Starting /dee2/code/volunteer_pipeline.sh SRR12690144 current disk space = 3057426022400 free memory = 1234106204 SRR12690144 SRAfilesize 4d408f0f9fe540a2ba467f32c048b27b SRR12690144.sra SRR12690144.sra file validated SRR12690144 is paired end SRR12690144 is conventional basespace SRR12690144 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690144_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5935 37.0 37.0 37.0 37.0 37.0 2 36.346 37.0 37.0 37.0 37.0 37.0 3 36.5345 37.0 37.0 37.0 37.0 37.0 4 36.48 37.0 37.0 37.0 37.0 37.0 5 36.629 37.0 37.0 37.0 37.0 37.0 6 36.6495 37.0 37.0 37.0 37.0 37.0 7 36.4715 37.0 37.0 37.0 37.0 37.0 8 36.577 37.0 37.0 37.0 37.0 37.0 9 36.5345 37.0 37.0 37.0 37.0 37.0 10-14 36.6011 37.0 37.0 37.0 37.0 37.0 15-19 36.59779999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.5742 37.0 37.0 37.0 37.0 37.0 25-29 36.5276 37.0 37.0 37.0 37.0 37.0 30-34 36.479299999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.4639 37.0 37.0 37.0 37.0 37.0 40-44 36.492200000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.4615 37.0 37.0 37.0 37.0 37.0 50-54 36.427200000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.3685 37.0 37.0 37.0 37.0 37.0 60-64 36.3939 37.0 37.0 37.0 37.0 37.0 65-69 36.380900000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.346999999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.3254 37.0 37.0 37.0 37.0 37.0 80-84 36.2724 37.0 37.0 37.0 37.0 37.0 85-89 36.270799999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.245799999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.2059 37.0 37.0 37.0 37.0 37.0 100-104 36.1627 37.0 37.0 37.0 37.0 37.0 105-109 36.1017 37.0 37.0 37.0 37.0 37.0 110-114 36.129599999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.1281 37.0 37.0 37.0 37.0 37.0 120-124 36.025400000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.957800000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.9691 37.0 37.0 37.0 37.0 37.0 135-139 35.9988 37.0 37.0 37.0 37.0 37.0 140-144 35.8096 37.0 37.0 37.0 37.0 37.0 145-149 35.7753 37.0 37.0 37.0 37.0 37.0 150-151 35.65975 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 0.0 26 4.0 27 4.0 28 7.0 29 17.0 30 18.0 31 44.0 32 57.0 33 63.0 34 107.0 35 341.0 36 3001.0 37 336.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.775 10.375 6.950000000000001 42.9 2 18.33249623304872 12.581617277749874 35.986941235560025 33.09894525364139 3 16.6 13.65 28.65 41.099999999999994 4 21.8 21.7 25.474999999999998 31.025000000000002 5 23.375 27.900000000000002 25.974999999999998 22.75 6 22.175 32.45 23.849999999999998 21.525 7 16.525000000000002 26.424999999999997 40.1 16.950000000000003 8 18.175 25.424999999999997 32.4 24.0 9 16.8 24.075 35.225 23.9 10-14 19.985 29.34 27.865000000000002 22.81 15-19 19.77 27.97 27.85 24.41 20-24 19.395 27.675 28.815 24.115000000000002 25-29 19.945 27.91 28.375 23.77 30-34 19.98 27.98 27.975 24.065 35-39 19.759999999999998 28.249999999999996 27.425 24.565 40-44 20.135 27.82 28.005000000000003 24.04 45-49 20.235 27.785 28.095 23.885 50-54 20.655 29.065 26.905 23.375 55-59 20.39 27.905 28.01 23.695 60-64 20.02 29.095 27.29 23.595 65-69 20.47 27.694999999999997 28.215 23.62 70-74 19.855 28.694999999999997 27.61 23.84 75-79 20.0 28.560000000000002 27.700000000000003 23.74 80-84 19.814999999999998 28.189999999999998 28.02 23.974999999999998 85-89 19.705000000000002 28.38 28.07 23.845 90-94 19.935 27.889999999999997 28.17 24.005000000000003 95-99 20.24 27.345000000000002 28.194999999999997 24.22 100-104 20.62 28.555000000000003 27.560000000000002 23.265 105-109 20.965 27.815 27.815 23.405 110-114 21.255 28.175 27.62 22.95 115-119 20.71 27.555000000000003 27.455000000000002 24.279999999999998 120-124 21.3 28.27 27.11 23.32 125-129 20.34 27.785 27.825 24.05 130-134 21.15 27.55 27.93 23.369999999999997 135-139 20.915 28.01 27.72 23.355 140-144 21.04 28.225 27.495000000000005 23.24 145-149 21.735 27.825 27.065 23.375 150-151 20.925 28.199999999999996 26.9125 23.962500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.0 23 1.0 24 5.0 25 7.5 26 4.5 27 2.0 28 6.0 29 12.5 30 18.0 31 22.0 32 32.0 33 41.5 34 50.5 35 61.5 36 77.0 37 102.5 38 127.5 39 148.0 40 170.0 41 199.0 42 223.0 43 256.5 44 265.0 45 261.5 46 272.5 47 276.0 48 251.0 49 222.0 50 205.5 51 153.5 52 111.0 53 93.0 54 73.0 55 57.0 56 54.0 57 42.5 58 24.5 59 24.0 60 19.0 61 9.0 62 5.5 63 4.0 64 3.5 65 2.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.44999999999999996 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.85 #Duplication Level Percentage of deduplicated Percentage of total 1 90.2615470228158 81.10000000000001 2 8.375069560378408 15.049999999999999 3 1.196438508625487 3.225 4 0.13912075681691707 0.5 5 0.02782415136338342 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGTGATTCTTCGCGTCTAACTCGTTGGTCTCCTGTGCTTGATCCCCCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.7875000000000001 0.0 0.0 0.0 0.0 108-109 0.8999999999999999 0.0 0.0 0.0 0.0 110-111 1.0875 0.0 0.0 0.0 0.0 112-113 1.1749999999999998 0.0 0.0 0.0 0.0 114-115 1.3 0.0 0.0 0.0 0.0 116-117 1.475 0.0 0.0 0.0 0.0 118-119 1.6125 0.0 0.0 0.0 0.0 120-121 1.8625 0.0 0.0 0.0 0.0 122-123 2.15 0.0 0.0 0.0 0.0 124-125 2.475 0.0 0.0 0.0 0.0 126-127 2.7 0.0 0.0 0.0 0.0 128-129 2.9625000000000004 0.0 0.0 0.0 0.0 130-131 3.4375 0.0 0.0 0.0 0.0 132-133 3.7375 0.0 0.0 0.0 0.0 134-135 4.1 0.0 0.0 0.0 0.0 136-137 4.55 0.0 0.0 0.0 0.0 138-139 4.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12690144 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690144_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.928 37.0 37.0 37.0 37.0 37.0 2 35.8635 37.0 37.0 37.0 37.0 37.0 3 35.8245 37.0 37.0 37.0 37.0 37.0 4 35.9795 37.0 37.0 37.0 37.0 37.0 5 36.0675 37.0 37.0 37.0 37.0 37.0 6 35.9125 37.0 37.0 37.0 37.0 37.0 7 36.0365 37.0 37.0 37.0 37.0 37.0 8 36.172 37.0 37.0 37.0 37.0 37.0 9 36.155 37.0 37.0 37.0 37.0 37.0 10-14 36.12050000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.0715 37.0 37.0 37.0 37.0 37.0 20-24 36.0928 37.0 37.0 37.0 37.0 37.0 25-29 36.0422 37.0 37.0 37.0 37.0 37.0 30-34 35.979600000000005 37.0 37.0 37.0 37.0 37.0 35-39 35.997 37.0 37.0 37.0 37.0 37.0 40-44 35.908699999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.962 37.0 37.0 37.0 37.0 37.0 50-54 35.870400000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.871 37.0 37.0 37.0 37.0 37.0 60-64 35.7768 37.0 37.0 37.0 37.0 37.0 65-69 35.795500000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.7025 37.0 37.0 37.0 37.0 37.0 75-79 35.7072 37.0 37.0 37.0 37.0 37.0 80-84 35.7489 37.0 37.0 37.0 37.0 37.0 85-89 35.644 37.0 37.0 37.0 37.0 37.0 90-94 35.6263 37.0 37.0 37.0 37.0 37.0 95-99 35.57170000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.6191 37.0 37.0 37.0 37.0 37.0 105-109 35.5915 37.0 37.0 37.0 37.0 37.0 110-114 35.45399999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.4836 37.0 37.0 37.0 37.0 37.0 120-124 35.3856 37.0 37.0 37.0 37.0 37.0 125-129 35.30749999999999 37.0 37.0 37.0 32.2 37.0 130-134 35.2586 37.0 37.0 37.0 29.8 37.0 135-139 35.214600000000004 37.0 37.0 37.0 27.4 37.0 140-144 35.1009 37.0 37.0 37.0 25.0 37.0 145-149 35.0908 37.0 37.0 37.0 27.4 37.0 150-151 34.61225 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 3.0 15 1.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 5.0 22 1.0 23 10.0 24 8.0 25 13.0 26 14.0 27 9.0 28 18.0 29 32.0 30 29.0 31 55.0 32 88.0 33 150.0 34 238.0 35 668.0 36 2478.0 37 177.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.8 24.025 11.05 29.125 2 26.55 29.099999999999998 28.475 15.875 3 20.65 28.975 30.875000000000004 19.5 4 22.525000000000002 35.0 24.325 18.15 5 24.474999999999998 36.775000000000006 21.3 17.45 6 20.65 39.475 23.275000000000002 16.6 7 20.575 22.25 37.45 19.725 8 20.9 26.325 28.775000000000002 24.0 9 20.724999999999998 24.9 31.674999999999997 22.7 10-14 22.455 29.535 26.655 21.355 15-19 22.755 28.595 27.474999999999998 21.175 20-24 22.185 28.810000000000002 27.615000000000002 21.39 25-29 22.975 28.294999999999998 27.61 21.12 30-34 22.735 28.59 27.525 21.15 35-39 22.305 28.38 28.084999999999997 21.23 40-44 22.81 28.01 27.744999999999997 21.435000000000002 45-49 22.175 28.475 27.91 21.44 50-54 22.865 28.77 27.04 21.325 55-59 22.509999999999998 28.235 27.92 21.335 60-64 22.055 28.435 27.889999999999997 21.62 65-69 22.11 27.889999999999997 28.01 21.990000000000002 70-74 23.25 28.044999999999998 27.26 21.445 75-79 22.725 27.725 27.88 21.67 80-84 22.66 28.685 27.725 20.93 85-89 22.509999999999998 28.075 27.32 22.095000000000002 90-94 22.439999999999998 27.63 28.325 21.605 95-99 23.055 27.455000000000002 28.050000000000004 21.44 100-104 23.535 27.47 27.82 21.175 105-109 23.0 27.375 28.470000000000002 21.154999999999998 110-114 23.095 28.49 27.505000000000003 20.91 115-119 23.565 28.425 27.37 20.64 120-124 23.200000000000003 28.084999999999997 28.22 20.495 125-129 23.305 28.134999999999998 27.534999999999997 21.025 130-134 24.349999999999998 28.4 26.845000000000002 20.405 135-139 24.445 27.98 27.235 20.34 140-144 24.63 27.915 27.05 20.405 145-149 25.235000000000003 27.785 27.095000000000002 19.885 150-151 24.7875 28.999999999999996 26.0375 20.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.5 4 1.5 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 1.0 21 1.5 22 2.0 23 2.5 24 2.0 25 4.5 26 8.0 27 9.5 28 12.5 29 12.5 30 15.0 31 20.5 32 32.0 33 45.5 34 53.0 35 62.5 36 85.5 37 113.0 38 139.0 39 169.0 40 194.5 41 227.0 42 248.0 43 263.0 44 275.5 45 263.0 46 252.5 47 260.0 48 226.0 49 184.0 50 168.5 51 124.5 52 98.0 53 93.0 54 76.0 55 58.0 56 50.5 57 41.0 58 29.5 59 21.5 60 13.0 61 11.5 62 7.0 63 3.0 64 2.0 65 0.5 66 0.0 67 0.0 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.5 94 0.5 95 0.0 96 0.0 97 0.5 98 1.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.925 #Duplication Level Percentage of deduplicated Percentage of total 1 90.26966916875175 81.175 2 8.45148735056992 15.2 3 1.1120378092855159 3.0 4 0.13900472616068948 0.5 5 0.027800945232137893 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAAAGATTCTAATGTGGCTAGCTTAGGAGACATAGAGGACCTCGTACACA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.48750000000000004 0.0 0.0 0.0 0.0 102-103 0.5375000000000001 0.0 0.0 0.0 0.0 104-105 0.65 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.8500000000000001 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.125 0.0 0.0 0.0 0.0 114-115 1.25 0.0 0.0 0.0 0.0 116-117 1.4249999999999998 0.0 0.0 0.0 0.0 118-119 1.5625 0.0 0.0 0.0 0.0 120-121 1.8125 0.0 0.0 0.0 0.0 122-123 2.1 0.0 0.0 0.0 0.0 124-125 2.425 0.0 0.0 0.0 0.0 126-127 2.6625 0.0 0.0 0.0 0.0 128-129 2.9375 0.0 0.0 0.0 0.0 130-131 3.4 0.0 0.0 0.0 0.0 132-133 3.7125 0.0 0.0 0.0 0.0 134-135 4.075 0.0 0.0 0.0 0.0 136-137 4.525 0.0 0.0 0.0 0.0 138-139 4.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTCTT 10 0.006830828 145.0 145 ATAATTC 10 0.006830828 145.0 2 >>END_MODULE Read 1087742 spots for SRR12690144.sra Written 1087742 spots for SRR12690144.sra Read 1087742 spots for SRR12690144.sra Written 1087742 spots for SRR12690144.sra Read 1087742 spots for SRR12690144.sra Written 1087742 spots for SRR12690144.sra Read 1087742 spots for SRR12690144.sra Written 1087742 spots for SRR12690144.sra Read 1087742 spots for SRR12690144.sra Written 1087742 spots for SRR12690144.sra Read 1087742 spots for SRR12690144.sra Written 1087742 spots for SRR12690144.sra Read 1087742 spots for SRR12690144.sra Written 1087742 spots for SRR12690144.sra Read 1087742 spots for SRR12690144.sra Written 1087742 spots for SRR12690144.sra Read 1087742 spots for SRR12690144.sra Written 1087742 spots for SRR12690144.sra Read 1087748 spots for SRR12690144.sra Written 1087748 spots for SRR12690144.sra Read 1087742 spots for SRR12690144.sra Written 1087742 spots for SRR12690144.sra Read 1087742 spots for SRR12690144.sra Written 1087742 spots for SRR12690144.sra Read 1087742 spots for SRR12690144.sra Written 1087742 spots for SRR12690144.sra Read 1087742 spots for SRR12690144.sra Written 1087742 spots for SRR12690144.sra Read 1087742 spots for SRR12690144.sra Written 1087742 spots for SRR12690144.sra Read 1087742 spots for SRR12690144.sra Written 1087742 spots for SRR12690144.sra Read 1087742 spots for SRR12690144.sra Written 1087742 spots for SRR12690144.sra Read 1087742 spots for SRR12690144.sra Written 1087742 spots for SRR12690144.sra Read 1087742 spots for SRR12690144.sra Written 1087742 spots for SRR12690144.sra Read 1087742 spots for SRR12690144.sra Written 1087742 spots for SRR12690144.sra SRR ids: ['SRR12690144.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_br_5xy1r SRR12690144.sra spots: 21754846 blocks: [[1, 1087742], [1087743, 2175484], [2175485, 3263226], [3263227, 4350968], [4350969, 5438710], [5438711, 6526452], [6526453, 7614194], [7614195, 8701936], [8701937, 9789678], [9789679, 10877420], [10877421, 11965162], [11965163, 13052904], [13052905, 14140646], [14140647, 15228388], [15228389, 16316130], [16316131, 17403872], [17403873, 18491614], [18491615, 19579356], [19579357, 20667098], [20667099, 21754846]] SRR12690144 file size 7371548 SRR12690144 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690144 SRR12690144_1.fastq SRR12690144_2.fastq Input file: SRR12690144_1.fastq Paired file: SRR12690144_2.fastq trimmed: SRR12690144-trimmed-pair1.fastq, SRR12690144-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:38:21 2025 >> started Mon Feb 10 18:38:45 2025 >> done (24.367s) 21754846 read pairs processed; of these: 36 ( 0.00%) short read pairs filtered out after trimming by size control 2569 ( 0.01%) empty read pairs filtered out after trimming by size control 21752241 (99.99%) read pairs available; of these: 1911254 ( 8.79%) trimmed read pairs available after processing 19840987 (91.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 11 0.00% 21 5 0.00% 22 4 0.00% 23 4 0.00% 24 8 0.00% 25 9 0.00% 26 13 0.00% 27 7 0.00% 28 13 0.00% 29 19 0.00% 30 21 0.00% 31 42 0.00% 32 17 0.00% 33 13 0.00% 34 23 0.00% 35 28 0.00% 36 19 0.00% 37 23 0.00% 38 25 0.00% 39 20 0.00% 40 28 0.00% 41 22 0.00% 42 37 0.00% 43 43 0.00% 44 40 0.00% 45 38 0.00% 46 67 0.00% 47 55 0.00% 48 50 0.00% 49 59 0.00% 50 97 0.00% 51 79 0.00% 52 84 0.00% 53 86 0.00% 54 115 0.00% 55 151 0.00% 56 123 0.00% 57 153 0.00% 58 183 0.00% 59 185 0.00% 60 245 0.00% 61 250 0.00% 62 305 0.00% 63 311 0.00% 64 368 0.00% 65 374 0.00% 66 400 0.00% 67 457 0.00% 68 579 0.00% 69 569 0.00% 70 643 0.00% 71 735 0.00% 72 933 0.00% 73 1001 0.00% 74 1172 0.01% 75 1261 0.01% 76 1404 0.01% 77 1611 0.01% 78 1804 0.01% 79 1898 0.01% 80 2200 0.01% 81 2465 0.01% 82 2631 0.01% 83 2901 0.01% 84 3287 0.02% 85 3725 0.02% 86 4005 0.02% 87 4330 0.02% 88 4820 0.02% 89 5088 0.02% 90 5465 0.03% 91 6005 0.03% 92 6393 0.03% 93 6947 0.03% 94 7565 0.03% 95 8108 0.04% 96 8867 0.04% 97 9435 0.04% 98 10002 0.05% 99 10554 0.05% 100 11013 0.05% 101 11690 0.05% 102 12471 0.06% 103 13133 0.06% 104 13800 0.06% 105 14836 0.07% 106 15511 0.07% 107 16198 0.07% 108 16782 0.08% 109 17634 0.08% 110 18494 0.09% 111 19528 0.09% 112 20456 0.09% 113 20755 0.10% 114 22021 0.10% 115 22854 0.11% 116 23826 0.11% 117 25030 0.12% 118 25843 0.12% 119 26922 0.12% 120 28132 0.13% 121 28818 0.13% 122 30108 0.14% 123 31137 0.14% 124 32064 0.15% 125 32860 0.15% 126 34679 0.16% 127 35522 0.16% 128 37280 0.17% 129 37699 0.17% 130 39290 0.18% 131 40490 0.19% 132 41369 0.19% 133 43253 0.20% 134 43928 0.20% 135 45021 0.21% 136 46278 0.21% 137 47317 0.22% 138 48725 0.22% 139 50442 0.23% 140 51230 0.24% 141 52470 0.24% 142 54479 0.25% 143 55165 0.25% 144 56796 0.26% 145 58165 0.27% 146 58965 0.27% 147 59230 0.27% 148 61459 0.28% 149 62365 0.29% 150 64581 0.30% 151 19840987 91.21% 21752241 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=20 prefix-density=0.39 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=12.61 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=5.6 sequence=ATTCTTCACTTCACGCTTTTGCAATCTGTGGAAGGACTGATTTTGTAGGAGATGGATACACCACACTTTGAAGGGAGGCCAGCAGCCACGCCATAGTTGATGCCAGAGATCTTACCAGCCAAGGATTTCAAACAGTTGCAGACCCCTTGGCGGTCGGCGGTGGTCGTGGCTGCAGAATTAAGTCCTTTCAACCCACTGCAGCAAGCTGCAGGCACAGCCCCACCCTTCTGGAGGTAGGTTATACATTGTGCCAAGCTGCTTGACACCTGGCCACATGAGATGGCAGCTTCTGCTAGTGGTGCACTAACAACCATCGCTACAAGCATGGCACAGGCCAGCTTCAAGCTCATTGAAGAAGCCATTATATGCTAGCAGAATATTACAACTGGAATTATAAGAAGATTTTAGAGTATGGTTTAAGACTACTGCCCT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=32 prefix-density=0.29 prefix-fanout=2.2 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=63.50 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=3.5 sequence=AAGGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR12690144 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:39:36 Started mapping on | Feb 10 18:39:37 Finished on | Feb 10 18:41:35 Mapping speed, Million of reads per hour | 663.63 Number of input reads | 21752241 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 20802884 Uniquely mapped reads % | 95.64% Average mapped length | 296.93 Number of splices: Total | 20225319 Number of splices: Annotated (sjdb) | 19632367 Number of splices: GT/AG | 19812401 Number of splices: GC/AG | 336625 Number of splices: AT/AC | 17442 Number of splices: Non-canonical | 58851 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.97 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 463933 % of reads mapped to multiple loci | 2.13% Number of reads mapped to too many loci | 67994 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.82% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 485424 485424 485424 N_multimapping 463933 463933 463933 N_noFeature 903072 20556331 990738 N_ambiguous 281182 1314 121549 UnstrandedReadsAssigned:19618630 PositiveStrandReadsAssigned:245239 NegativeStrandReadsAssigned:19690597 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690144 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690144-trimmed-pair1.fastq SRR12690144-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,752,241 reads, 19,729,053 reads pseudoaligned [quant] estimated average fragment length: 260.162 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 986 rounds 52401 SRR12690144.ke.tsv 34699 SRR12690144.se.tsv 87100 total ==> SRR12690144.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.84 653 18.2157 Potri.005G024800.1.v4.1 1035 775.838 335 21.1852 Potri.004G059700.1.v4.1 961 701.997 90 6.29023 Potri.007G009000.2.v4.1 1416 1156.84 0 0 Potri.003G141000.2.v4.1 2943 2683.84 852 15.5755 Potri.016G087400.1.v4.1 270 79.3699 1523.63 941.855 Potri.015G069301.1.v4.1 564 319.729 0 0 Potri.010G195200.1.v4.1 1773 1513.84 23 0.745432 Potri.012G127500.1.v4.1 977 717.93 350 23.9191 ==> SRR12690144.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 345 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 287 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 20 SRR12690144 completed mapping pipeline successfully