 2726 0.02% 71 2949 0.02% 72 3430 0.02% 73 3847 0.02% 74 4173 0.03% 75 4553 0.03% 76 5045 0.03% 77 5536 0.03% 78 5833 0.04% 79 6835 0.04% 80 7304 0.05% 81 7895 0.05% 82 8927 0.06% 83 9420 0.06% 84 10559 0.07% 85 11636 0.07% 86 11844 0.07% 87 12784 0.08% 88 13315 0.08% 89 14025 0.09% 90 14772 0.09% 91 16115 0.10% 92 17032 0.11% 93 18246 0.11% 94 19180 0.12% 95 20347 0.13% 96 20879 0.13% 97 21540 0.13% 98 22052 0.14% 99 23200 0.15% 100 23978 0.15% 101 24859 0.16% 102 25908 0.16% 103 26813 0.17% 104 27815 0.17% 105 28797 0.18% 106 29648 0.19% 107 30549 0.19% 108 31006 0.19% 109 31788 0.20% 110 32543 0.20% 111 33197 0.21% 112 34664 0.22% 113 34861 0.22% 114 35932 0.22% 115 37692 0.24% 116 37976 0.24% 117 38668 0.24% 118 39225 0.25% 119 39532 0.25% 120 40952 0.26% 121 41882 0.26% 122 42427 0.27% 123 43169 0.27% 124 44441 0.28% 125 45236 0.28% 126 45879 0.29% 127 46348 0.29% 128 47315 0.30% 129 47420 0.30% 130 48438 0.30% 131 49114 0.31% 132 49569 0.31% 133 51308 0.32% 134 51351 0.32% 135 52176 0.33% 136 53183 0.33% 137 53420 0.33% 138 54527 0.34% 139 55201 0.35% 140 55065 0.34% 141 55589 0.35% 142 56236 0.35% 143 57410 0.36% 144 58391 0.37% 145 59117 0.37% 146 59815 0.37% 147 59747 0.37% 148 60587 0.38% 149 60432 0.38% 150 61890 0.39% 151 13362195 83.60% 15983673 reads passed initial QC criterion=sequence-density sequence-density=1.02 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=18 prefix-density=1.03 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=82.22 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=2.1 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=22 prefix-density=0.86 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=62.08 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=4.4 sequence=CAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAAT SRR12690136 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:50:55 Started mapping on | Feb 10 17:50:56 Finished on | Feb 10 17:52:31 Mapping speed, Million of reads per hour | 605.70 Number of input reads | 15983673 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 15004583 Uniquely mapped reads % | 93.87% Average mapped length | 291.65 Number of splices: Total | 15405896 Number of splices: Annotated (sjdb) | 15150146 Number of splices: GT/AG | 15076045 Number of splices: GC/AG | 280991 Number of splices: AT/AC | 12648 Number of splices: Non-canonical | 36212 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 398423 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 171269 % of reads mapped to too many loci | 1.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.34% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 580667 580667 580667 N_multimapping 398423 398423 398423 N_noFeature 313229 14818865 353856 N_ambiguous 249714 824 104098 UnstrandedReadsAssigned:14441640 PositiveStrandReadsAssigned:184894 NegativeStrandReadsAssigned:14546629 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690136 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690136-trimmed-pair1.fastq SRR12690136-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,983,673 reads, 14,735,694 reads pseudoaligned [quant] estimated average fragment length: 229.475 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52401 SRR12690136.ke.tsv 34699 SRR12690136.se.tsv 87100 total ==> SRR12690136.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.53 429 13.7263 Potri.005G024800.1.v4.1 1035 806.525 248 17.6063 Potri.004G059700.1.v4.1 961 732.554 64 5.00235 Potri.007G009000.2.v4.1 1416 1187.53 0 0 Potri.003G141000.2.v4.1 2943 2714.53 358 7.55132 Potri.016G087400.1.v4.1 270 92.5116 1037 641.825 Potri.015G069301.1.v4.1 564 342.12 0 0 Potri.010G195200.1.v4.1 1773 1544.53 3 0.111214 Potri.012G127500.1.v4.1 977 748.531 693 53.0099 ==> SRR12690136.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 21 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 280 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 13 SRR12690136 completed mapping pipeline successfully