Starting /dee2/code/volunteer_pipeline.sh SRR12690143 current disk space = 3057464811520 free memory = 1295385780 SRR12690143 SRAfilesize ee47341562c1c8db2361f561ec3eed62 SRR12690143.sra SRR12690143.sra file validated SRR12690143 is paired end SRR12690143 is conventional basespace SRR12690143 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690143_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.618 37.0 37.0 37.0 37.0 37.0 2 36.395 37.0 37.0 37.0 37.0 37.0 3 36.65 37.0 37.0 37.0 37.0 37.0 4 36.589 37.0 37.0 37.0 37.0 37.0 5 36.67 37.0 37.0 37.0 37.0 37.0 6 36.5855 37.0 37.0 37.0 37.0 37.0 7 36.523 37.0 37.0 37.0 37.0 37.0 8 36.679 37.0 37.0 37.0 37.0 37.0 9 36.591 37.0 37.0 37.0 37.0 37.0 10-14 36.644600000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.6535 37.0 37.0 37.0 37.0 37.0 20-24 36.588800000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.5417 37.0 37.0 37.0 37.0 37.0 30-34 36.5309 37.0 37.0 37.0 37.0 37.0 35-39 36.505399999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.5207 37.0 37.0 37.0 37.0 37.0 45-49 36.5044 37.0 37.0 37.0 37.0 37.0 50-54 36.4742 37.0 37.0 37.0 37.0 37.0 55-59 36.4491 37.0 37.0 37.0 37.0 37.0 60-64 36.4379 37.0 37.0 37.0 37.0 37.0 65-69 36.3447 37.0 37.0 37.0 37.0 37.0 70-74 36.392 37.0 37.0 37.0 37.0 37.0 75-79 36.340999999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.3133 37.0 37.0 37.0 37.0 37.0 85-89 36.3026 37.0 37.0 37.0 37.0 37.0 90-94 36.2863 37.0 37.0 37.0 37.0 37.0 95-99 36.2525 37.0 37.0 37.0 37.0 37.0 100-104 36.2204 37.0 37.0 37.0 37.0 37.0 105-109 36.132600000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.1563 37.0 37.0 37.0 37.0 37.0 115-119 36.156400000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.0831 37.0 37.0 37.0 37.0 37.0 125-129 36.0763 37.0 37.0 37.0 37.0 37.0 130-134 35.9536 37.0 37.0 37.0 37.0 37.0 135-139 36.0338 37.0 37.0 37.0 37.0 37.0 140-144 35.8257 37.0 37.0 37.0 37.0 37.0 145-149 35.8459 37.0 37.0 37.0 37.0 37.0 150-151 35.7945 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 1.0 25 4.0 26 5.0 27 5.0 28 11.0 29 14.0 30 19.0 31 29.0 32 43.0 33 63.0 34 122.0 35 262.0 36 3041.0 37 380.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.675000000000004 12.65 7.1 37.574999999999996 2 19.28104575163399 13.323278029160383 35.06787330316742 32.32780291603821 3 16.775000000000002 16.6 28.499999999999996 38.125 4 20.9 25.3 25.575 28.225 5 22.1 30.8 23.5 23.599999999999998 6 20.0 34.225 24.15 21.625 7 15.825 27.150000000000002 40.300000000000004 16.725 8 16.650000000000002 28.349999999999998 30.825000000000003 24.175 9 17.375 24.075 35.875 22.675 10-14 19.689999999999998 29.4 27.875 23.035 15-19 19.66 28.37 27.71 24.26 20-24 19.53 29.175 27.605 23.69 25-29 19.64 29.315 26.895000000000003 24.15 30-34 20.355 28.37 27.755000000000003 23.52 35-39 19.82 29.035 27.155 23.990000000000002 40-44 20.04 29.025000000000002 27.650000000000002 23.285 45-49 20.07 28.22 27.529999999999998 24.18 50-54 20.674999999999997 28.000000000000004 27.725 23.599999999999998 55-59 20.21 28.415000000000003 27.61 23.765 60-64 20.095 28.505000000000003 27.265 24.135 65-69 20.055 28.04 28.015 23.89 70-74 20.845 28.455000000000002 27.6 23.1 75-79 20.735 27.63 28.175 23.46 80-84 20.435 28.444999999999997 28.044999999999998 23.075000000000003 85-89 20.715 28.685 27.375 23.225 90-94 20.8 28.77 26.919999999999998 23.51 95-99 20.635 28.325 27.27 23.77 100-104 20.585 28.16 27.915 23.34 105-109 21.04 28.17 27.834999999999997 22.955000000000002 110-114 21.08 27.98 27.250000000000004 23.69 115-119 20.77 27.825 27.584999999999997 23.82 120-124 20.599999999999998 28.439999999999998 27.07 23.89 125-129 21.125 28.64 26.99 23.244999999999997 130-134 20.415 28.660000000000004 27.560000000000002 23.365 135-139 21.98 28.68 26.009999999999998 23.330000000000002 140-144 21.455 28.17 26.85 23.525 145-149 20.785 28.544999999999998 27.07 23.599999999999998 150-151 21.625 28.499999999999996 26.437500000000004 23.4375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 2.0 23 1.5 24 1.0 25 3.5 26 3.5 27 3.0 28 6.5 29 12.5 30 16.0 31 28.5 32 38.5 33 36.5 34 48.0 35 69.0 36 81.0 37 93.5 38 120.5 39 171.5 40 204.0 41 210.5 42 240.0 43 256.0 44 247.5 45 269.5 46 283.5 47 260.0 48 241.5 49 212.0 50 168.5 51 137.0 52 120.0 53 92.0 54 69.0 55 64.0 56 50.5 57 41.0 58 36.0 59 20.0 60 9.0 61 11.5 62 9.0 63 2.0 64 1.5 65 2.5 66 1.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.5499999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.575 #Duplication Level Percentage of deduplicated Percentage of total 1 90.91912779464533 82.35 2 7.894010488545404 14.299999999999999 3 1.0488545404361027 2.85 4 0.1380071763731714 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.48750000000000004 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.7875000000000001 0.0 0.0 0.0 0.0 102-103 0.9624999999999999 0.0 0.0 0.0 0.0 104-105 1.05 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.3875 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.5250000000000004 0.0 0.0 0.0 0.0 118-119 2.7874999999999996 0.0 0.0 0.0 0.0 120-121 3.1125 0.0 0.0 0.0 0.0 122-123 3.375 0.0 0.0 0.0 0.0 124-125 3.6500000000000004 0.0 0.0 0.0 0.0 126-127 4.2125 0.0 0.0 0.0 0.0 128-129 4.7 0.0 0.0 0.0 0.0 130-131 5.112500000000001 0.0 0.0 0.0 0.0 132-133 5.762499999999999 0.0 0.0 0.0 0.0 134-135 6.4125 0.0 0.0 0.0 0.0 136-137 6.8125 0.0 0.0 0.0 0.0 138-139 7.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGACGT 10 0.006830828 145.0 145 >>END_MODULE SRR12690143 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690143_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3615 37.0 37.0 37.0 37.0 37.0 2 36.1325 37.0 37.0 37.0 37.0 37.0 3 36.107 37.0 37.0 37.0 37.0 37.0 4 36.1995 37.0 37.0 37.0 37.0 37.0 5 36.348 37.0 37.0 37.0 37.0 37.0 6 36.2515 37.0 37.0 37.0 37.0 37.0 7 36.319 37.0 37.0 37.0 37.0 37.0 8 36.333 37.0 37.0 37.0 37.0 37.0 9 36.3535 37.0 37.0 37.0 37.0 37.0 10-14 36.2824 37.0 37.0 37.0 37.0 37.0 15-19 36.293400000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.3009 37.0 37.0 37.0 37.0 37.0 25-29 36.21169999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.1663 37.0 37.0 37.0 37.0 37.0 35-39 36.195100000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.153 37.0 37.0 37.0 37.0 37.0 45-49 36.191700000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.1376 37.0 37.0 37.0 37.0 37.0 55-59 36.1454 37.0 37.0 37.0 37.0 37.0 60-64 36.0747 37.0 37.0 37.0 37.0 37.0 65-69 36.0486 37.0 37.0 37.0 37.0 37.0 70-74 35.9556 37.0 37.0 37.0 37.0 37.0 75-79 35.9516 37.0 37.0 37.0 37.0 37.0 80-84 35.9459 37.0 37.0 37.0 37.0 37.0 85-89 35.9379 37.0 37.0 37.0 37.0 37.0 90-94 35.8271 37.0 37.0 37.0 37.0 37.0 95-99 35.8594 37.0 37.0 37.0 37.0 37.0 100-104 35.9026 37.0 37.0 37.0 37.0 37.0 105-109 35.8138 37.0 37.0 37.0 37.0 37.0 110-114 35.7719 37.0 37.0 37.0 37.0 37.0 115-119 35.7305 37.0 37.0 37.0 37.0 37.0 120-124 35.589099999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.623599999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.4576 37.0 37.0 37.0 37.0 37.0 135-139 35.324799999999996 37.0 37.0 37.0 32.2 37.0 140-144 35.367399999999996 37.0 37.0 37.0 34.6 37.0 145-149 35.27839999999999 37.0 37.0 37.0 29.8 37.0 150-151 34.770250000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 2.0 15 1.0 16 3.0 17 1.0 18 1.0 19 0.0 20 1.0 21 2.0 22 2.0 23 3.0 24 1.0 25 2.0 26 12.0 27 11.0 28 14.0 29 14.0 30 20.0 31 46.0 32 62.0 33 104.0 34 211.0 35 565.0 36 2673.0 37 245.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.375 26.450000000000003 10.375 24.8 2 29.799999999999997 27.55 27.3 15.35 3 20.275000000000002 29.975 30.45 19.3 4 22.625 34.25 23.7 19.425 5 24.55 36.35 22.900000000000002 16.2 6 21.125 39.7 21.9 17.275 7 19.975 22.225 38.05 19.75 8 21.0 25.75 27.85 25.4 9 21.575 26.025 30.25 22.15 10-14 23.485 29.054999999999996 26.38 21.08 15-19 22.84 28.505000000000003 27.355 21.3 20-24 22.735 27.79 28.000000000000004 21.475 25-29 22.54 28.205000000000002 28.194999999999997 21.060000000000002 30-34 22.955000000000002 27.644999999999996 28.29 21.11 35-39 22.775000000000002 27.860000000000003 27.775 21.59 40-44 22.515 28.78 27.805000000000003 20.9 45-49 23.175 27.584999999999997 28.110000000000003 21.13 50-54 22.884999999999998 27.605 27.744999999999997 21.765 55-59 22.45 26.945000000000004 29.01 21.595 60-64 22.689999999999998 27.825 27.98 21.505 65-69 23.13 27.37 27.839999999999996 21.66 70-74 23.25 28.08 27.485 21.185000000000002 75-79 22.835 27.63 27.785 21.75 80-84 22.755 28.455000000000002 27.145000000000003 21.645 85-89 23.335 27.855 27.855 20.955 90-94 23.705000000000002 27.810000000000002 27.36 21.125 95-99 23.415 28.115000000000002 27.529999999999998 20.94 100-104 23.724999999999998 27.705000000000002 27.97 20.599999999999998 105-109 23.335 27.465 27.865000000000002 21.335 110-114 23.41 27.834999999999997 28.07 20.685000000000002 115-119 23.53 27.965 27.884999999999998 20.62 120-124 24.005000000000003 28.405 27.27 20.32 125-129 24.695 27.42 27.334999999999997 20.549999999999997 130-134 24.884999999999998 27.87 27.169999999999998 20.075000000000003 135-139 24.715 27.93 27.439999999999998 19.915 140-144 25.705 26.88 27.68 19.735 145-149 25.919999999999998 27.405 26.795 19.88 150-151 26.400000000000002 27.250000000000004 26.8 19.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.5 13 1.5 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.0 20 2.5 21 3.0 22 2.5 23 3.0 24 2.0 25 2.5 26 3.5 27 5.5 28 6.0 29 5.5 30 9.0 31 15.0 32 23.0 33 30.5 34 54.5 35 68.5 36 84.0 37 118.5 38 139.0 39 161.0 40 193.0 41 234.5 42 257.0 43 244.0 44 252.0 45 283.0 46 270.5 47 250.5 48 232.0 49 202.0 50 174.0 51 138.5 52 114.5 53 100.5 54 87.5 55 63.5 56 41.0 57 31.5 58 23.5 59 17.0 60 13.5 61 11.0 62 5.0 63 2.0 64 1.5 65 0.5 66 1.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 1.0 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.875 #Duplication Level Percentage of deduplicated Percentage of total 1 91.30674002751032 82.975 2 7.620357634112793 13.850000000000001 3 0.8803301237964236 2.4 4 0.1375515818431912 0.5 5 0.027510316368638238 0.125 6 0.027510316368638238 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit AGGGTGTCTAGGTTCCAAGATTTGATGAGTCCCTAGCTATCTGTTAGGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.48750000000000004 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.7875000000000001 0.0 0.0 0.0 0.0 102-103 0.9624999999999999 0.0 0.0 0.0 0.0 104-105 1.05 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.3875 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.5250000000000004 0.0 0.0 0.0 0.0 118-119 2.7874999999999996 0.0 0.0 0.0 0.0 120-121 3.1125 0.0 0.0 0.0 0.0 122-123 3.3625 0.0 0.0 0.0 0.0 124-125 3.625 0.0 0.0 0.0 0.0 126-127 4.1875 0.0 0.0 0.0 0.0 128-129 4.6875 0.0 0.0 0.0 0.0 130-131 5.112500000000001 0.0 0.0 0.0 0.0 132-133 5.762499999999999 0.0 0.0 0.0 0.0 134-135 6.4 0.0 0.0 0.0 0.0 136-137 6.7875 0.0 0.0 0.0 0.0 138-139 7.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGGAC 10 0.006830828 145.0 1 TTGGACA 10 0.006830828 145.0 2 GGACGTG 10 0.006830828 145.0 145 >>END_MODULE Read 1112838 spots for SRR12690143.sra Written 1112838 spots for SRR12690143.sra Read 1112838 spots for SRR12690143.sra Written 1112838 spots for SRR12690143.sra Read 1112838 spots for SRR12690143.sra Written 1112838 spots for SRR12690143.sra Read 1112838 spots for SRR12690143.sra Written 1112838 spots for SRR12690143.sra Read 1112838 spots for SRR12690143.sra Written 1112838 spots for SRR12690143.sra Read 1112838 spots for SRR12690143.sra Written 1112838 spots for SRR12690143.sra Read 1112838 spots for SRR12690143.sra Written 1112838 spots for SRR12690143.sra Read 1112838 spots for SRR12690143.sra Written 1112838 spots for SRR12690143.sra Read 1112838 spots for SRR12690143.sra Written 1112838 spots for SRR12690143.sra Read 1112838 spots for SRR12690143.sra Written 1112838 spots for SRR12690143.sra Read 1112838 spots for SRR12690143.sra Written 1112838 spots for SRR12690143.sra Read 1112838 spots for SRR12690143.sra Written 1112838 spots for SRR12690143.sra Read 1112838 spots for SRR12690143.sra Written 1112838 spots for SRR12690143.sra Read 1112838 spots for SRR12690143.sra Written 1112838 spots for SRR12690143.sra Read 1112838 spots for SRR12690143.sra Written 1112838 spots for SRR12690143.sra Read 1112838 spots for SRR12690143.sra Written 1112838 spots for SRR12690143.sra Read 1112838 spots for SRR12690143.sra Written 1112838 spots for SRR12690143.sra Read 1112856 spots for SRR12690143.sra Written 1112856 spots for SRR12690143.sra Read 1112838 spots for SRR12690143.sra Written 1112838 spots for SRR12690143.sra Read 1112838 spots for SRR12690143.sra Written 1112838 spots for SRR12690143.sra SRR ids: ['SRR12690143.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_thun5azf SRR12690143.sra spots: 22256778 blocks: [[1, 1112838], [1112839, 2225676], [2225677, 3338514], [3338515, 4451352], [4451353, 5564190], [5564191, 6677028], [6677029, 7789866], [7789867, 8902704], [8902705, 10015542], [10015543, 11128380], [11128381, 12241218], [12241219, 13354056], [13354057, 14466894], [14466895, 15579732], [15579733, 16692570], [16692571, 17805408], [17805409, 18918246], [18918247, 20031084], [20031085, 21143922], [21143923, 22256778]] SRR12690143 file size 7542126 SRR12690143 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690143 SRR12690143_1.fastq SRR12690143_2.fastq Input file: SRR12690143_1.fastq Paired file: SRR12690143_2.fastq trimmed: SRR12690143-trimmed-pair1.fastq, SRR12690143-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:37:29 2025 >> started Mon Feb 10 18:38:08 2025 >> done (39.013s) 22256778 read pairs processed; of these: 40 ( 0.00%) short read pairs filtered out after trimming by size control 4555 ( 0.02%) empty read pairs filtered out after trimming by size control 22252183 (99.98%) read pairs available; of these: 2417190 (10.86%) trimmed read pairs available after processing 19834993 (89.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 6 0.00% 21 2 0.00% 22 11 0.00% 23 8 0.00% 24 16 0.00% 25 19 0.00% 26 18 0.00% 27 16 0.00% 28 29 0.00% 29 13 0.00% 30 33 0.00% 31 29 0.00% 32 30 0.00% 33 27 0.00% 34 37 0.00% 35 31 0.00% 36 37 0.00% 37 35 0.00% 38 32 0.00% 39 48 0.00% 40 43 0.00% 41 48 0.00% 42 47 0.00% 43 59 0.00% 44 53 0.00% 45 64 0.00% 46 57 0.00% 47 64 0.00% 48 98 0.00% 49 101 0.00% 50 89 0.00% 51 128 0.00% 52 129 0.00% 53 128 0.00% 54 145 0.00% 55 147 0.00% 56 150 0.00% 57 189 0.00% 58 202 0.00% 59 253 0.00% 60 309 0.00% 61 348 0.00% 62 405 0.00% 63 382 0.00% 64 431 0.00% 65 497 0.00% 66 573 0.00% 67 597 0.00% 68 739 0.00% 69 740 0.00% 70 899 0.00% 71 991 0.00% 72 1219 0.01% 73 1245 0.01% 74 1471 0.01% 75 1635 0.01% 76 1804 0.01% 77 1930 0.01% 78 2166 0.01% 79 2397 0.01% 80 2697 0.01% 81 3007 0.01% 82 3490 0.02% 83 3784 0.02% 84 4221 0.02% 85 4701 0.02% 86 5005 0.02% 87 5599 0.03% 88 5906 0.03% 89 6421 0.03% 90 7026 0.03% 91 7668 0.03% 92 8294 0.04% 93 9160 0.04% 94 9892 0.04% 95 10671 0.05% 96 11112 0.05% 97 12156 0.05% 98 12963 0.06% 99 13568 0.06% 100 14378 0.06% 101 15035 0.07% 102 16238 0.07% 103 17342 0.08% 104 17907 0.08% 105 19045 0.09% 106 20318 0.09% 107 21168 0.10% 108 22301 0.10% 109 22731 0.10% 110 23979 0.11% 111 25280 0.11% 112 26295 0.12% 113 27140 0.12% 114 28496 0.13% 115 30044 0.14% 116 31387 0.14% 117 32851 0.15% 118 33577 0.15% 119 34348 0.15% 120 36206 0.16% 121 37668 0.17% 122 38287 0.17% 123 40067 0.18% 124 41759 0.19% 125 42565 0.19% 126 44092 0.20% 127 45957 0.21% 128 46535 0.21% 129 48247 0.22% 130 49480 0.22% 131 50647 0.23% 132 52688 0.24% 133 54126 0.24% 134 54987 0.25% 135 56550 0.25% 136 58244 0.26% 137 59039 0.27% 138 61001 0.27% 139 62539 0.28% 140 63592 0.29% 141 65312 0.29% 142 67427 0.30% 143 68107 0.31% 144 70241 0.32% 145 72103 0.32% 146 72919 0.33% 147 73907 0.33% 148 76834 0.35% 149 76477 0.34% 150 78929 0.35% 151 19834993 89.14% 22252183 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=12 prefix-density=0.49 prefix-fanout=2.3 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=10.04 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=2.9 sequence=AGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=33 prefix-density=0.57 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=36.95 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=2.0 sequence=GGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCAACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR12690143 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:38:59 Started mapping on | Feb 10 18:39:00 Finished on | Feb 10 18:41:24 Mapping speed, Million of reads per hour | 556.30 Number of input reads | 22252183 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 21167356 Uniquely mapped reads % | 95.12% Average mapped length | 295.97 Number of splices: Total | 21014351 Number of splices: Annotated (sjdb) | 20536923 Number of splices: GT/AG | 20596916 Number of splices: GC/AG | 336163 Number of splices: AT/AC | 14110 Number of splices: Non-canonical | 67162 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 502896 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 79314 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.13% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 581931 581931 581931 N_multimapping 502896 502896 502896 N_noFeature 778784 20885712 868388 N_ambiguous 323205 1276 130444 UnstrandedReadsAssigned:20065367 PositiveStrandReadsAssigned:280368 NegativeStrandReadsAssigned:20168524 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690143 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690143-trimmed-pair1.fastq SRR12690143-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,252,183 reads, 20,145,760 reads pseudoaligned [quant] estimated average fragment length: 242.372 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 969 rounds 52401 SRR12690143.ke.tsv 34699 SRR12690143.se.tsv 87100 total ==> SRR12690143.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.63 751 17.9348 Potri.005G024800.1.v4.1 1035 793.628 172 9.19529 Potri.004G059700.1.v4.1 961 719.682 16 0.943264 Potri.007G009000.2.v4.1 1416 1174.63 0 0 Potri.003G141000.2.v4.1 2943 2701.63 852.43 13.3871 Potri.016G087400.1.v4.1 270 82.2639 890 459.023 Potri.015G069301.1.v4.1 564 330.151 0 0 Potri.010G195200.1.v4.1 1773 1531.63 22 0.609429 Potri.012G127500.1.v4.1 977 735.65 201 11.5925 ==> SRR12690143.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 621 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 287 Potri.001G212900.v4.1 14 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 10 SRR12690143 completed mapping pipeline successfully