Starting /dee2/code/volunteer_pipeline.sh SRR12690140 current disk space = 3057186279424 free memory = 1577963976 SRR12690140 SRAfilesize 517ba999b7dc41a3a436e84a47a1504a SRR12690140.sra SRR12690140.sra file validated SRR12690140 is paired end SRR12690140 is conventional basespace SRR12690140 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690140_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.619 37.0 37.0 37.0 37.0 37.0 2 36.4005 37.0 37.0 37.0 37.0 37.0 3 36.637 37.0 37.0 37.0 37.0 37.0 4 36.5975 37.0 37.0 37.0 37.0 37.0 5 36.6005 37.0 37.0 37.0 37.0 37.0 6 36.621 37.0 37.0 37.0 37.0 37.0 7 36.572 37.0 37.0 37.0 37.0 37.0 8 36.597 37.0 37.0 37.0 37.0 37.0 9 36.6245 37.0 37.0 37.0 37.0 37.0 10-14 36.6306 37.0 37.0 37.0 37.0 37.0 15-19 36.6221 37.0 37.0 37.0 37.0 37.0 20-24 36.5567 37.0 37.0 37.0 37.0 37.0 25-29 36.532 37.0 37.0 37.0 37.0 37.0 30-34 36.5069 37.0 37.0 37.0 37.0 37.0 35-39 36.4803 37.0 37.0 37.0 37.0 37.0 40-44 36.486900000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.418600000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.4526 37.0 37.0 37.0 37.0 37.0 55-59 36.406699999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.4159 37.0 37.0 37.0 37.0 37.0 65-69 36.3706 37.0 37.0 37.0 37.0 37.0 70-74 36.3948 37.0 37.0 37.0 37.0 37.0 75-79 36.352799999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.2827 37.0 37.0 37.0 37.0 37.0 85-89 36.28060000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.26989999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.2248 37.0 37.0 37.0 37.0 37.0 100-104 36.2319 37.0 37.0 37.0 37.0 37.0 105-109 36.1452 37.0 37.0 37.0 37.0 37.0 110-114 36.14209999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.128 37.0 37.0 37.0 37.0 37.0 120-124 36.0745 37.0 37.0 37.0 37.0 37.0 125-129 36.061600000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.976 37.0 37.0 37.0 37.0 37.0 135-139 35.9976 37.0 37.0 37.0 37.0 37.0 140-144 35.7898 37.0 37.0 37.0 37.0 37.0 145-149 35.6862 37.0 37.0 37.0 37.0 37.0 150-151 35.480000000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 1.0 22 1.0 23 2.0 24 2.0 25 1.0 26 4.0 27 5.0 28 4.0 29 13.0 30 23.0 31 37.0 32 54.0 33 70.0 34 101.0 35 302.0 36 3005.0 37 374.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.775 11.700000000000001 6.875000000000001 36.65 2 21.37481184144506 12.543903662819869 33.993978926241844 32.087305569493225 3 17.474999999999998 17.275 28.225 37.025000000000006 4 22.1 24.075 25.35 28.475 5 22.8 30.45 25.55 21.2 6 23.375 33.6 21.55 21.475 7 15.825 25.900000000000002 40.625 17.65 8 18.375 27.200000000000003 32.6 21.825 9 18.125 23.525 35.75 22.6 10-14 20.09 28.835 27.705000000000002 23.369999999999997 15-19 20.45 27.665 27.625 24.26 20-24 20.9 27.51 27.889999999999997 23.7 25-29 20.105 28.425 27.42 24.05 30-34 19.84 28.125 27.67 24.365000000000002 35-39 20.580000000000002 27.750000000000004 28.015 23.655 40-44 20.47 28.24 27.33 23.96 45-49 20.849999999999998 28.275 27.150000000000002 23.724999999999998 50-54 20.825 28.675 26.905 23.595 55-59 20.48 27.705000000000002 27.87 23.945 60-64 20.5 28.895 27.229999999999997 23.375 65-69 20.685000000000002 27.800000000000004 27.544999999999998 23.97 70-74 21.025 27.435 27.944999999999997 23.595 75-79 20.66 27.82 27.55 23.97 80-84 20.735 28.365000000000002 27.810000000000002 23.09 85-89 20.82 28.275 27.495000000000005 23.41 90-94 21.095 27.47 27.825 23.61 95-99 21.32 27.815 26.735 24.13 100-104 20.580000000000002 28.349999999999998 27.18 23.89 105-109 20.735 28.875 26.865 23.525 110-114 21.29 27.975 26.650000000000002 24.085 115-119 21.135 27.439999999999998 27.205000000000002 24.22 120-124 21.790000000000003 28.060000000000002 26.295 23.855 125-129 21.805 27.950000000000003 26.484999999999996 23.76 130-134 21.08 28.42 26.46 24.04 135-139 21.535 27.77 26.405 24.29 140-144 20.674999999999997 28.055000000000003 27.08 24.19 145-149 20.77 27.35 26.974999999999998 24.905 150-151 21.1375 27.712500000000002 26.200000000000003 24.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 1.5 21 1.5 22 0.5 23 2.0 24 3.5 25 4.0 26 5.0 27 4.0 28 6.0 29 10.5 30 16.5 31 23.0 32 26.0 33 31.0 34 47.5 35 64.5 36 81.0 37 94.5 38 108.5 39 146.5 40 188.0 41 196.0 42 212.5 43 241.5 44 251.5 45 259.5 46 262.0 47 258.0 48 240.5 49 217.5 50 180.0 51 152.0 52 128.5 53 107.5 54 93.0 55 78.0 56 71.0 57 49.5 58 33.5 59 28.0 60 22.0 61 13.0 62 9.5 63 9.0 64 4.5 65 2.0 66 2.0 67 1.0 68 1.5 69 2.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.05 #Duplication Level Percentage of deduplicated Percentage of total 1 91.81768259198243 83.6 2 7.029104887424492 12.8 3 0.8237232289950577 2.25 4 0.21965952773201539 0.8 5 0.054914881933003847 0.25 6 0.054914881933003847 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCAAAACTTCTTACATTCACCGCTGAGCTGAGCCTATTCATGTTTACAAG 6 0.15 No Hit GGCTGTACATGCATTTGAGGCATGGGCTGAAATTGAGTTACAGCATTAAA 6 0.15 No Hit GTCCTTTCAACCCACTGCAGCAAGCTGCAGGCACAGCCCCACCCTTCTGG 5 0.125 No Hit GGCATGTTTCCTCAAGAGTCTGCATAGATCAACTCAGAGCTCCGCTAGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.6000000000000001 0.0 0.0 0.0 0.0 88-89 0.7875 0.0 0.0 0.0 0.0 90-91 1.025 0.0 0.0 0.0 0.0 92-93 1.2875 0.0 0.0 0.0 0.0 94-95 1.6 0.0 0.0 0.0 0.0 96-97 1.775 0.0 0.0 0.0 0.0 98-99 2.1125 0.0 0.0 0.0 0.0 100-101 2.3875 0.0 0.0 0.0 0.0 102-103 2.5875 0.0 0.0 0.0 0.0 104-105 2.9375 0.0 0.0 0.0 0.0 106-107 3.3125 0.0 0.0 0.0 0.0 108-109 3.6375 0.0 0.0 0.0 0.0 110-111 4.025 0.0 0.0 0.0 0.0 112-113 4.262499999999999 0.0 0.0 0.0 0.0 114-115 4.6875 0.0 0.0 0.0 0.0 116-117 5.2 0.0 0.0 0.0 0.0 118-119 5.625 0.0 0.0 0.0 0.0 120-121 6.1 0.0 0.0 0.0 0.0 122-123 6.7125 0.0 0.0 0.0 0.0 124-125 7.2625 0.0 0.0 0.0 0.0 126-127 7.675000000000001 0.0 0.0 0.0 0.0 128-129 8.025 0.0 0.0 0.0 0.0 130-131 8.625 0.0 0.0 0.0 0.0 132-133 9.1375 0.0 0.0 0.0 0.0 134-135 9.8125 0.0 0.0 0.0 0.0 136-137 10.3 0.0 0.0 0.0 0.0 138-139 10.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTCTT 10 0.006830828 145.0 1 GGCACAG 10 0.006830828 145.0 1 CTTCTTA 10 0.006830828 145.0 7 >>END_MODULE SRR12690140 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690140_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.498 37.0 37.0 37.0 37.0 37.0 2 36.197 37.0 37.0 37.0 37.0 37.0 3 36.1985 37.0 37.0 37.0 37.0 37.0 4 36.3115 37.0 37.0 37.0 37.0 37.0 5 36.4665 37.0 37.0 37.0 37.0 37.0 6 36.4 37.0 37.0 37.0 37.0 37.0 7 36.3935 37.0 37.0 37.0 37.0 37.0 8 36.4975 37.0 37.0 37.0 37.0 37.0 9 36.358 37.0 37.0 37.0 37.0 37.0 10-14 36.3759 37.0 37.0 37.0 37.0 37.0 15-19 36.3612 37.0 37.0 37.0 37.0 37.0 20-24 36.3258 37.0 37.0 37.0 37.0 37.0 25-29 36.2926 37.0 37.0 37.0 37.0 37.0 30-34 36.2385 37.0 37.0 37.0 37.0 37.0 35-39 36.2331 37.0 37.0 37.0 37.0 37.0 40-44 36.188100000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.21490000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.1357 37.0 37.0 37.0 37.0 37.0 55-59 36.17399999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.1168 37.0 37.0 37.0 37.0 37.0 65-69 36.1383 37.0 37.0 37.0 37.0 37.0 70-74 36.0289 37.0 37.0 37.0 37.0 37.0 75-79 36.063900000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.0894 37.0 37.0 37.0 37.0 37.0 85-89 36.0355 37.0 37.0 37.0 37.0 37.0 90-94 35.920899999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.980900000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.9771 37.0 37.0 37.0 37.0 37.0 105-109 35.9225 37.0 37.0 37.0 37.0 37.0 110-114 35.884699999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.866 37.0 37.0 37.0 37.0 37.0 120-124 35.7841 37.0 37.0 37.0 37.0 37.0 125-129 35.6222 37.0 37.0 37.0 37.0 37.0 130-134 35.632400000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.4354 37.0 37.0 37.0 37.0 37.0 140-144 35.2649 37.0 37.0 37.0 32.2 37.0 145-149 35.2195 37.0 37.0 37.0 32.2 37.0 150-151 34.68325 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 2.0 15 3.0 16 3.0 17 2.0 18 2.0 19 1.0 20 0.0 21 2.0 22 6.0 23 4.0 24 6.0 25 6.0 26 9.0 27 7.0 28 11.0 29 21.0 30 18.0 31 29.0 32 57.0 33 88.0 34 167.0 35 475.0 36 2775.0 37 302.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.375 25.224999999999998 9.725 24.675 2 28.999999999999996 26.025 28.725 16.25 3 19.85 28.499999999999996 31.1 20.549999999999997 4 22.375 34.175 23.549999999999997 19.900000000000002 5 24.325 36.075 21.65 17.95 6 21.65 38.85 20.825 18.675 7 20.95 23.625 36.575 18.85 8 20.625 26.674999999999997 28.199999999999996 24.5 9 21.625 24.125 30.049999999999997 24.2 10-14 23.735 29.294999999999998 25.979999999999997 20.990000000000002 15-19 22.96 28.275 27.245 21.52 20-24 23.630000000000003 28.4 26.57 21.4 25-29 22.98 28.84 26.985 21.195 30-34 22.64 27.925 27.52 21.915000000000003 35-39 22.91 27.43 28.24 21.42 40-44 23.32 27.875 27.560000000000002 21.245 45-49 23.485 28.025 27.165 21.325 50-54 23.465 27.83 27.055 21.65 55-59 22.795 27.77 27.860000000000003 21.575 60-64 23.365 27.575 27.694999999999997 21.365000000000002 65-69 23.29 27.46 27.32 21.93 70-74 23.5 28.305000000000003 26.590000000000003 21.605 75-79 23.32 27.395000000000003 27.35 21.935 80-84 23.595 27.16 27.67 21.575 85-89 23.715 28.22 26.505000000000003 21.560000000000002 90-94 24.104999999999997 27.92 26.71 21.265 95-99 23.494999999999997 28.794999999999998 26.229999999999997 21.48 100-104 23.630000000000003 27.915 27.26 21.195 105-109 23.794999999999998 27.939999999999998 27.065 21.2 110-114 24.385 28.415000000000003 26.450000000000003 20.75 115-119 24.55 27.57 26.965 20.915 120-124 24.39 28.09 27.0 20.52 125-129 25.19 27.73 26.43 20.65 130-134 24.965 27.54 26.755000000000003 20.74 135-139 25.019999999999996 27.54 26.815 20.625 140-144 25.205 28.03 26.740000000000002 20.025000000000002 145-149 26.695 27.295 25.765 20.244999999999997 150-151 26.650000000000002 28.675 25.5625 19.112499999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 2.0 6 1.0 7 0.0 8 1.0 9 1.5 10 0.5 11 0.0 12 0.0 13 0.0 14 1.0 15 1.5 16 0.5 17 0.5 18 0.5 19 0.5 20 1.5 21 2.0 22 1.5 23 1.5 24 1.0 25 2.0 26 3.5 27 3.5 28 3.0 29 5.0 30 8.5 31 16.0 32 26.0 33 32.5 34 36.5 35 50.5 36 65.0 37 87.0 38 122.0 39 161.5 40 187.0 41 214.0 42 255.0 43 264.0 44 252.5 45 256.0 46 269.0 47 263.0 48 245.0 49 217.0 50 171.5 51 141.5 52 117.0 53 97.5 54 95.0 55 72.5 56 56.5 57 56.0 58 41.5 59 25.0 60 16.5 61 11.5 62 9.5 63 6.0 64 2.5 65 1.5 66 1.5 67 1.5 68 0.5 69 0.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 1.5 88 1.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.65519140732582 83.2 2 7.160561828697329 13.0 3 0.8262186725419994 2.25 4 0.2203249793445332 0.8 5 0.02754062241806665 0.125 6 0.08262186725419994 0.44999999999999996 7 0.02754062241806665 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit CAGGCAATTCCATTACCAAATGCTCAGCCAAACAGGCATGTCATGTCTGG 6 0.15 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit CGGACAACAACCAATCTTCTTCGCAAATACCTTGGAGATTTTTTAATCGC 6 0.15 No Hit GTTTGCCATTGCATCTATTTAAGTTTAAAATATATATACTGATGCACTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.8125 0.0 0.0 0.0 0.0 90-91 1.0625 0.0 0.0 0.0 0.0 92-93 1.3375 0.0 0.0 0.0 0.0 94-95 1.65 0.0 0.0 0.0 0.0 96-97 1.825 0.0 0.0 0.0 0.0 98-99 2.175 0.0 0.0 0.0 0.0 100-101 2.45 0.0 0.0 0.0 0.0 102-103 2.6375 0.0 0.0 0.0 0.0 104-105 2.9875 0.0 0.0 0.0 0.0 106-107 3.3625 0.0 0.0 0.0 0.0 108-109 3.6875 0.0 0.0 0.0 0.0 110-111 4.075 0.0 0.0 0.0 0.0 112-113 4.325 0.0 0.0 0.0 0.0 114-115 4.7625 0.0 0.0 0.0 0.0 116-117 5.275 0.0 0.0 0.0 0.0 118-119 5.7 0.0 0.0 0.0 0.0 120-121 6.199999999999999 0.0 0.0 0.0 0.0 122-123 6.825 0.0 0.0 0.0 0.0 124-125 7.3875 0.0 0.0 0.0 0.0 126-127 7.800000000000001 0.0 0.0 0.0 0.0 128-129 8.15 0.0 0.0 0.0 0.0 130-131 8.75 0.0 0.0 0.0 0.0 132-133 9.2625 0.0 0.0 0.0 0.0 134-135 9.95 0.0 0.0 0.0 0.0 136-137 10.4 0.0 0.0 0.0 0.0 138-139 10.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 949068 spots for SRR12690140.sra Written 949068 spots for SRR12690140.sra Read 949068 spots for SRR12690140.sra Written 949068 spots for SRR12690140.sra Read 949068 spots for SRR12690140.sra Written 949068 spots for SRR12690140.sra Read 949068 spots for SRR12690140.sra Written 949068 spots for SRR12690140.sra Read 949068 spots for SRR12690140.sra Written 949068 spots for SRR12690140.sra Read 949068 spots for SRR12690140.sra Written 949068 spots for SRR12690140.sra Read 949068 spots for SRR12690140.sra Written 949068 spots for SRR12690140.sra Read 949068 spots for SRR12690140.sra Written 949068 spots for SRR12690140.sra Read 949068 spots for SRR12690140.sra Written 949068 spots for SRR12690140.sra Read 949068 spots for SRR12690140.sra Written 949068 spots for SRR12690140.sra Read 949068 spots for SRR12690140.sra Written 949068 spots for SRR12690140.sra Read 949068 spots for SRR12690140.sra Written 949068 spots for SRR12690140.sra Read 949068 spots for SRR12690140.sra Written 949068 spots for SRR12690140.sra Read 949068 spots for SRR12690140.sra Written 949068 spots for SRR12690140.sra Read 949068 spots for SRR12690140.sra Written 949068 spots for SRR12690140.sra Read 949068 spots for SRR12690140.sra Written 949068 spots for SRR12690140.sra Read 949068 spots for SRR12690140.sra Written 949068 spots for SRR12690140.sra Read 949068 spots for SRR12690140.sra Written 949068 spots for SRR12690140.sra Read 949068 spots for SRR12690140.sra Written 949068 spots for SRR12690140.sra Read 949076 spots for SRR12690140.sra Written 949076 spots for SRR12690140.sra SRR ids: ['SRR12690140.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_43pu07r_ SRR12690140.sra spots: 18981368 blocks: [[1, 949068], [949069, 1898136], [1898137, 2847204], [2847205, 3796272], [3796273, 4745340], [4745341, 5694408], [5694409, 6643476], [6643477, 7592544], [7592545, 8541612], [8541613, 9490680], [9490681, 10439748], [10439749, 11388816], [11388817, 12337884], [12337885, 13286952], [13286953, 14236020], [14236021, 15185088], [15185089, 16134156], [16134157, 17083224], [17083225, 18032292], [18032293, 18981368]] SRR12690140 file size 6428998 SRR12690140 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690140 SRR12690140_1.fastq SRR12690140_2.fastq Input file: SRR12690140_1.fastq Paired file: SRR12690140_2.fastq trimmed: SRR12690140-trimmed-pair1.fastq, SRR12690140-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:03:07 2025 >> started Mon Feb 10 19:03:29 2025 >> done (21.910s) 18981368 read pairs processed; of these: 47 ( 0.00%) short read pairs filtered out after trimming by size control 5004 ( 0.03%) empty read pairs filtered out after trimming by size control 18976317 (99.97%) read pairs available; of these: 3120878 (16.45%) trimmed read pairs available after processing 15855439 (83.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 7 0.00% 21 4 0.00% 22 11 0.00% 23 24 0.00% 24 20 0.00% 25 20 0.00% 26 14 0.00% 27 23 0.00% 28 30 0.00% 29 41 0.00% 30 21 0.00% 31 37 0.00% 32 28 0.00% 33 35 0.00% 34 42 0.00% 35 39 0.00% 36 39 0.00% 37 41 0.00% 38 62 0.00% 39 52 0.00% 40 63 0.00% 41 56 0.00% 42 74 0.00% 43 82 0.00% 44 74 0.00% 45 115 0.00% 46 117 0.00% 47 132 0.00% 48 141 0.00% 49 160 0.00% 50 197 0.00% 51 221 0.00% 52 251 0.00% 53 300 0.00% 54 295 0.00% 55 309 0.00% 56 384 0.00% 57 439 0.00% 58 578 0.00% 59 596 0.00% 60 695 0.00% 61 822 0.00% 62 870 0.00% 63 989 0.01% 64 1117 0.01% 65 1219 0.01% 66 1350 0.01% 67 1539 0.01% 68 1857 0.01% 69 2006 0.01% 70 2373 0.01% 71 2655 0.01% 72 2942 0.02% 73 3569 0.02% 74 3683 0.02% 75 4278 0.02% 76 4589 0.02% 77 5025 0.03% 78 5482 0.03% 79 6145 0.03% 80 6824 0.04% 81 7668 0.04% 82 8566 0.05% 83 9282 0.05% 84 10378 0.05% 85 11022 0.06% 86 11895 0.06% 87 12917 0.07% 88 13864 0.07% 89 14524 0.08% 90 15623 0.08% 91 16961 0.09% 92 18007 0.09% 93 19386 0.10% 94 20409 0.11% 95 22105 0.12% 96 22739 0.12% 97 24081 0.13% 98 24862 0.13% 99 25864 0.14% 100 27305 0.14% 101 28251 0.15% 102 29829 0.16% 103 30992 0.16% 104 32267 0.17% 105 33509 0.18% 106 34450 0.18% 107 35529 0.19% 108 35995 0.19% 109 37390 0.20% 110 38185 0.20% 111 39944 0.21% 112 41260 0.22% 113 42319 0.22% 114 43103 0.23% 115 44787 0.24% 116 45315 0.24% 117 47287 0.25% 118 47560 0.25% 119 48075 0.25% 120 50183 0.26% 121 50864 0.27% 122 51979 0.27% 123 52868 0.28% 124 54167 0.29% 125 55553 0.29% 126 56151 0.30% 127 57642 0.30% 128 58197 0.31% 129 59011 0.31% 130 60073 0.32% 131 60333 0.32% 132 61328 0.32% 133 62420 0.33% 134 63788 0.34% 135 65195 0.34% 136 65316 0.34% 137 65412 0.34% 138 65956 0.35% 139 67709 0.36% 140 68293 0.36% 141 68646 0.36% 142 70164 0.37% 143 70987 0.37% 144 72762 0.38% 145 73574 0.39% 146 73573 0.39% 147 74067 0.39% 148 74969 0.40% 149 74557 0.39% 150 76426 0.40% 151 15855439 83.55% 18976317 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=21 prefix-density=0.60 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=35.06 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=8.6 sequence=CCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.85 fanout-score-rank=12 prefix-density=0.96 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.03 sequence-density-rank=26 fanout-score=22.69 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=6.3 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAAGTCTGGTCACTCCATGTTTGTCTAATATAGTATTTGCTGTAAATTAAAGTACAGTTAGCTAGCCATGGCCTCCTCAAATCCTTTCTACAGGATCTCATTTGATGGCTAGTAATCTGTAAGTGTCTTGTATTTCCT SRR12690140 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:04:11 Started mapping on | Feb 10 19:04:11 Finished on | Feb 10 19:06:04 Mapping speed, Million of reads per hour | 604.56 Number of input reads | 18976317 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 17870441 Uniquely mapped reads % | 94.17% Average mapped length | 292.04 Number of splices: Total | 17314770 Number of splices: Annotated (sjdb) | 16898851 Number of splices: GT/AG | 16969900 Number of splices: GC/AG | 280055 Number of splices: AT/AC | 12889 Number of splices: Non-canonical | 51926 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 412477 % of reads mapped to multiple loci | 2.17% Number of reads mapped to too many loci | 119126 % of reads mapped to too many loci | 0.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.88% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 693399 693399 693399 N_multimapping 412477 412477 412477 N_noFeature 631776 17623261 711862 N_ambiguous 280459 1171 112752 UnstrandedReadsAssigned:16958206 PositiveStrandReadsAssigned:246009 NegativeStrandReadsAssigned:17045827 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690140 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690140-trimmed-pair1.fastq SRR12690140-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,976,317 reads, 17,118,113 reads pseudoaligned [quant] estimated average fragment length: 234.042 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,014 rounds 52401 SRR12690140.ke.tsv 34699 SRR12690140.se.tsv 87100 total ==> SRR12690140.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.96 480 14.0894 Potri.005G024800.1.v4.1 1035 801.958 198 12.9358 Potri.004G059700.1.v4.1 961 728.081 32 2.30277 Potri.007G009000.2.v4.1 1416 1182.96 0 0 Potri.003G141000.2.v4.1 2943 2709.96 560.186 10.8305 Potri.016G087400.1.v4.1 270 93.0232 683 384.689 Potri.015G069301.1.v4.1 564 341.341 0 0 Potri.010G195200.1.v4.1 1773 1539.96 5 0.170115 Potri.012G127500.1.v4.1 977 744.02 169 11.901 ==> SRR12690140.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 451 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 277 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR12690140 completed mapping pipeline successfully