Starting /dee2/code/volunteer_pipeline.sh SRR12690142 current disk space = 3057680449536 free memory = 1023907760 SRR12690142 SRAfilesize 2c480474116464b503c1b9e3ab1607da SRR12690142.sra SRR12690142.sra file validated SRR12690142 is paired end SRR12690142 is conventional basespace SRR12690142 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690142_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5495 37.0 37.0 37.0 37.0 37.0 2 36.3955 37.0 37.0 37.0 37.0 37.0 3 36.616 37.0 37.0 37.0 37.0 37.0 4 36.511 37.0 37.0 37.0 37.0 37.0 5 36.6865 37.0 37.0 37.0 37.0 37.0 6 36.606 37.0 37.0 37.0 37.0 37.0 7 36.468 37.0 37.0 37.0 37.0 37.0 8 36.608 37.0 37.0 37.0 37.0 37.0 9 36.5535 37.0 37.0 37.0 37.0 37.0 10-14 36.553399999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.511300000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.5379 37.0 37.0 37.0 37.0 37.0 25-29 36.4833 37.0 37.0 37.0 37.0 37.0 30-34 36.45119999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.40220000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.411 37.0 37.0 37.0 37.0 37.0 45-49 36.3355 37.0 37.0 37.0 37.0 37.0 50-54 36.3243 37.0 37.0 37.0 37.0 37.0 55-59 36.2995 37.0 37.0 37.0 37.0 37.0 60-64 36.3249 37.0 37.0 37.0 37.0 37.0 65-69 36.2814 37.0 37.0 37.0 37.0 37.0 70-74 36.2543 37.0 37.0 37.0 37.0 37.0 75-79 36.237399999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.1766 37.0 37.0 37.0 37.0 37.0 85-89 36.172399999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.192899999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.110800000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.060500000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.097699999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.0653 37.0 37.0 37.0 37.0 37.0 115-119 36.0085 37.0 37.0 37.0 37.0 37.0 120-124 35.9666 37.0 37.0 37.0 37.0 37.0 125-129 35.9762 37.0 37.0 37.0 37.0 37.0 130-134 35.94000000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.9105 37.0 37.0 37.0 37.0 37.0 140-144 35.82899999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.7142 37.0 37.0 37.0 37.0 37.0 150-151 35.5975 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 5.0 26 6.0 27 10.0 28 17.0 29 28.0 30 33.0 31 41.0 32 42.0 33 66.0 34 101.0 35 303.0 36 2994.0 37 353.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.2 12.65 7.1499999999999995 36.0 2 21.51454363089268 14.092276830491473 32.54764292878636 31.845536609829487 3 17.5 16.425 29.849999999999998 36.225 4 21.475 24.775 24.95 28.799999999999997 5 22.325 31.95 23.925 21.8 6 20.549999999999997 35.15 23.35 20.95 7 15.825 26.85 41.125 16.2 8 18.35 27.575 30.2 23.875 9 18.0 24.224999999999998 34.599999999999994 23.175 10-14 20.485 29.14 27.384999999999998 22.99 15-19 19.865 28.175 27.88 24.08 20-24 19.98 28.360000000000003 28.244999999999997 23.415 25-29 20.0 28.58 27.834999999999997 23.585 30-34 19.869999999999997 28.92 27.705000000000002 23.505000000000003 35-39 19.465 28.485 27.55 24.5 40-44 20.335 28.660000000000004 27.315 23.69 45-49 19.37 28.549999999999997 28.294999999999998 23.785 50-54 20.544999999999998 28.155 27.889999999999997 23.41 55-59 19.794999999999998 28.73 27.83 23.645 60-64 20.424999999999997 28.494999999999997 27.589999999999996 23.49 65-69 20.095 28.76 27.365000000000002 23.78 70-74 20.54 28.335 27.950000000000003 23.175 75-79 20.665 28.610000000000003 27.51 23.215 80-84 20.175 28.325 28.22 23.28 85-89 20.055 28.694999999999997 27.555000000000003 23.695 90-94 19.794999999999998 28.634999999999998 28.01 23.56 95-99 20.34 28.57 28.060000000000002 23.03 100-104 19.93 27.99 28.144999999999996 23.935000000000002 105-109 20.52 28.095 27.395000000000003 23.990000000000002 110-114 20.48 27.694999999999997 28.33 23.494999999999997 115-119 20.560000000000002 28.415000000000003 27.71 23.315 120-124 20.349999999999998 28.375 27.47 23.805 125-129 20.974999999999998 29.38 26.58 23.064999999999998 130-134 21.005 27.83 27.37 23.794999999999998 135-139 20.880000000000003 28.58 26.345000000000002 24.195 140-144 20.69 27.994999999999997 27.375 23.94 145-149 21.625 27.689999999999998 27.125 23.56 150-151 20.825 28.3375 26.724999999999998 24.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 5.0 26 7.5 27 4.0 28 6.0 29 12.0 30 20.0 31 30.0 32 37.0 33 48.0 34 54.0 35 67.5 36 91.0 37 109.5 38 135.5 39 160.5 40 182.0 41 209.5 42 235.5 43 254.5 44 266.5 45 268.5 46 269.0 47 254.5 48 235.0 49 204.0 50 177.0 51 151.5 52 115.5 53 95.0 54 74.0 55 60.0 56 49.0 57 32.0 58 20.0 59 19.5 60 12.5 61 6.0 62 6.5 63 3.5 64 1.5 65 1.5 66 1.5 67 1.5 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.07499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.28889492261743 84.975 2 6.896551724137931 12.7 3 0.7330980179201738 2.025 4 0.08145533532446375 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.11249999999999999 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.3875000000000002 0.0 0.0 0.0 0.0 110-111 1.7 0.0 0.0 0.0 0.0 112-113 1.8875000000000002 0.0 0.0 0.0 0.0 114-115 2.0999999999999996 0.0 0.0 0.0 0.0 116-117 2.325 0.0 0.0 0.0 0.0 118-119 2.7 0.0 0.0 0.0 0.0 120-121 3.0875 0.0 0.0 0.0 0.0 122-123 3.5999999999999996 0.0 0.0 0.0 0.0 124-125 4.0 0.0 0.0 0.0 0.0 126-127 4.4125 0.0 0.0 0.0 0.0 128-129 4.8375 0.0 0.0 0.0 0.0 130-131 5.3125 0.0 0.0 0.0 0.0 132-133 5.8875 0.0 0.0 0.0 0.0 134-135 6.3125 0.0 0.0 0.0 0.0 136-137 6.775 0.0 0.0 0.0 0.0 138-139 7.324999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCAACT 10 0.006830828 145.0 9 >>END_MODULE SRR12690142 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690142_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.226 37.0 37.0 37.0 37.0 37.0 2 36.0365 37.0 37.0 37.0 37.0 37.0 3 36.116 37.0 37.0 37.0 37.0 37.0 4 36.1665 37.0 37.0 37.0 37.0 37.0 5 36.26 37.0 37.0 37.0 37.0 37.0 6 36.12 37.0 37.0 37.0 37.0 37.0 7 36.234 37.0 37.0 37.0 37.0 37.0 8 36.1895 37.0 37.0 37.0 37.0 37.0 9 36.2065 37.0 37.0 37.0 37.0 37.0 10-14 36.1918 37.0 37.0 37.0 37.0 37.0 15-19 36.1728 37.0 37.0 37.0 37.0 37.0 20-24 36.1761 37.0 37.0 37.0 37.0 37.0 25-29 36.134299999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.1034 37.0 37.0 37.0 37.0 37.0 35-39 36.0844 37.0 37.0 37.0 37.0 37.0 40-44 36.0452 37.0 37.0 37.0 37.0 37.0 45-49 36.0023 37.0 37.0 37.0 37.0 37.0 50-54 35.998999999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.903800000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.9065 37.0 37.0 37.0 37.0 37.0 65-69 35.8725 37.0 37.0 37.0 37.0 37.0 70-74 35.8547 37.0 37.0 37.0 37.0 37.0 75-79 35.8609 37.0 37.0 37.0 37.0 37.0 80-84 35.8176 37.0 37.0 37.0 37.0 37.0 85-89 35.8267 37.0 37.0 37.0 37.0 37.0 90-94 35.7567 37.0 37.0 37.0 37.0 37.0 95-99 35.783699999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.7687 37.0 37.0 37.0 37.0 37.0 105-109 35.727799999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.72619999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.60359999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.5571 37.0 37.0 37.0 37.0 37.0 125-129 35.489399999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.512 37.0 37.0 37.0 37.0 37.0 135-139 35.468 37.0 37.0 37.0 37.0 37.0 140-144 35.3643 37.0 37.0 37.0 37.0 37.0 145-149 35.2886 37.0 37.0 37.0 29.8 37.0 150-151 34.817499999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 3.0 15 3.0 16 0.0 17 2.0 18 4.0 19 2.0 20 3.0 21 5.0 22 2.0 23 14.0 24 5.0 25 9.0 26 14.0 27 8.0 28 21.0 29 25.0 30 33.0 31 41.0 32 54.0 33 91.0 34 181.0 35 484.0 36 2688.0 37 304.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.025 24.95 9.9 24.125 2 28.275 26.325 28.525 16.875 3 20.575 27.625 33.074999999999996 18.725 4 23.825 35.199999999999996 22.475 18.5 5 24.775 35.275 22.325 17.625 6 21.8 38.625 21.8 17.775 7 21.349999999999998 22.85 37.625 18.175 8 22.475 26.1 27.125 24.3 9 21.05 26.200000000000003 29.725 23.025000000000002 10-14 23.895 29.34 26.26 20.505000000000003 15-19 23.405 28.084999999999997 27.389999999999997 21.12 20-24 22.939999999999998 28.525 27.405 21.13 25-29 22.78 29.049999999999997 27.275 20.895 30-34 22.705000000000002 28.415000000000003 27.705000000000002 21.175 35-39 22.634999999999998 28.515 27.735 21.115000000000002 40-44 22.994999999999997 29.09 27.55 20.365 45-49 23.27 28.244999999999997 28.005000000000003 20.48 50-54 22.869999999999997 28.04 27.544999999999998 21.545 55-59 22.785 29.005 27.37 20.84 60-64 22.78 27.839999999999996 28.33 21.05 65-69 23.175 28.12 27.900000000000002 20.805 70-74 23.03 28.275 28.285 20.41 75-79 23.3 28.48 27.37 20.849999999999998 80-84 21.884999999999998 28.54 27.689999999999998 21.884999999999998 85-89 22.884999999999998 28.32 27.43 21.365000000000002 90-94 23.945 27.125 28.005000000000003 20.925 95-99 22.900000000000002 28.310000000000002 27.944999999999997 20.845 100-104 23.605 28.08 27.36 20.955 105-109 23.515 28.705000000000002 27.355 20.424999999999997 110-114 23.05 28.299999999999997 28.185 20.465 115-119 23.305 28.634999999999998 27.534999999999997 20.525 120-124 23.599999999999998 28.595 27.665 20.14 125-129 23.974999999999998 28.685 27.075 20.265 130-134 24.59 28.57 26.919999999999998 19.919999999999998 135-139 24.335 27.265 27.96 20.44 140-144 24.5 28.65 27.105 19.744999999999997 145-149 25.380000000000003 28.655 26.07 19.895 150-151 24.4375 27.775 27.5875 20.200000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 1.5 8 3.5 9 2.0 10 1.0 11 1.0 12 0.5 13 2.0 14 2.0 15 0.5 16 0.0 17 1.5 18 1.5 19 0.5 20 2.5 21 3.0 22 2.5 23 3.0 24 4.5 25 5.0 26 2.5 27 2.5 28 4.0 29 9.5 30 19.0 31 21.0 32 30.0 33 44.0 34 52.0 35 67.0 36 83.0 37 106.5 38 145.0 39 164.0 40 188.0 41 229.5 42 233.5 43 256.0 44 288.5 45 272.0 46 258.0 47 251.5 48 238.0 49 208.5 50 169.0 51 138.0 52 107.5 53 79.0 54 60.5 55 53.5 56 38.5 57 28.0 58 28.0 59 19.5 60 13.5 61 12.0 62 9.0 63 5.5 64 3.0 65 1.5 66 1.0 67 1.5 68 2.0 69 1.0 70 1.0 71 2.0 72 1.5 73 0.5 74 0.5 75 1.0 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.53528773072746 85.225 2 6.5689467969598265 12.1 3 0.8143322475570033 2.25 4 0.05428881650380022 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02714440825190011 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.11249999999999999 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.075 0.0 0.0 0.0 0.0 106-107 1.3 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.7625 0.0 0.0 0.0 0.0 112-113 1.9375 0.0 0.0 0.0 0.0 114-115 2.1500000000000004 0.0 0.0 0.0 0.0 116-117 2.375 0.0 0.0 0.0 0.0 118-119 2.75 0.0 0.0 0.0 0.0 120-121 3.1375 0.0 0.0 0.0 0.0 122-123 3.6500000000000004 0.0 0.0 0.0 0.0 124-125 4.05 0.0 0.0 0.0 0.0 126-127 4.4375 0.0 0.0 0.0 0.0 128-129 4.875 0.0 0.0 0.0 0.0 130-131 5.3625 0.0 0.0 0.0 0.0 132-133 5.9625 0.0 0.0 0.0 0.0 134-135 6.3875 0.0 0.0 0.0 0.0 136-137 6.85 0.0 0.0 0.0 0.0 138-139 7.425000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACCAA 15 1.1411342E-4 145.0 4 TAAACCA 10 0.006830828 145.0 3 AAACACG 10 0.006830828 145.0 9 ACCAAAC 15 1.1411342E-4 145.0 6 ATGCCTT 10 0.006830828 145.0 145 AGTAAAC 10 0.006830828 145.0 1 AACCAAA 20 3.5877043E-4 108.75 5 >>END_MODULE Read 955234 spots for SRR12690142.sra Written 955234 spots for SRR12690142.sra Read 955234 spots for SRR12690142.sra Written 955234 spots for SRR12690142.sra Read 955234 spots for SRR12690142.sra Written 955234 spots for SRR12690142.sra Read 955234 spots for SRR12690142.sra Written 955234 spots for SRR12690142.sra Read 955234 spots for SRR12690142.sra Written 955234 spots for SRR12690142.sra Read 955234 spots for SRR12690142.sra Written 955234 spots for SRR12690142.sra Read 955234 spots for SRR12690142.sra Written 955234 spots for SRR12690142.sra Read 955234 spots for SRR12690142.sra Written 955234 spots for SRR12690142.sra Read 955234 spots for SRR12690142.sra Written 955234 spots for SRR12690142.sra Read 955234 spots for SRR12690142.sra Written 955234 spots for SRR12690142.sra Read 955234 spots for SRR12690142.sra Written 955234 spots for SRR12690142.sra Read 955234 spots for SRR12690142.sra Written 955234 spots for SRR12690142.sra Read 955234 spots for SRR12690142.sra Written 955234 spots for SRR12690142.sra Read 955234 spots for SRR12690142.sra Written 955234 spots for SRR12690142.sra Read 955234 spots for SRR12690142.sra Written 955234 spots for SRR12690142.sra Read 955234 spots for SRR12690142.sra Written 955234 spots for SRR12690142.sra Read 955234 spots for SRR12690142.sra Written 955234 spots for SRR12690142.sra Read 955234 spots for SRR12690142.sra Written 955234 spots for SRR12690142.sra Read 955234 spots for SRR12690142.sra Written 955234 spots for SRR12690142.sra Read 955237 spots for SRR12690142.sra Written 955237 spots for SRR12690142.sra SRR ids: ['SRR12690142.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g4zzyc3g SRR12690142.sra spots: 19104683 blocks: [[1, 955234], [955235, 1910468], [1910469, 2865702], [2865703, 3820936], [3820937, 4776170], [4776171, 5731404], [5731405, 6686638], [6686639, 7641872], [7641873, 8597106], [8597107, 9552340], [9552341, 10507574], [10507575, 11462808], [11462809, 12418042], [12418043, 13373276], [13373277, 14328510], [14328511, 15283744], [15283745, 16238978], [16238979, 17194212], [17194213, 18149446], [18149447, 19104683]] SRR12690142 file size 6470906 SRR12690142 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690142 SRR12690142_1.fastq SRR12690142_2.fastq Input file: SRR12690142_1.fastq Paired file: SRR12690142_2.fastq trimmed: SRR12690142-trimmed-pair1.fastq, SRR12690142-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:15:00 2025 >> started Mon Feb 10 18:15:22 2025 >> done (22.000s) 19104683 read pairs processed; of these: 28 ( 0.00%) short read pairs filtered out after trimming by size control 5887 ( 0.03%) empty read pairs filtered out after trimming by size control 19098768 (99.97%) read pairs available; of these: 2190400 (11.47%) trimmed read pairs available after processing 16908368 (88.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 3 0.00% 21 6 0.00% 22 11 0.00% 23 11 0.00% 24 17 0.00% 25 10 0.00% 26 23 0.00% 27 24 0.00% 28 25 0.00% 29 21 0.00% 30 16 0.00% 31 30 0.00% 32 20 0.00% 33 30 0.00% 34 30 0.00% 35 31 0.00% 36 40 0.00% 37 33 0.00% 38 23 0.00% 39 41 0.00% 40 47 0.00% 41 47 0.00% 42 42 0.00% 43 48 0.00% 44 48 0.00% 45 70 0.00% 46 52 0.00% 47 59 0.00% 48 65 0.00% 49 79 0.00% 50 99 0.00% 51 121 0.00% 52 103 0.00% 53 135 0.00% 54 116 0.00% 55 142 0.00% 56 125 0.00% 57 158 0.00% 58 223 0.00% 59 251 0.00% 60 263 0.00% 61 309 0.00% 62 343 0.00% 63 373 0.00% 64 427 0.00% 65 449 0.00% 66 545 0.00% 67 597 0.00% 68 589 0.00% 69 740 0.00% 70 840 0.00% 71 965 0.01% 72 1158 0.01% 73 1280 0.01% 74 1346 0.01% 75 1483 0.01% 76 1663 0.01% 77 1815 0.01% 78 1985 0.01% 79 2326 0.01% 80 2616 0.01% 81 2887 0.02% 82 3215 0.02% 83 3583 0.02% 84 4019 0.02% 85 4418 0.02% 86 4709 0.02% 87 5073 0.03% 88 5722 0.03% 89 6045 0.03% 90 6481 0.03% 91 7181 0.04% 92 7786 0.04% 93 8465 0.04% 94 9339 0.05% 95 10146 0.05% 96 10528 0.06% 97 11363 0.06% 98 11812 0.06% 99 12442 0.07% 100 13686 0.07% 101 14180 0.07% 102 15295 0.08% 103 16033 0.08% 104 16927 0.09% 105 17899 0.09% 106 18622 0.10% 107 19589 0.10% 108 20192 0.11% 109 21377 0.11% 110 21890 0.11% 111 23079 0.12% 112 24133 0.13% 113 24862 0.13% 114 26504 0.14% 115 27814 0.15% 116 28191 0.15% 117 29694 0.16% 118 30788 0.16% 119 31640 0.17% 120 32835 0.17% 121 33474 0.18% 122 34818 0.18% 123 36166 0.19% 124 37577 0.20% 125 38779 0.20% 126 39741 0.21% 127 41757 0.22% 128 42578 0.22% 129 43324 0.23% 130 44933 0.24% 131 45939 0.24% 132 47019 0.25% 133 48981 0.26% 134 49995 0.26% 135 51280 0.27% 136 52673 0.28% 137 54153 0.28% 138 54425 0.28% 139 56214 0.29% 140 56668 0.30% 141 58028 0.30% 142 60462 0.32% 143 61194 0.32% 144 63570 0.33% 145 64647 0.34% 146 65402 0.34% 147 66365 0.35% 148 67231 0.35% 149 67895 0.36% 150 70073 0.37% 151 16908368 88.53% 19098768 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=32 prefix-density=0.37 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=52.40 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=2.0 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCCATAGAAAGTTCCTCTATCAATGGAATCTTGATTGGCTTCACCAAGAGAAGCCTCGCTCAGGTACTTGTCAGCCAATTGGACTCTCTTCACATTCTCTTGCTCCTGGACAAGCATGTTTCCATACTCAAGGAGCTTCTCGATTGTCATCTTCGGCTGCTCAAAAGTTGGGGGTCCTTCCCTTGAGTTCACAAGTTTCTTTCCAATGCTGTCAACACCAACGCCTGAGACCCACTTCCTCACCTCATCGTCATAAACTCGGGC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=3.55 fanout-score-rank=29 prefix-density=0.31 prefix-fanout=2.9 sequence=CCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=337.50 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=21.5 sequence=GAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGG SRR12690142 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:16:08 Started mapping on | Feb 10 18:16:08 Finished on | Feb 10 18:18:04 Mapping speed, Million of reads per hour | 592.72 Number of input reads | 19098768 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17908565 Uniquely mapped reads % | 93.77% Average mapped length | 295.63 Number of splices: Total | 16849779 Number of splices: Annotated (sjdb) | 16280769 Number of splices: GT/AG | 16524267 Number of splices: GC/AG | 260029 Number of splices: AT/AC | 14415 Number of splices: Non-canonical | 51068 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 436250 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 176159 % of reads mapped to too many loci | 0.92% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.78% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 753953 753953 753953 N_multimapping 436250 436250 436250 N_noFeature 852098 17659712 962486 N_ambiguous 242007 1620 102501 UnstrandedReadsAssigned:16814460 PositiveStrandReadsAssigned:247233 NegativeStrandReadsAssigned:16843578 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690142 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690142-trimmed-pair1.fastq SRR12690142-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,098,768 reads, 16,992,581 reads pseudoaligned [quant] estimated average fragment length: 239.134 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,037 rounds 52401 SRR12690142.ke.tsv 34699 SRR12690142.se.tsv 87100 total ==> SRR12690142.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.87 1013 32.573 Potri.005G024800.1.v4.1 1035 796.866 959 68.8762 Potri.004G059700.1.v4.1 961 722.959 81 6.4122 Potri.007G009000.2.v4.1 1416 1177.87 0 0 Potri.003G141000.2.v4.1 2943 2704.87 679.62 14.3799 Potri.016G087400.1.v4.1 270 83.647 1100 752.624 Potri.015G069301.1.v4.1 564 333.253 0 0 Potri.010G195200.1.v4.1 1773 1534.87 50 1.86438 Potri.012G127500.1.v4.1 977 738.901 537 41.5934 ==> SRR12690142.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 144 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 390 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR12690142 completed mapping pipeline successfully