Starting /dee2/code/volunteer_pipeline.sh SRR12690139 current disk space = 3057684189184 free memory = 1240843652 SRR12690139 SRAfilesize 90a2f7cee10fd87f347875c3b8e9c57f SRR12690139.sra SRR12690139.sra file validated SRR12690139 is paired end SRR12690139 is conventional basespace SRR12690139 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690139_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.597 37.0 37.0 37.0 37.0 37.0 2 36.36975 37.0 37.0 37.0 37.0 37.0 3 36.556 37.0 37.0 37.0 37.0 37.0 4 36.602 37.0 37.0 37.0 37.0 37.0 5 36.6395 37.0 37.0 37.0 37.0 37.0 6 36.565 37.0 37.0 37.0 37.0 37.0 7 36.566 37.0 37.0 37.0 37.0 37.0 8 36.5925 37.0 37.0 37.0 37.0 37.0 9 36.6125 37.0 37.0 37.0 37.0 37.0 10-14 36.59119999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.584199999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.576899999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.506600000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.5357 37.0 37.0 37.0 37.0 37.0 35-39 36.5069 37.0 37.0 37.0 37.0 37.0 40-44 36.4599 37.0 37.0 37.0 37.0 37.0 45-49 36.3932 37.0 37.0 37.0 37.0 37.0 50-54 36.4187 37.0 37.0 37.0 37.0 37.0 55-59 36.352199999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.3772 37.0 37.0 37.0 37.0 37.0 65-69 36.3094 37.0 37.0 37.0 37.0 37.0 70-74 36.291 37.0 37.0 37.0 37.0 37.0 75-79 36.3281 37.0 37.0 37.0 37.0 37.0 80-84 36.22089999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.272800000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.1762 37.0 37.0 37.0 37.0 37.0 95-99 36.1906 37.0 37.0 37.0 37.0 37.0 100-104 36.1592 37.0 37.0 37.0 37.0 37.0 105-109 36.079699999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.069399999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.0586 37.0 37.0 37.0 37.0 37.0 120-124 36.0302 37.0 37.0 37.0 37.0 37.0 125-129 35.9778 37.0 37.0 37.0 37.0 37.0 130-134 35.916 37.0 37.0 37.0 37.0 37.0 135-139 36.007400000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.8001 37.0 37.0 37.0 37.0 37.0 145-149 35.70440000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.6325 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 0.0 25 3.0 26 7.0 27 4.0 28 17.0 29 17.0 30 28.0 31 32.0 32 47.0 33 65.0 34 115.0 35 321.0 36 2999.0 37 343.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.725 11.025 5.775 39.475 2 19.422835633626097 14.002509410288583 35.8594730238394 30.715181932245923 3 16.175 16.575 28.749999999999996 38.5 4 21.25 23.400000000000002 24.5 30.85 5 23.825 30.975 25.05 20.150000000000002 6 20.825 35.449999999999996 22.125 21.6 7 16.175 26.35 39.975 17.5 8 18.325 27.05 30.85 23.775 9 17.974999999999998 23.150000000000002 36.875 22.0 10-14 19.55 30.005 27.005000000000003 23.44 15-19 20.025000000000002 27.994999999999997 27.98 24.0 20-24 20.055 28.48 27.67 23.794999999999998 25-29 19.86 28.689999999999998 27.99 23.46 30-34 19.900000000000002 28.24 28.249999999999996 23.61 35-39 20.22 28.625 27.305 23.849999999999998 40-44 20.21 28.720000000000002 27.04 24.03 45-49 20.335 28.275 27.595 23.794999999999998 50-54 20.435 28.410000000000004 27.525 23.630000000000003 55-59 20.215 28.199999999999996 27.68 23.905 60-64 20.79 27.74 27.775 23.695 65-69 20.225 28.17 27.33 24.275 70-74 20.175 28.53 27.839999999999996 23.455000000000002 75-79 20.080000000000002 28.689999999999998 27.025 24.205 80-84 20.51 28.87 27.355 23.265 85-89 20.375 28.694999999999997 27.195000000000004 23.735 90-94 20.05 28.52 27.49 23.94 95-99 20.755000000000003 28.01 27.98 23.255 100-104 20.62 28.935 27.08 23.365 105-109 20.485 28.694999999999997 27.38 23.44 110-114 20.665 28.025 27.91 23.400000000000002 115-119 21.12 28.22 27.58 23.080000000000002 120-124 20.995 29.09 26.505000000000003 23.41 125-129 20.945 28.294999999999998 27.05 23.71 130-134 21.224999999999998 28.275 27.0 23.5 135-139 21.02 28.24 27.155 23.585 140-144 21.58 28.044999999999998 27.060000000000002 23.315 145-149 21.529999999999998 28.050000000000004 26.55 23.87 150-151 21.337500000000002 28.512500000000003 27.1375 23.0125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.5 23 3.0 24 2.0 25 0.5 26 2.0 27 6.0 28 7.5 29 11.0 30 17.0 31 23.5 32 31.5 33 43.0 34 58.0 35 69.0 36 83.5 37 101.5 38 135.5 39 160.5 40 174.5 41 204.0 42 225.0 43 230.5 44 245.0 45 261.5 46 266.5 47 252.5 48 245.0 49 249.0 50 197.5 51 141.5 52 123.5 53 107.5 54 80.5 55 63.5 56 46.5 57 28.5 58 28.5 59 23.0 60 16.0 61 11.0 62 5.5 63 3.5 64 2.5 65 2.0 66 1.5 67 0.5 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.45385450597176 85.15 2 6.731813246471227 12.4 3 0.6786102062975028 1.875 4 0.08143322475570033 0.3 5 0.02714440825190011 0.125 6 0.02714440825190011 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCTTTCAACCCACTGCAGCAAGCTGCAGGCACAGCCCCACCCTTCTGG 6 0.15 No Hit GCCCGATTCAGCATCCGAATCCAGAAGCTAAAAACAAAAACAAAGTAGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.1375 0.0 0.0 0.0 0.0 110-111 1.3250000000000002 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.775 0.0 0.0 0.0 0.0 116-117 1.925 0.0 0.0 0.0 0.0 118-119 2.1625 0.0 0.0 0.0 0.0 120-121 2.4125 0.0 0.0 0.0 0.0 122-123 2.6500000000000004 0.0 0.0 0.0 0.0 124-125 2.9875 0.0 0.0 0.0 0.0 126-127 3.2875 0.0 0.0 0.0 0.0 128-129 3.6624999999999996 0.0 0.0 0.0 0.0 130-131 4.0625 0.0 0.0 0.0 0.0 132-133 4.5375 0.0 0.0 0.0 0.0 134-135 5.0 0.0 0.0 0.0 0.0 136-137 5.387499999999999 0.0 0.0 0.0 0.0 138-139 6.050000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCCAAG 10 0.006830828 145.0 6 ATTTTCA 20 0.00593511 29.0 60-64 >>END_MODULE SRR12690139 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690139_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3915 37.0 37.0 37.0 37.0 37.0 2 36.143 37.0 37.0 37.0 37.0 37.0 3 36.144 37.0 37.0 37.0 37.0 37.0 4 36.1235 37.0 37.0 37.0 37.0 37.0 5 36.384 37.0 37.0 37.0 37.0 37.0 6 36.213 37.0 37.0 37.0 37.0 37.0 7 36.26 37.0 37.0 37.0 37.0 37.0 8 36.2875 37.0 37.0 37.0 37.0 37.0 9 36.378 37.0 37.0 37.0 37.0 37.0 10-14 36.3178 37.0 37.0 37.0 37.0 37.0 15-19 36.288199999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.2613 37.0 37.0 37.0 37.0 37.0 25-29 36.2098 37.0 37.0 37.0 37.0 37.0 30-34 36.175399999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.102500000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.013400000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.0964 37.0 37.0 37.0 37.0 37.0 50-54 36.0653 37.0 37.0 37.0 37.0 37.0 55-59 36.0391 37.0 37.0 37.0 37.0 37.0 60-64 36.0141 37.0 37.0 37.0 37.0 37.0 65-69 35.9166 37.0 37.0 37.0 37.0 37.0 70-74 35.8697 37.0 37.0 37.0 37.0 37.0 75-79 35.943400000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.95700000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.895500000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.76180000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.8774 37.0 37.0 37.0 37.0 37.0 100-104 35.8779 37.0 37.0 37.0 37.0 37.0 105-109 35.7469 37.0 37.0 37.0 37.0 37.0 110-114 35.7061 37.0 37.0 37.0 37.0 37.0 115-119 35.6554 37.0 37.0 37.0 37.0 37.0 120-124 35.597500000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.584500000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.4936 37.0 37.0 37.0 37.0 37.0 135-139 35.4889 37.0 37.0 37.0 37.0 37.0 140-144 35.4165 37.0 37.0 37.0 37.0 37.0 145-149 35.2644 37.0 37.0 37.0 29.8 37.0 150-151 34.899 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 5.0 15 5.0 16 2.0 17 4.0 18 3.0 19 3.0 20 0.0 21 1.0 22 4.0 23 8.0 24 8.0 25 8.0 26 7.0 27 11.0 28 13.0 29 17.0 30 38.0 31 35.0 32 54.0 33 90.0 34 175.0 35 467.0 36 2732.0 37 308.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.275 25.025 9.049999999999999 25.650000000000002 2 27.775 26.950000000000003 30.15 15.125 3 21.675 29.025000000000002 29.975 19.325 4 23.525 34.925 23.025000000000002 18.525 5 24.025 36.975 22.3 16.7 6 20.724999999999998 40.2 21.099999999999998 17.974999999999998 7 20.175 23.150000000000002 37.175000000000004 19.5 8 20.25 25.3 28.599999999999998 25.85 9 21.975 23.875 30.125 24.025 10-14 23.005 28.575 26.995 21.425 15-19 23.005 28.165000000000003 27.195000000000004 21.634999999999998 20-24 22.595000000000002 28.945 27.405 21.055 25-29 22.25 28.360000000000003 27.985 21.404999999999998 30-34 23.105 27.834999999999997 28.325 20.735 35-39 22.759999999999998 27.18 28.705000000000002 21.355 40-44 22.235 27.474999999999998 28.925 21.365000000000002 45-49 22.825 28.165000000000003 28.115000000000002 20.895 50-54 22.61 28.46 27.810000000000002 21.12 55-59 22.994999999999997 28.005000000000003 27.955000000000002 21.044999999999998 60-64 22.985 27.755000000000003 27.765 21.495 65-69 23.285 27.905 27.63 21.18 70-74 23.23 28.194999999999997 28.000000000000004 20.575 75-79 22.915 27.98 28.04 21.065 80-84 22.770000000000003 28.235 27.72 21.275 85-89 23.18 28.375 27.495000000000005 20.95 90-94 23.07 27.49 28.235 21.205 95-99 23.46 28.110000000000003 27.839999999999996 20.59 100-104 23.505000000000003 28.749999999999996 27.32 20.424999999999997 105-109 23.415 28.505000000000003 27.655 20.424999999999997 110-114 23.915 28.105000000000004 27.985 19.994999999999997 115-119 24.75 27.955000000000002 26.935 20.36 120-124 24.09 27.500000000000004 28.435 19.975 125-129 24.474999999999998 27.265 27.779999999999998 20.48 130-134 23.93 28.095 27.05 20.925 135-139 24.959999999999997 27.91 27.089999999999996 20.04 140-144 24.285 28.37 27.055 20.29 145-149 24.709999999999997 27.694999999999997 27.43 20.165 150-151 24.712500000000002 28.012500000000003 26.6125 20.6625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 1.0 5 0.5 6 0.0 7 1.0 8 1.0 9 0.5 10 1.0 11 0.5 12 0.5 13 1.5 14 1.0 15 0.5 16 1.0 17 1.5 18 1.0 19 1.5 20 2.5 21 2.5 22 3.0 23 4.5 24 3.5 25 1.5 26 1.5 27 1.5 28 5.5 29 11.0 30 12.5 31 15.5 32 28.0 33 42.0 34 54.0 35 80.0 36 109.5 37 119.5 38 131.5 39 159.0 40 184.5 41 214.0 42 244.0 43 252.0 44 244.0 45 268.5 46 290.0 47 260.5 48 220.0 49 190.0 50 174.0 51 151.0 52 116.0 53 86.5 54 74.0 55 58.5 56 46.5 57 37.5 58 17.0 59 13.5 60 14.0 61 10.0 62 7.0 63 4.0 64 3.0 65 1.0 66 0.0 67 1.5 68 1.5 69 0.0 70 0.0 71 0.0 72 1.0 73 1.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 1.0 97 0.5 98 0.5 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.825 #Duplication Level Percentage of deduplicated Percentage of total 1 92.56738361012796 85.0 2 6.4252654505853535 11.799999999999999 3 0.8167710318540702 2.25 4 0.054451402123604685 0.2 5 0.027225701061802342 0.125 6 0.08167710318540702 0.44999999999999996 7 0.027225701061802342 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTC 7 0.17500000000000002 No Hit CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 6 0.15 No Hit CTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCC 6 0.15 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.025 0.0 0.0 0.025 0.0 72-73 0.05 0.0 0.0 0.025 0.0 74-75 0.0625 0.0 0.0 0.025 0.0 76-77 0.075 0.0 0.0 0.025 0.0 78-79 0.075 0.0 0.0 0.025 0.0 80-81 0.0875 0.0 0.0 0.025 0.0 82-83 0.125 0.0 0.0 0.025 0.0 84-85 0.125 0.0 0.0 0.025 0.0 86-87 0.16249999999999998 0.0 0.0 0.025 0.0 88-89 0.25 0.0 0.0 0.025 0.0 90-91 0.25 0.0 0.0 0.025 0.0 92-93 0.3125 0.0 0.0 0.025 0.0 94-95 0.375 0.0 0.0 0.025 0.0 96-97 0.475 0.0 0.0 0.025 0.0 98-99 0.575 0.0 0.0 0.025 0.0 100-101 0.7 0.0 0.0 0.025 0.0 102-103 0.825 0.0 0.0 0.025 0.0 104-105 0.9624999999999999 0.0 0.0 0.025 0.0 106-107 1.0499999999999998 0.0 0.0 0.025 0.0 108-109 1.1625 0.0 0.0 0.025 0.0 110-111 1.35 0.0 0.0 0.025 0.0 112-113 1.6 0.0 0.0 0.025 0.0 114-115 1.775 0.0 0.0 0.025 0.0 116-117 1.95 0.0 0.0 0.025 0.0 118-119 2.1875 0.0 0.0 0.025 0.0 120-121 2.4625 0.0 0.0 0.025 0.0 122-123 2.7 0.0 0.0 0.025 0.0 124-125 3.0375 0.0 0.0 0.025 0.0 126-127 3.3375 0.0 0.0 0.025 0.0 128-129 3.7125000000000004 0.0 0.0 0.025 0.0 130-131 4.1375 0.0 0.0 0.025 0.0 132-133 4.6375 0.0 0.0 0.025 0.0 134-135 5.1 0.0 0.0 0.025 0.0 136-137 5.487500000000001 0.0 0.0 0.025 0.0 138-139 6.175000000000001 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTTTA 10 0.006830828 145.0 9 AACACAT 10 0.006830828 145.0 1 >>END_MODULE Read 1000389 spots for SRR12690139.sra Written 1000389 spots for SRR12690139.sra Read 1000389 spots for SRR12690139.sra Written 1000389 spots for SRR12690139.sra Read 1000389 spots for SRR12690139.sra Written 1000389 spots for SRR12690139.sra Read 1000389 spots for SRR12690139.sra Written 1000389 spots for SRR12690139.sra Read 1000389 spots for SRR12690139.sra Written 1000389 spots for SRR12690139.sra Read 1000389 spots for SRR12690139.sra Written 1000389 spots for SRR12690139.sra Read 1000389 spots for SRR12690139.sra Written 1000389 spots for SRR12690139.sra Read 1000389 spots for SRR12690139.sra Written 1000389 spots for SRR12690139.sra Read 1000389 spots for SRR12690139.sra Written 1000389 spots for SRR12690139.sra Read 1000389 spots for SRR12690139.sra Written 1000389 spots for SRR12690139.sra Read 1000389 spots for SRR12690139.sra Written 1000389 spots for SRR12690139.sra Read 1000389 spots for SRR12690139.sra Written 1000389 spots for SRR12690139.sra Read 1000389 spots for SRR12690139.sra Written 1000389 spots for SRR12690139.sra Read 1000389 spots for SRR12690139.sra Written 1000389 spots for SRR12690139.sra Read 1000389 spots for SRR12690139.sra Written 1000389 spots for SRR12690139.sra Read 1000394 spots for SRR12690139.sra Written 1000394 spots for SRR12690139.sra Read 1000389 spots for SRR12690139.sra Written 1000389 spots for SRR12690139.sra Read 1000389 spots for SRR12690139.sra Written 1000389 spots for SRR12690139.sra Read 1000389 spots for SRR12690139.sra Written 1000389 spots for SRR12690139.sra Read 1000389 spots for SRR12690139.sra Written 1000389 spots for SRR12690139.sra SRR ids: ['SRR12690139.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iogm1tbn SRR12690139.sra spots: 20007785 blocks: [[1, 1000389], [1000390, 2000778], [2000779, 3001167], [3001168, 4001556], [4001557, 5001945], [5001946, 6002334], [6002335, 7002723], [7002724, 8003112], [8003113, 9003501], [9003502, 10003890], [10003891, 11004279], [11004280, 12004668], [12004669, 13005057], [13005058, 14005446], [14005447, 15005835], [15005836, 16006224], [16006225, 17006613], [17006614, 18007002], [18007003, 19007391], [19007392, 20007785]] SRR12690139 file size 6777820 SRR12690139 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690139 SRR12690139_1.fastq SRR12690139_2.fastq Input file: SRR12690139_1.fastq Paired file: SRR12690139_2.fastq trimmed: SRR12690139-trimmed-pair1.fastq, SRR12690139-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:14:58 2025 >> started Mon Feb 10 18:15:22 2025 >> done (23.923s) 20007785 read pairs processed; of these: 47 ( 0.00%) short read pairs filtered out after trimming by size control 1800 ( 0.01%) empty read pairs filtered out after trimming by size control 20005938 (99.99%) read pairs available; of these: 2022418 (10.11%) trimmed read pairs available after processing 17983520 (89.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 10 0.00% 20 7 0.00% 21 5 0.00% 22 7 0.00% 23 18 0.00% 24 19 0.00% 25 17 0.00% 26 22 0.00% 27 22 0.00% 28 21 0.00% 29 17 0.00% 30 30 0.00% 31 23 0.00% 32 15 0.00% 33 28 0.00% 34 22 0.00% 35 33 0.00% 36 25 0.00% 37 34 0.00% 38 37 0.00% 39 33 0.00% 40 39 0.00% 41 28 0.00% 42 40 0.00% 43 51 0.00% 44 49 0.00% 45 54 0.00% 46 44 0.00% 47 61 0.00% 48 76 0.00% 49 74 0.00% 50 64 0.00% 51 92 0.00% 52 119 0.00% 53 112 0.00% 54 115 0.00% 55 127 0.00% 56 128 0.00% 57 185 0.00% 58 186 0.00% 59 202 0.00% 60 221 0.00% 61 241 0.00% 62 315 0.00% 63 358 0.00% 64 364 0.00% 65 396 0.00% 66 430 0.00% 67 512 0.00% 68 605 0.00% 69 625 0.00% 70 786 0.00% 71 852 0.00% 72 960 0.00% 73 1056 0.01% 74 1199 0.01% 75 1413 0.01% 76 1491 0.01% 77 1628 0.01% 78 1969 0.01% 79 2186 0.01% 80 2500 0.01% 81 2503 0.01% 82 3006 0.02% 83 3210 0.02% 84 3571 0.02% 85 3868 0.02% 86 4268 0.02% 87 4714 0.02% 88 5093 0.03% 89 5438 0.03% 90 5943 0.03% 91 6649 0.03% 92 7089 0.04% 93 7716 0.04% 94 8363 0.04% 95 9078 0.05% 96 9299 0.05% 97 10027 0.05% 98 10312 0.05% 99 11369 0.06% 100 12142 0.06% 101 12926 0.06% 102 13762 0.07% 103 14550 0.07% 104 15157 0.08% 105 15879 0.08% 106 16733 0.08% 107 17295 0.09% 108 18343 0.09% 109 19360 0.10% 110 19728 0.10% 111 20942 0.10% 112 22086 0.11% 113 22521 0.11% 114 23432 0.12% 115 24609 0.12% 116 25678 0.13% 117 26764 0.13% 118 27754 0.14% 119 28937 0.14% 120 29927 0.15% 121 31195 0.16% 122 31975 0.16% 123 33446 0.17% 124 34546 0.17% 125 35231 0.18% 126 37241 0.19% 127 38286 0.19% 128 38902 0.19% 129 40487 0.20% 130 41127 0.21% 131 42900 0.21% 132 43832 0.22% 133 45524 0.23% 134 46509 0.23% 135 47627 0.24% 136 49171 0.25% 137 49614 0.25% 138 50110 0.25% 139 52536 0.26% 140 53243 0.27% 141 54505 0.27% 142 56722 0.28% 143 57735 0.29% 144 59570 0.30% 145 60554 0.30% 146 61214 0.31% 147 61991 0.31% 148 63639 0.32% 149 64315 0.32% 150 66230 0.33% 151 17983520 89.89% 20005938 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=22 prefix-density=0.69 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=122.84 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=15.4 sequence=CTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCATAAGGGAAGGACATGAGGCCCTTAATTCCACCACAGGCGCTGTGTCCAATGACCACAATGTATTCC criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=21 prefix-density=0.92 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=55.39 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.1 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR12690139 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:16:06 Started mapping on | Feb 10 18:16:07 Finished on | Feb 10 18:17:59 Mapping speed, Million of reads per hour | 643.05 Number of input reads | 20005938 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 18879367 Uniquely mapped reads % | 94.37% Average mapped length | 296.31 Number of splices: Total | 18556260 Number of splices: Annotated (sjdb) | 18169233 Number of splices: GT/AG | 18176757 Number of splices: GC/AG | 317267 Number of splices: AT/AC | 13966 Number of splices: Non-canonical | 48270 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.95 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 514389 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 64572 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.59% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 612182 612182 612182 N_multimapping 514389 514389 514389 N_noFeature 652388 18702692 708366 N_ambiguous 238547 930 117259 UnstrandedReadsAssigned:17988432 PositiveStrandReadsAssigned:175745 NegativeStrandReadsAssigned:18053742 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690139 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690139-trimmed-pair1.fastq SRR12690139-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,005,938 reads, 18,198,131 reads pseudoaligned [quant] estimated average fragment length: 247.058 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52401 SRR12690139.ke.tsv 34699 SRR12690139.se.tsv 87100 total ==> SRR12690139.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.94 440 13.6244 Potri.005G024800.1.v4.1 1035 788.942 73 5.07682 Potri.004G059700.1.v4.1 961 715.123 41 3.1457 Potri.007G009000.2.v4.1 1416 1169.94 0 0 Potri.003G141000.2.v4.1 2943 2696.94 640.257 13.0256 Potri.016G087400.1.v4.1 270 81.6168 1260 847.043 Potri.015G069301.1.v4.1 564 329.147 0 0 Potri.010G195200.1.v4.1 1773 1526.94 7 0.25153 Potri.012G127500.1.v4.1 977 731.01 799 59.9705 ==> SRR12690139.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 100 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 208 Potri.001G212900.v4.1 21 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 129 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR12690139 completed mapping pipeline successfully