Starting /dee2/code/volunteer_pipeline.sh SRR12690137 current disk space = 3057810960384 free memory = 1021798988 SRR12690137 SRAfilesize 18b39d73eef62cd44867f7714381c857 SRR12690137.sra SRR12690137.sra file validated SRR12690137 is paired end SRR12690137 is conventional basespace SRR12690137 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690137_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5345 37.0 37.0 37.0 37.0 37.0 2 36.48925 37.0 37.0 37.0 37.0 37.0 3 36.6025 37.0 37.0 37.0 37.0 37.0 4 36.641 37.0 37.0 37.0 37.0 37.0 5 36.6685 37.0 37.0 37.0 37.0 37.0 6 36.6325 37.0 37.0 37.0 37.0 37.0 7 36.4855 37.0 37.0 37.0 37.0 37.0 8 36.669 37.0 37.0 37.0 37.0 37.0 9 36.67 37.0 37.0 37.0 37.0 37.0 10-14 36.6214 37.0 37.0 37.0 37.0 37.0 15-19 36.6243 37.0 37.0 37.0 37.0 37.0 20-24 36.596199999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.5693 37.0 37.0 37.0 37.0 37.0 30-34 36.537 37.0 37.0 37.0 37.0 37.0 35-39 36.5167 37.0 37.0 37.0 37.0 37.0 40-44 36.5346 37.0 37.0 37.0 37.0 37.0 45-49 36.4973 37.0 37.0 37.0 37.0 37.0 50-54 36.500800000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.463499999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.4342 37.0 37.0 37.0 37.0 37.0 65-69 36.4109 37.0 37.0 37.0 37.0 37.0 70-74 36.3634 37.0 37.0 37.0 37.0 37.0 75-79 36.3353 37.0 37.0 37.0 37.0 37.0 80-84 36.3046 37.0 37.0 37.0 37.0 37.0 85-89 36.2965 37.0 37.0 37.0 37.0 37.0 90-94 36.291700000000006 37.0 37.0 37.0 37.0 37.0 95-99 36.22950000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.17659999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.1721 37.0 37.0 37.0 37.0 37.0 110-114 36.1069 37.0 37.0 37.0 37.0 37.0 115-119 36.1082 37.0 37.0 37.0 37.0 37.0 120-124 36.0489 37.0 37.0 37.0 37.0 37.0 125-129 36.111599999999996 37.0 37.0 37.0 37.0 37.0 130-134 36.0104 37.0 37.0 37.0 37.0 37.0 135-139 36.0073 37.0 37.0 37.0 37.0 37.0 140-144 35.8268 37.0 37.0 37.0 37.0 37.0 145-149 35.7718 37.0 37.0 37.0 37.0 37.0 150-151 35.469 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 2.0 23 0.0 24 0.0 25 1.0 26 3.0 27 12.0 28 9.0 29 14.0 30 12.0 31 33.0 32 37.0 33 75.0 34 112.0 35 314.0 36 3001.0 37 374.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.675000000000004 12.7 7.124999999999999 37.5 2 21.322976697569533 13.806063643197195 35.27937860185417 29.591581057379102 3 17.45 18.0 30.25 34.300000000000004 4 21.575 24.65 26.200000000000003 27.575 5 22.725 31.825 23.549999999999997 21.9 6 21.0 34.949999999999996 22.900000000000002 21.15 7 15.950000000000001 26.674999999999997 40.425 16.950000000000003 8 18.3 26.575 30.075000000000003 25.05 9 17.299999999999997 23.65 34.925 24.125 10-14 19.695 28.999999999999996 27.595 23.71 15-19 19.945 28.525 27.894999999999996 23.635 20-24 20.215 28.29 27.845 23.65 25-29 20.244999999999997 28.435 27.735 23.585 30-34 19.580000000000002 28.660000000000004 27.305 24.455 35-39 20.315 28.21 27.58 23.895 40-44 20.04 28.51 27.355 24.095 45-49 20.61 27.96 27.35 24.08 50-54 20.16 28.335 27.939999999999998 23.565 55-59 20.685000000000002 27.644999999999996 27.875 23.794999999999998 60-64 20.830000000000002 27.595 26.97 24.605 65-69 20.9 27.529999999999998 28.1 23.47 70-74 20.3 28.360000000000003 27.425 23.915 75-79 20.195 28.549999999999997 27.425 23.830000000000002 80-84 20.31 28.005000000000003 27.544999999999998 24.14 85-89 20.724999999999998 28.715000000000003 26.765 23.794999999999998 90-94 21.3 27.944999999999997 27.49 23.265 95-99 20.044999999999998 27.715 28.025 24.215 100-104 20.244999999999997 27.97 27.88 23.905 105-109 21.23 27.91 27.04 23.82 110-114 20.86 28.139999999999997 27.165 23.835 115-119 20.565 28.095 27.49 23.849999999999998 120-124 21.17 27.944999999999997 27.200000000000003 23.685000000000002 125-129 21.27 27.805000000000003 28.235 22.689999999999998 130-134 20.665 27.750000000000004 27.029999999999998 24.555 135-139 21.345 27.810000000000002 27.015 23.830000000000002 140-144 21.335 27.560000000000002 27.089999999999996 24.015 145-149 21.315 27.72 26.93 24.035 150-151 20.6125 29.15 25.924999999999997 24.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 1.5 25 3.0 26 4.0 27 4.5 28 8.5 29 16.5 30 18.5 31 22.5 32 25.5 33 33.5 34 47.0 35 54.0 36 76.5 37 108.5 38 135.0 39 155.0 40 177.5 41 217.5 42 232.0 43 237.5 44 256.0 45 256.0 46 244.0 47 252.0 48 260.5 49 230.5 50 180.0 51 147.5 52 131.5 53 105.5 54 84.5 55 65.0 56 47.0 57 42.0 58 35.0 59 24.5 60 18.0 61 10.0 62 6.5 63 5.0 64 3.5 65 3.0 66 1.5 67 1.0 68 1.5 69 1.5 70 1.0 71 0.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.8 #Duplication Level Percentage of deduplicated Percentage of total 1 90.0890868596882 80.9 2 8.68596881959911 15.6 3 1.0022271714922049 2.7 4 0.22271714922048996 0.8 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.6499999999999999 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 0.85 0.0 0.0 0.0 0.0 94-95 0.95 0.0 0.0 0.0 0.0 96-97 1.15 0.0 0.0 0.0 0.0 98-99 1.4249999999999998 0.0 0.0 0.0 0.0 100-101 1.5875 0.0 0.0 0.0 0.0 102-103 1.725 0.0 0.0 0.0 0.0 104-105 1.9375 0.0 0.0 0.0 0.0 106-107 2.3125 0.0 0.0 0.0 0.0 108-109 2.5625 0.0 0.0 0.0 0.0 110-111 2.7 0.0 0.0 0.0 0.0 112-113 2.925 0.0 0.0 0.0 0.0 114-115 3.2875 0.0 0.0 0.0 0.0 116-117 3.6375 0.0 0.0 0.0 0.0 118-119 4.0625 0.0 0.0 0.0 0.0 120-121 4.525 0.0 0.0 0.0 0.0 122-123 5.025 0.0 0.0 0.0 0.0 124-125 5.525 0.0 0.0 0.0 0.0 126-127 6.125 0.0 0.0 0.0 0.0 128-129 6.9125 0.0 0.0 0.0 0.0 130-131 7.449999999999999 0.0 0.0 0.0 0.0 132-133 8.0125 0.0 0.0 0.0 0.0 134-135 8.8125 0.0 0.0 0.0 0.0 136-137 9.65 0.0 0.0 0.0 0.0 138-139 10.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGAGTA 10 0.006830828 145.0 4 TGCCTCC 10 0.006830828 145.0 6 >>END_MODULE SRR12690137 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690137_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.16675 37.0 37.0 37.0 37.0 37.0 2 36.0115 37.0 37.0 37.0 37.0 37.0 3 36.076 37.0 37.0 37.0 37.0 37.0 4 36.189 37.0 37.0 37.0 37.0 37.0 5 36.3345 37.0 37.0 37.0 37.0 37.0 6 36.2205 37.0 37.0 37.0 37.0 37.0 7 36.341 37.0 37.0 37.0 37.0 37.0 8 36.3955 37.0 37.0 37.0 37.0 37.0 9 36.372 37.0 37.0 37.0 37.0 37.0 10-14 36.24550000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.302499999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.273399999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.17229999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.1681 37.0 37.0 37.0 37.0 37.0 35-39 36.135000000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.1173 37.0 37.0 37.0 37.0 37.0 45-49 36.1552 37.0 37.0 37.0 37.0 37.0 50-54 36.0596 37.0 37.0 37.0 37.0 37.0 55-59 36.0555 37.0 37.0 37.0 37.0 37.0 60-64 35.980500000000006 37.0 37.0 37.0 37.0 37.0 65-69 35.947500000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.9211 37.0 37.0 37.0 37.0 37.0 75-79 35.9392 37.0 37.0 37.0 37.0 37.0 80-84 35.9431 37.0 37.0 37.0 37.0 37.0 85-89 35.9074 37.0 37.0 37.0 37.0 37.0 90-94 35.8427 37.0 37.0 37.0 37.0 37.0 95-99 35.8346 37.0 37.0 37.0 37.0 37.0 100-104 35.8567 37.0 37.0 37.0 37.0 37.0 105-109 35.8073 37.0 37.0 37.0 37.0 37.0 110-114 35.7056 37.0 37.0 37.0 37.0 37.0 115-119 35.6129 37.0 37.0 37.0 37.0 37.0 120-124 35.550700000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.544399999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.3759 37.0 37.0 37.0 34.6 37.0 135-139 35.21470000000001 37.0 37.0 37.0 32.2 37.0 140-144 35.1139 37.0 37.0 37.0 27.4 37.0 145-149 34.936 37.0 37.0 37.0 27.4 37.0 150-151 34.48375 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 3.0 14 2.0 15 3.0 16 1.0 17 1.0 18 0.0 19 0.0 20 2.0 21 4.0 22 4.0 23 4.0 24 4.0 25 6.0 26 5.0 27 12.0 28 16.0 29 16.0 30 35.0 31 41.0 32 62.0 33 120.0 34 214.0 35 568.0 36 2636.0 37 239.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.13553388347086 24.131032758189548 9.877469367341837 23.85596399099775 2 28.050000000000004 27.875 27.950000000000003 16.125 3 21.5 27.6 31.624999999999996 19.275000000000002 4 23.400000000000002 33.25 24.0 19.35 5 25.074999999999996 36.975 20.375 17.575 6 21.975 39.75 20.875 17.4 7 20.4 22.85 37.9 18.85 8 20.5 26.424999999999997 28.000000000000004 25.074999999999996 9 22.225 25.75 28.725 23.3 10-14 24.065 29.304999999999996 25.979999999999997 20.65 15-19 23.635 28.505000000000003 26.72 21.14 20-24 23.68 27.775 27.589999999999996 20.955 25-29 24.13 27.689999999999998 27.125 21.055 30-34 23.169999999999998 28.18 27.439999999999998 21.21 35-39 23.745 28.26 27.255000000000003 20.74 40-44 23.57 27.67 28.084999999999997 20.674999999999997 45-49 23.94 27.639999999999997 27.67 20.75 50-54 22.495 28.42 28.13 20.955 55-59 23.435 27.944999999999997 27.834999999999997 20.785 60-64 23.56 27.82 27.589999999999996 21.029999999999998 65-69 23.544999999999998 27.595 27.76 21.099999999999998 70-74 23.445 27.584999999999997 27.83 21.14 75-79 23.595 27.084999999999997 28.225 21.095 80-84 23.745 28.15 27.200000000000003 20.905 85-89 23.96 28.000000000000004 27.425 20.615 90-94 24.104999999999997 27.994999999999997 26.729999999999997 21.17 95-99 23.78 28.46 27.139999999999997 20.62 100-104 24.0 28.255000000000003 27.24 20.505000000000003 105-109 23.635 28.04 27.245 21.08 110-114 24.65 27.67 27.284999999999997 20.395 115-119 24.58 27.944999999999997 26.834999999999997 20.64 120-124 25.105 27.439999999999998 27.315 20.14 125-129 25.255 27.61 26.69 20.445 130-134 25.465 26.875 27.36 20.3 135-139 25.56 27.095000000000002 27.48 19.865 140-144 26.584999999999997 27.05 26.38 19.985 145-149 26.995 27.55 26.06 19.395 150-151 27.762500000000003 26.3 26.9125 19.025 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.5 23 2.0 24 1.5 25 1.5 26 5.0 27 6.0 28 7.0 29 8.0 30 9.5 31 19.0 32 31.5 33 28.5 34 34.5 35 51.5 36 67.0 37 100.5 38 135.5 39 167.5 40 198.5 41 218.5 42 244.0 43 264.0 44 268.5 45 272.5 46 265.0 47 262.0 48 251.5 49 218.5 50 173.0 51 139.0 52 118.0 53 94.5 54 76.5 55 55.5 56 41.0 57 33.0 58 25.0 59 25.0 60 22.5 61 14.5 62 9.0 63 4.5 64 3.5 65 2.5 66 0.5 67 0.5 68 1.5 69 1.5 70 0.5 71 0.5 72 1.0 73 0.5 74 0.5 75 0.5 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 1.0 98 1.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.8 #Duplication Level Percentage of deduplicated Percentage of total 1 90.25612472160356 81.05 2 8.407572383073497 15.1 3 1.0579064587973273 2.85 4 0.27839643652561247 1.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.7875000000000001 0.0 0.0 0.0 0.0 92-93 0.875 0.0 0.0 0.0 0.0 94-95 0.975 0.0 0.0 0.0 0.0 96-97 1.1749999999999998 0.0 0.0 0.0 0.0 98-99 1.4500000000000002 0.0 0.0 0.0 0.0 100-101 1.625 0.0 0.0 0.0 0.0 102-103 1.775 0.0 0.0 0.0 0.0 104-105 1.9875 0.0 0.0 0.0 0.0 106-107 2.3875 0.0 0.0 0.0 0.0 108-109 2.6375 0.0 0.0 0.0 0.0 110-111 2.7750000000000004 0.0 0.0 0.0 0.0 112-113 3.0 0.0 0.0 0.0 0.0 114-115 3.3625 0.0 0.0 0.0 0.0 116-117 3.7125000000000004 0.0 0.0 0.0 0.0 118-119 4.1625 0.0 0.0 0.0 0.0 120-121 4.625 0.0 0.0 0.0 0.0 122-123 5.125 0.0 0.0 0.0 0.0 124-125 5.612500000000001 0.0 0.0 0.0 0.0 126-127 6.2 0.0 0.0 0.0 0.0 128-129 7.0 0.0 0.0 0.0 0.0 130-131 7.574999999999999 0.0 0.0 0.0 0.0 132-133 8.1375 0.0 0.0 0.0 0.0 134-135 8.9125 0.0 0.0 0.0 0.0 136-137 9.7375 0.0 0.0 0.0 0.0 138-139 10.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCTGGA 10 0.006830828 145.0 145 CACCAGA 10 0.006830828 145.0 4 GCACCAG 10 0.006830828 145.0 3 ACTATGG 10 0.006830828 145.0 5 GAAGAGC 60 0.004491891 14.500001 140-144 >>END_MODULE Read 710536 spots for SRR12690137.sra Written 710536 spots for SRR12690137.sra Read 710536 spots for SRR12690137.sra Written 710536 spots for SRR12690137.sra Read 710536 spots for SRR12690137.sra Written 710536 spots for SRR12690137.sra Read 710536 spots for SRR12690137.sra Written 710536 spots for SRR12690137.sra Read 710536 spots for SRR12690137.sra Written 710536 spots for SRR12690137.sra Read 710536 spots for SRR12690137.sra Written 710536 spots for SRR12690137.sra Read 710536 spots for SRR12690137.sra Written 710536 spots for SRR12690137.sra Read 710536 spots for SRR12690137.sra Written 710536 spots for SRR12690137.sra Read 710536 spots for SRR12690137.sra Written 710536 spots for SRR12690137.sra Read 710536 spots for SRR12690137.sra Written 710536 spots for SRR12690137.sra Read 710536 spots for SRR12690137.sra Written 710536 spots for SRR12690137.sra Read 710536 spots for SRR12690137.sra Written 710536 spots for SRR12690137.sra Read 710536 spots for SRR12690137.sra Written 710536 spots for SRR12690137.sra Read 710537 spots for SRR12690137.sra Written 710537 spots for SRR12690137.sra Read 710536 spots for SRR12690137.sra Written 710536 spots for SRR12690137.sra Read 710536 spots for SRR12690137.sra Written 710536 spots for SRR12690137.sra Read 710536 spots for SRR12690137.sra Written 710536 spots for SRR12690137.sra Read 710536 spots for SRR12690137.sra Written 710536 spots for SRR12690137.sra Read 710536 spots for SRR12690137.sra Written 710536 spots for SRR12690137.sra Read 710536 spots for SRR12690137.sra Written 710536 spots for SRR12690137.sra SRR ids: ['SRR12690137.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rvkpvh0b SRR12690137.sra spots: 14210721 blocks: [[1, 710536], [710537, 1421072], [1421073, 2131608], [2131609, 2842144], [2842145, 3552680], [3552681, 4263216], [4263217, 4973752], [4973753, 5684288], [5684289, 6394824], [6394825, 7105360], [7105361, 7815896], [7815897, 8526432], [8526433, 9236968], [9236969, 9947504], [9947505, 10658040], [10658041, 11368576], [11368577, 12079112], [12079113, 12789648], [12789649, 13500184], [13500185, 14210721]] SRR12690137 file size 4807724 SRR12690137 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690137 SRR12690137_1.fastq SRR12690137_2.fastq Input file: SRR12690137_1.fastq Paired file: SRR12690137_2.fastq trimmed: SRR12690137-trimmed-pair1.fastq, SRR12690137-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:02:22 2025 >> started Mon Feb 10 18:02:38 2025 >> done (16.275s) 14210721 read pairs processed; of these: 27 ( 0.00%) short read pairs filtered out after trimming by size control 2992 ( 0.02%) empty read pairs filtered out after trimming by size control 14207702 (99.98%) read pairs available; of these: 2144807 (15.10%) trimmed read pairs available after processing 12062895 (84.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 4 0.00% 20 6 0.00% 21 11 0.00% 22 6 0.00% 23 30 0.00% 24 14 0.00% 25 24 0.00% 26 31 0.00% 27 32 0.00% 28 34 0.00% 29 35 0.00% 30 32 0.00% 31 25 0.00% 32 28 0.00% 33 36 0.00% 34 36 0.00% 35 34 0.00% 36 35 0.00% 37 38 0.00% 38 28 0.00% 39 45 0.00% 40 52 0.00% 41 64 0.00% 42 52 0.00% 43 48 0.00% 44 49 0.00% 45 63 0.00% 46 79 0.00% 47 67 0.00% 48 92 0.00% 49 122 0.00% 50 137 0.00% 51 115 0.00% 52 151 0.00% 53 144 0.00% 54 158 0.00% 55 159 0.00% 56 204 0.00% 57 209 0.00% 58 274 0.00% 59 308 0.00% 60 367 0.00% 61 378 0.00% 62 427 0.00% 63 464 0.00% 64 500 0.00% 65 618 0.00% 66 628 0.00% 67 760 0.01% 68 822 0.01% 69 948 0.01% 70 1106 0.01% 71 1202 0.01% 72 1456 0.01% 73 1484 0.01% 74 1739 0.01% 75 1968 0.01% 76 2035 0.01% 77 2324 0.02% 78 2522 0.02% 79 2763 0.02% 80 3167 0.02% 81 3698 0.03% 82 3944 0.03% 83 4406 0.03% 84 4806 0.03% 85 5283 0.04% 86 5629 0.04% 87 6113 0.04% 88 6459 0.05% 89 6957 0.05% 90 7746 0.05% 91 8236 0.06% 92 8983 0.06% 93 9597 0.07% 94 10769 0.08% 95 11235 0.08% 96 11729 0.08% 97 12398 0.09% 98 12814 0.09% 99 13736 0.10% 100 14353 0.10% 101 15116 0.11% 102 16454 0.12% 103 17350 0.12% 104 18329 0.13% 105 19178 0.13% 106 19681 0.14% 107 20053 0.14% 108 21214 0.15% 109 21668 0.15% 110 22541 0.16% 111 23834 0.17% 112 24749 0.17% 113 25850 0.18% 114 27080 0.19% 115 27934 0.20% 116 29030 0.20% 117 30116 0.21% 118 30653 0.22% 119 31458 0.22% 120 32761 0.23% 121 33716 0.24% 122 34806 0.24% 123 36525 0.26% 124 37385 0.26% 125 38486 0.27% 126 39766 0.28% 127 40567 0.29% 128 40932 0.29% 129 42197 0.30% 130 43158 0.30% 131 43651 0.31% 132 45412 0.32% 133 46787 0.33% 134 48601 0.34% 135 49434 0.35% 136 50352 0.35% 137 50642 0.36% 138 51583 0.36% 139 52931 0.37% 140 52384 0.37% 141 53959 0.38% 142 55596 0.39% 143 56581 0.40% 144 58628 0.41% 145 59997 0.42% 146 59994 0.42% 147 60521 0.43% 148 61322 0.43% 149 61539 0.43% 150 62619 0.44% 151 12062895 84.90% 14207702 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=22 prefix-density=0.46 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=20.93 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.4 sequence=TCAAATATATCGGTGACATCTAAGTTCAATGGGTGGTTTTTGTACATAGCAACAGCACTCTATGAGAAATCATAACGATCAGAGACATTACAAGTTCTAGTGATGATACAAAGGTTGCATCGACAAATACAAATATTTCAAGCTCCTTCCTTGATTAGGCAAGCATGTTCACCAGTGTTCCTCACTTGGGGGTGAAAGCAGAAAAAACGGTGGCATGACCAGGATCTGCAAGGTGAGCAAAGAGGTTGTCGATAGGACCAGTGCCAGTGTAAATGTGTTGGAACCAAGCACCCATGACAGCCAACATAGCCAA criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=19 prefix-density=0.66 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=16.37 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.5 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC SRR12690137 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:03:29 Started mapping on | Feb 10 18:03:29 Finished on | Feb 10 18:05:08 Mapping speed, Million of reads per hour | 516.64 Number of input reads | 14207702 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 13255686 Uniquely mapped reads % | 93.30% Average mapped length | 293.45 Number of splices: Total | 13447167 Number of splices: Annotated (sjdb) | 13147607 Number of splices: GT/AG | 13169831 Number of splices: GC/AG | 221598 Number of splices: AT/AC | 10378 Number of splices: Non-canonical | 45360 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 321826 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 74766 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.75% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 630190 630190 630190 N_multimapping 321826 321826 321826 N_noFeature 476293 13089199 531450 N_ambiguous 193291 1085 81203 UnstrandedReadsAssigned:12586102 PositiveStrandReadsAssigned:165402 NegativeStrandReadsAssigned:12643033 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690137 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690137-trimmed-pair1.fastq SRR12690137-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,207,702 reads, 12,732,941 reads pseudoaligned [quant] estimated average fragment length: 227.655 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,038 rounds 52401 SRR12690137.ke.tsv 34699 SRR12690137.se.tsv 87100 total ==> SRR12690137.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.34 652 25.7116 Potri.005G024800.1.v4.1 1035 808.345 226 19.7503 Potri.004G059700.1.v4.1 961 734.424 33 3.17415 Potri.007G009000.2.v4.1 1416 1189.34 0 0 Potri.003G141000.2.v4.1 2943 2716.34 528.841 13.7531 Potri.016G087400.1.v4.1 270 90.1219 576.642 451.998 Potri.015G069301.1.v4.1 564 345.728 0 0 Potri.010G195200.1.v4.1 1773 1546.34 50.6374 2.31327 Potri.012G127500.1.v4.1 977 750.385 164 15.4391 ==> SRR12690137.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 174 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 255 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR12690137 completed mapping pipeline successfully