Starting /dee2/code/volunteer_pipeline.sh SRR12690141 current disk space = 3057654890496 free memory = 1545689756 SRR12690141 SRAfilesize 53de4b3ab6ebd3084258f0205945c144 SRR12690141.sra SRR12690141.sra file validated SRR12690141 is paired end SRR12690141 is conventional basespace SRR12690141 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690141_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.615 37.0 37.0 37.0 37.0 37.0 2 36.2695 37.0 37.0 37.0 37.0 37.0 3 36.604 37.0 37.0 37.0 37.0 37.0 4 36.579 37.0 37.0 37.0 37.0 37.0 5 36.6945 37.0 37.0 37.0 37.0 37.0 6 36.677 37.0 37.0 37.0 37.0 37.0 7 36.553 37.0 37.0 37.0 37.0 37.0 8 36.6305 37.0 37.0 37.0 37.0 37.0 9 36.625 37.0 37.0 37.0 37.0 37.0 10-14 36.634299999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5969 37.0 37.0 37.0 37.0 37.0 20-24 36.598 37.0 37.0 37.0 37.0 37.0 25-29 36.554899999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.5244 37.0 37.0 37.0 37.0 37.0 35-39 36.50699999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.5099 37.0 37.0 37.0 37.0 37.0 45-49 36.4914 37.0 37.0 37.0 37.0 37.0 50-54 36.4585 37.0 37.0 37.0 37.0 37.0 55-59 36.4235 37.0 37.0 37.0 37.0 37.0 60-64 36.440799999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.3699 37.0 37.0 37.0 37.0 37.0 70-74 36.39640000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.3788 37.0 37.0 37.0 37.0 37.0 80-84 36.31269999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.284499999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.2168 37.0 37.0 37.0 37.0 37.0 95-99 36.22090000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.2504 37.0 37.0 37.0 37.0 37.0 105-109 36.196 37.0 37.0 37.0 37.0 37.0 110-114 36.1642 37.0 37.0 37.0 37.0 37.0 115-119 36.1357 37.0 37.0 37.0 37.0 37.0 120-124 36.071600000000004 37.0 37.0 37.0 37.0 37.0 125-129 36.0914 37.0 37.0 37.0 37.0 37.0 130-134 36.0542 37.0 37.0 37.0 37.0 37.0 135-139 36.0219 37.0 37.0 37.0 37.0 37.0 140-144 35.7672 37.0 37.0 37.0 37.0 37.0 145-149 35.7417 37.0 37.0 37.0 37.0 37.0 150-151 35.6075 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 3.0 26 1.0 27 7.0 28 17.0 29 12.0 30 24.0 31 29.0 32 45.0 33 55.0 34 114.0 35 274.0 36 3047.0 37 370.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.3 11.175 7.475 40.050000000000004 2 19.994982438534873 12.092323130958354 37.405920722528855 30.506773707977924 3 16.45 15.725 29.15 38.675 4 21.2 22.275 24.95 31.574999999999996 5 23.474999999999998 30.3 24.275 21.95 6 19.025 34.275 23.275000000000002 23.425 7 16.075 26.424999999999997 40.425 17.075000000000003 8 17.95 26.05 32.775 23.225 9 16.85 23.599999999999998 36.4 23.150000000000002 10-14 18.955 29.28 28.075 23.69 15-19 19.42 28.199999999999996 28.689999999999998 23.69 20-24 20.375 27.66 28.04 23.925 25-29 20.22 27.38 28.194999999999997 24.205 30-34 20.349999999999998 28.055000000000003 27.725 23.87 35-39 20.175 28.18 27.655 23.990000000000002 40-44 20.915 27.985 27.665 23.435 45-49 20.424999999999997 28.525 27.42 23.630000000000003 50-54 20.46 28.685 27.735 23.119999999999997 55-59 20.395 28.615000000000002 27.615000000000002 23.375 60-64 21.385 27.634999999999998 27.689999999999998 23.29 65-69 20.18 28.49 27.500000000000004 23.830000000000002 70-74 20.605 27.97 27.889999999999997 23.535 75-79 20.555 27.815 27.91 23.72 80-84 20.810000000000002 27.82 28.005000000000003 23.365 85-89 20.544999999999998 28.26 27.375 23.82 90-94 20.200000000000003 28.185 27.860000000000003 23.755000000000003 95-99 21.05 27.544999999999998 28.08 23.325000000000003 100-104 21.215 28.115000000000002 27.534999999999997 23.135 105-109 20.805 27.88 28.110000000000003 23.205000000000002 110-114 20.369999999999997 28.415000000000003 27.415 23.799999999999997 115-119 20.73 28.485 27.195000000000004 23.59 120-124 20.765 28.194999999999997 27.200000000000003 23.84 125-129 21.0 28.52 27.284999999999997 23.195 130-134 20.674999999999997 28.025 27.72 23.580000000000002 135-139 21.349999999999998 28.09 26.465 24.095 140-144 21.055 28.09 27.200000000000003 23.655 145-149 21.3 28.235 26.625 23.84 150-151 20.5375 29.45 26.35 23.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 0.5 24 1.0 25 3.5 26 4.5 27 7.0 28 10.0 29 9.5 30 14.5 31 20.5 32 30.5 33 39.0 34 49.5 35 62.0 36 69.5 37 89.5 38 122.5 39 161.0 40 189.0 41 220.0 42 245.0 43 248.5 44 259.5 45 257.5 46 263.5 47 261.5 48 242.0 49 218.0 50 187.5 51 146.5 52 112.0 53 108.0 54 91.0 55 70.0 56 53.5 57 36.5 58 25.5 59 18.0 60 17.0 61 14.5 62 4.0 63 2.0 64 3.0 65 2.0 66 2.0 67 1.5 68 0.0 69 0.0 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.125 #Duplication Level Percentage of deduplicated Percentage of total 1 92.34735413839891 85.075 2 6.892808683853461 12.7 3 0.6784260515603799 1.875 4 0.054274084124830396 0.2 5 0.0 0.0 6 0.027137042062415198 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.2125 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.7875000000000001 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.3875000000000002 0.0 0.0 0.0 0.0 110-111 1.575 0.0 0.0 0.0 0.0 112-113 1.7374999999999998 0.0 0.0 0.0 0.0 114-115 2.0250000000000004 0.0 0.0 0.0 0.0 116-117 2.175 0.0 0.0 0.0 0.0 118-119 2.6625 0.0 0.0 0.0 0.0 120-121 2.9000000000000004 0.0 0.0 0.0 0.0 122-123 3.2375 0.0 0.0 0.0 0.0 124-125 3.6375 0.0 0.0 0.0 0.0 126-127 4.025 0.0 0.0 0.0 0.0 128-129 4.3375 0.0 0.0 0.0 0.0 130-131 4.862500000000001 0.0 0.0 0.0 0.0 132-133 5.225 0.0 0.0 0.0 0.0 134-135 5.525 0.0 0.0 0.0 0.0 136-137 6.0 0.0 0.0 0.0 0.0 138-139 6.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCTGT 10 0.006830828 145.0 2 CACAATC 10 0.006830828 145.0 145 >>END_MODULE SRR12690141 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690141_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.208 37.0 37.0 37.0 37.0 37.0 2 35.908 37.0 37.0 37.0 37.0 37.0 3 36.032 37.0 37.0 37.0 37.0 37.0 4 36.0435 37.0 37.0 37.0 37.0 37.0 5 36.1915 37.0 37.0 37.0 37.0 37.0 6 36.182 37.0 37.0 37.0 37.0 37.0 7 36.209 37.0 37.0 37.0 37.0 37.0 8 36.266 37.0 37.0 37.0 37.0 37.0 9 36.2335 37.0 37.0 37.0 37.0 37.0 10-14 36.1529 37.0 37.0 37.0 37.0 37.0 15-19 36.1613 37.0 37.0 37.0 37.0 37.0 20-24 36.1832 37.0 37.0 37.0 37.0 37.0 25-29 36.069399999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.108 37.0 37.0 37.0 37.0 37.0 35-39 36.0954 37.0 37.0 37.0 37.0 37.0 40-44 36.0576 37.0 37.0 37.0 37.0 37.0 45-49 35.99250000000001 37.0 37.0 37.0 37.0 37.0 50-54 35.9645 37.0 37.0 37.0 37.0 37.0 55-59 35.9408 37.0 37.0 37.0 37.0 37.0 60-64 35.874900000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.8283 37.0 37.0 37.0 37.0 37.0 70-74 35.822500000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.8272 37.0 37.0 37.0 37.0 37.0 80-84 35.7909 37.0 37.0 37.0 37.0 37.0 85-89 35.7611 37.0 37.0 37.0 37.0 37.0 90-94 35.664 37.0 37.0 37.0 37.0 37.0 95-99 35.687400000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.709500000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.6504 37.0 37.0 37.0 37.0 37.0 110-114 35.6261 37.0 37.0 37.0 37.0 37.0 115-119 35.568599999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.493700000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.4269 37.0 37.0 37.0 34.6 37.0 130-134 35.4029 37.0 37.0 37.0 32.2 37.0 135-139 35.2325 37.0 37.0 37.0 29.8 37.0 140-144 35.217999999999996 37.0 37.0 37.0 29.8 37.0 145-149 35.10340000000001 37.0 37.0 37.0 29.8 37.0 150-151 34.529250000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 4.0 15 4.0 16 1.0 17 0.0 18 2.0 19 0.0 20 1.0 21 3.0 22 2.0 23 4.0 24 3.0 25 14.0 26 7.0 27 13.0 28 14.0 29 20.0 30 37.0 31 45.0 32 70.0 33 119.0 34 228.0 35 666.0 36 2575.0 37 167.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.574999999999996 25.775 10.95 25.7 2 29.275000000000002 26.25 29.525000000000002 14.95 3 18.175 30.125 31.900000000000002 19.8 4 22.825 33.900000000000006 24.625 18.65 5 24.3 35.275 22.975 17.45 6 20.474999999999998 40.050000000000004 21.775 17.7 7 19.15 23.474999999999998 37.525 19.85 8 21.525 26.8 27.775 23.9 9 20.75 24.25 31.1 23.9 10-14 23.39 29.575000000000003 26.064999999999998 20.97 15-19 23.369999999999997 28.810000000000002 26.840000000000003 20.979999999999997 20-24 22.905 28.52 27.37 21.205 25-29 22.52 28.29 27.99 21.2 30-34 22.345000000000002 28.395 27.544999999999998 21.715 35-39 22.56 28.194999999999997 27.589999999999996 21.654999999999998 40-44 22.255 28.065 28.305000000000003 21.375 45-49 21.88 28.275 28.410000000000004 21.435000000000002 50-54 22.375 28.49 27.700000000000003 21.435000000000002 55-59 22.88 28.54 27.439999999999998 21.14 60-64 22.675 27.229999999999997 28.67 21.425 65-69 23.11 27.71 27.82 21.36 70-74 23.195 27.555000000000003 27.889999999999997 21.36 75-79 22.41 28.095 28.51 20.985 80-84 22.73 28.315 27.66 21.295 85-89 23.145 27.584999999999997 27.675 21.595 90-94 23.09 27.944999999999997 27.675 21.29 95-99 22.98 27.96 27.405 21.654999999999998 100-104 23.235 28.645 26.825 21.295 105-109 23.905 27.79 27.515 20.79 110-114 23.665 27.655 27.505000000000003 21.175 115-119 24.224999999999998 27.49 27.474999999999998 20.810000000000002 120-124 23.51 27.6 27.644999999999996 21.245 125-129 23.94 28.560000000000002 27.025 20.474999999999998 130-134 24.62 27.900000000000002 27.145000000000003 20.335 135-139 24.87 28.235 26.685 20.21 140-144 24.985 27.750000000000004 27.150000000000002 20.115 145-149 25.94 28.225 26.005 19.830000000000002 150-151 25.637500000000003 28.512500000000003 26.5625 19.287499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.5 8 0.5 9 0.5 10 1.0 11 1.0 12 1.0 13 0.5 14 1.0 15 1.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 3.0 24 2.5 25 4.0 26 6.0 27 5.5 28 6.0 29 10.5 30 18.5 31 22.5 32 22.5 33 39.5 34 67.5 35 78.0 36 79.0 37 97.0 38 137.0 39 169.5 40 190.5 41 214.5 42 240.5 43 254.0 44 261.0 45 288.0 46 287.5 47 263.0 48 235.5 49 194.5 50 167.0 51 146.0 52 108.5 53 80.5 54 71.5 55 56.0 56 39.5 57 29.0 58 26.5 59 20.0 60 9.0 61 4.5 62 6.0 63 5.5 64 4.0 65 3.0 66 1.5 67 1.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.5 74 1.0 75 1.0 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.5 95 1.0 96 0.5 97 0.0 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.45385450597176 85.15 2 6.596091205211726 12.15 3 0.8686210640608035 2.4 4 0.08143322475570033 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.2125 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.7875000000000001 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.3875000000000002 0.0 0.0 0.0 0.0 110-111 1.575 0.0 0.0 0.0 0.0 112-113 1.7374999999999998 0.0 0.0 0.0 0.0 114-115 2.0125 0.0 0.0 0.0 0.0 116-117 2.1375 0.0 0.0 0.0 0.0 118-119 2.625 0.0 0.0 0.0 0.0 120-121 2.875 0.0 0.0 0.0 0.0 122-123 3.175 0.0 0.0 0.0 0.0 124-125 3.5875 0.0 0.0 0.0 0.0 126-127 3.975 0.0 0.0 0.0 0.0 128-129 4.2625 0.0 0.0 0.0 0.0 130-131 4.737500000000001 0.0 0.0 0.0 0.0 132-133 5.1 0.0 0.0 0.0 0.0 134-135 5.4 0.0 0.0 0.0 0.0 136-137 5.875 0.0 0.0 0.0 0.0 138-139 6.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCCTAG 10 0.006830828 145.0 5 AGGCCTA 10 0.006830828 145.0 4 TCCCTCT 10 0.006830828 145.0 9 TAGGCCT 10 0.006830828 145.0 3 >>END_MODULE Read 1093454 spots for SRR12690141.sra Written 1093454 spots for SRR12690141.sra Read 1093454 spots for SRR12690141.sra Written 1093454 spots for SRR12690141.sra Read 1093454 spots for SRR12690141.sra Written 1093454 spots for SRR12690141.sra Read 1093454 spots for SRR12690141.sra Written 1093454 spots for SRR12690141.sra Read 1093454 spots for SRR12690141.sra Written 1093454 spots for SRR12690141.sra Read 1093454 spots for SRR12690141.sra Written 1093454 spots for SRR12690141.sra Read 1093454 spots for SRR12690141.sra Written 1093454 spots for SRR12690141.sra Read 1093454 spots for SRR12690141.sra Written 1093454 spots for SRR12690141.sra Read 1093454 spots for SRR12690141.sra Written 1093454 spots for SRR12690141.sra Read 1093454 spots for SRR12690141.sra Written 1093454 spots for SRR12690141.sra Read 1093454 spots for SRR12690141.sra Written 1093454 spots for SRR12690141.sra Read 1093454 spots for SRR12690141.sra Written 1093454 spots for SRR12690141.sra Read 1093454 spots for SRR12690141.sra Written 1093454 spots for SRR12690141.sra Read 1093454 spots for SRR12690141.sra Written 1093454 spots for SRR12690141.sra Read 1093454 spots for SRR12690141.sra Written 1093454 spots for SRR12690141.sra Read 1093454 spots for SRR12690141.sra Written 1093454 spots for SRR12690141.sra Read 1093454 spots for SRR12690141.sra Written 1093454 spots for SRR12690141.sra Read 1093454 spots for SRR12690141.sra Written 1093454 spots for SRR12690141.sra Read 1093454 spots for SRR12690141.sra Written 1093454 spots for SRR12690141.sra Read 1093469 spots for SRR12690141.sra Written 1093469 spots for SRR12690141.sra SRR ids: ['SRR12690141.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uqqjx46k SRR12690141.sra spots: 21869095 blocks: [[1, 1093454], [1093455, 2186908], [2186909, 3280362], [3280363, 4373816], [4373817, 5467270], [5467271, 6560724], [6560725, 7654178], [7654179, 8747632], [8747633, 9841086], [9841087, 10934540], [10934541, 12027994], [12027995, 13121448], [13121449, 14214902], [14214903, 15308356], [15308357, 16401810], [16401811, 17495264], [17495265, 18588718], [18588719, 19682172], [19682173, 20775626], [20775627, 21869095]] SRR12690141 file size 7410374 SRR12690141 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690141 SRR12690141_1.fastq SRR12690141_2.fastq Input file: SRR12690141_1.fastq Paired file: SRR12690141_2.fastq trimmed: SRR12690141-trimmed-pair1.fastq, SRR12690141-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:19:10 2025 >> started Mon Feb 10 18:19:44 2025 >> done (33.992s) 21869095 read pairs processed; of these: 35 ( 0.00%) short read pairs filtered out after trimming by size control 3956 ( 0.02%) empty read pairs filtered out after trimming by size control 21865104 (99.98%) read pairs available; of these: 2395275 (10.95%) trimmed read pairs available after processing 19469829 (89.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 3 0.00% 21 10 0.00% 22 11 0.00% 23 7 0.00% 24 16 0.00% 25 14 0.00% 26 24 0.00% 27 34 0.00% 28 12 0.00% 29 30 0.00% 30 25 0.00% 31 25 0.00% 32 23 0.00% 33 23 0.00% 34 23 0.00% 35 31 0.00% 36 19 0.00% 37 41 0.00% 38 33 0.00% 39 38 0.00% 40 30 0.00% 41 40 0.00% 42 48 0.00% 43 50 0.00% 44 42 0.00% 45 46 0.00% 46 50 0.00% 47 55 0.00% 48 61 0.00% 49 65 0.00% 50 97 0.00% 51 109 0.00% 52 134 0.00% 53 101 0.00% 54 131 0.00% 55 122 0.00% 56 134 0.00% 57 176 0.00% 58 182 0.00% 59 237 0.00% 60 243 0.00% 61 330 0.00% 62 326 0.00% 63 399 0.00% 64 441 0.00% 65 459 0.00% 66 525 0.00% 67 592 0.00% 68 620 0.00% 69 795 0.00% 70 802 0.00% 71 976 0.00% 72 1102 0.01% 73 1283 0.01% 74 1393 0.01% 75 1532 0.01% 76 1783 0.01% 77 1964 0.01% 78 2201 0.01% 79 2398 0.01% 80 2684 0.01% 81 3046 0.01% 82 3444 0.02% 83 3778 0.02% 84 4090 0.02% 85 4590 0.02% 86 5144 0.02% 87 5480 0.03% 88 5985 0.03% 89 6561 0.03% 90 6938 0.03% 91 7722 0.04% 92 8191 0.04% 93 8946 0.04% 94 10140 0.05% 95 10868 0.05% 96 11649 0.05% 97 12440 0.06% 98 12937 0.06% 99 13605 0.06% 100 14809 0.07% 101 15708 0.07% 102 16321 0.07% 103 17744 0.08% 104 18468 0.08% 105 19799 0.09% 106 20702 0.09% 107 21716 0.10% 108 22462 0.10% 109 23569 0.11% 110 24193 0.11% 111 25731 0.12% 112 26647 0.12% 113 28092 0.13% 114 29192 0.13% 115 30709 0.14% 116 31633 0.14% 117 32920 0.15% 118 34102 0.16% 119 35189 0.16% 120 37051 0.17% 121 37576 0.17% 122 38850 0.18% 123 40574 0.19% 124 42043 0.19% 125 43151 0.20% 126 44137 0.20% 127 45943 0.21% 128 47013 0.22% 129 48501 0.22% 130 49640 0.23% 131 50543 0.23% 132 51983 0.24% 133 53599 0.25% 134 54236 0.25% 135 56417 0.26% 136 58252 0.27% 137 59037 0.27% 138 59993 0.27% 139 61240 0.28% 140 62284 0.28% 141 63817 0.29% 142 65648 0.30% 143 66474 0.30% 144 67537 0.31% 145 69178 0.32% 146 70177 0.32% 147 71249 0.33% 148 71685 0.33% 149 72354 0.33% 150 74629 0.34% 151 19469829 89.05% 21865104 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=11 prefix-density=0.58 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=19.00 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=7.7 sequence=ACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGTTGGAAAAGAAGGAAAGTGTGATGAAATTAAGGGATTT criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=3.05 fanout-score-rank=15 prefix-density=0.49 prefix-fanout=2.6 sequence=ATGGTGGCACCATTCAATGGTCTCAAGTCTGCCGCAGCTTTCCCAGTCAGTACCAGAAAGGC criterion=fanout-score sequence-density=0.13 sequence-density-rank=24 fanout-score=34.24 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=10.8 sequence=AAAGAAAAGAAAA SRR12690141 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:20:47 Started mapping on | Feb 10 18:20:47 Finished on | Feb 10 18:23:01 Mapping speed, Million of reads per hour | 587.42 Number of input reads | 21865104 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 20705752 Uniquely mapped reads % | 94.70% Average mapped length | 295.87 Number of splices: Total | 20345100 Number of splices: Annotated (sjdb) | 19885705 Number of splices: GT/AG | 19933668 Number of splices: GC/AG | 338152 Number of splices: AT/AC | 14284 Number of splices: Non-canonical | 58996 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.96 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 544553 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 135258 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.06% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 614799 614799 614799 N_multimapping 544553 544553 544553 N_noFeature 732166 20491084 803129 N_ambiguous 276216 1261 131664 UnstrandedReadsAssigned:19697370 PositiveStrandReadsAssigned:213407 NegativeStrandReadsAssigned:19770959 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690141 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690141-trimmed-pair1.fastq SRR12690141-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,865,104 reads, 19,881,542 reads pseudoaligned [quant] estimated average fragment length: 251.133 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,087 rounds 52401 SRR12690141.ke.tsv 34699 SRR12690141.se.tsv 87100 total ==> SRR12690141.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.87 451 12.3524 Potri.005G024800.1.v4.1 1035 784.867 191 11.7832 Potri.004G059700.1.v4.1 961 710.97 73 4.9716 Potri.007G009000.2.v4.1 1416 1165.87 0 0 Potri.003G141000.2.v4.1 2943 2692.87 678.85 12.2063 Potri.016G087400.1.v4.1 270 83.743 1033 597.278 Potri.015G069301.1.v4.1 564 325.438 0 0 Potri.010G195200.1.v4.1 1773 1522.87 6 0.190772 Potri.012G127500.1.v4.1 977 726.924 1933 128.756 ==> SRR12690141.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 589 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 485 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 41 SRR12690141 completed mapping pipeline successfully