Starting /dee2/code/volunteer_pipeline.sh SRR12690145 current disk space = 3057452068864 free memory = 1081348812 SRR12690145 SRAfilesize 0b68dbaef7bba0e6592fabb88c24c037 SRR12690145.sra SRR12690145.sra file validated SRR12690145 is paired end SRR12690145 is conventional basespace SRR12690145 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690145_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.641 37.0 37.0 37.0 37.0 37.0 2 36.44 37.0 37.0 37.0 37.0 37.0 3 36.6515 37.0 37.0 37.0 37.0 37.0 4 36.624 37.0 37.0 37.0 37.0 37.0 5 36.714 37.0 37.0 37.0 37.0 37.0 6 36.6015 37.0 37.0 37.0 37.0 37.0 7 36.611 37.0 37.0 37.0 37.0 37.0 8 36.553 37.0 37.0 37.0 37.0 37.0 9 36.6215 37.0 37.0 37.0 37.0 37.0 10-14 36.593900000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.5363 37.0 37.0 37.0 37.0 37.0 20-24 36.6093 37.0 37.0 37.0 37.0 37.0 25-29 36.515699999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.5122 37.0 37.0 37.0 37.0 37.0 35-39 36.4853 37.0 37.0 37.0 37.0 37.0 40-44 36.4834 37.0 37.0 37.0 37.0 37.0 45-49 36.4487 37.0 37.0 37.0 37.0 37.0 50-54 36.4355 37.0 37.0 37.0 37.0 37.0 55-59 36.3747 37.0 37.0 37.0 37.0 37.0 60-64 36.4294 37.0 37.0 37.0 37.0 37.0 65-69 36.3557 37.0 37.0 37.0 37.0 37.0 70-74 36.357099999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.3146 37.0 37.0 37.0 37.0 37.0 80-84 36.217 37.0 37.0 37.0 37.0 37.0 85-89 36.26520000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.250600000000006 37.0 37.0 37.0 37.0 37.0 95-99 36.2482 37.0 37.0 37.0 37.0 37.0 100-104 36.188500000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.1644 37.0 37.0 37.0 37.0 37.0 110-114 36.1766 37.0 37.0 37.0 37.0 37.0 115-119 36.137 37.0 37.0 37.0 37.0 37.0 120-124 36.066700000000004 37.0 37.0 37.0 37.0 37.0 125-129 36.048899999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.9669 37.0 37.0 37.0 37.0 37.0 135-139 35.9513 37.0 37.0 37.0 37.0 37.0 140-144 35.76 37.0 37.0 37.0 37.0 37.0 145-149 35.767700000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.593 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 0.0 22 0.0 23 3.0 24 1.0 25 2.0 26 3.0 27 8.0 28 12.0 29 13.0 30 17.0 31 29.0 32 54.0 33 59.0 34 115.0 35 312.0 36 3023.0 37 347.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.875 9.8 8.475000000000001 44.85 2 18.097389558232933 13.328313253012048 37.424698795180724 31.149598393574294 3 17.150000000000002 15.25 26.650000000000002 40.949999999999996 4 20.7 24.7 24.3 30.3 5 22.425 29.9 25.1 22.575 6 20.625 33.875 24.425 21.075 7 16.525000000000002 27.500000000000004 39.1 16.875 8 18.25 25.974999999999998 33.4 22.375 9 18.125 24.8 34.025 23.05 10-14 19.535 29.815 27.935 22.715 15-19 19.62 28.375 27.88 24.125 20-24 19.74 28.499999999999996 28.32 23.44 25-29 19.765 28.915000000000003 27.22 24.099999999999998 30-34 19.925 28.294999999999998 28.1 23.68 35-39 19.845 28.384999999999998 27.49 24.279999999999998 40-44 20.200000000000003 28.365000000000002 27.72 23.715 45-49 20.51 28.065 28.060000000000002 23.365 50-54 20.19 27.694999999999997 28.249999999999996 23.865 55-59 20.044999999999998 28.405 27.834999999999997 23.715 60-64 20.14 28.215 27.82 23.825 65-69 20.39 27.845 28.455000000000002 23.31 70-74 20.745 28.7 26.834999999999997 23.72 75-79 20.345 28.1 27.455000000000002 24.099999999999998 80-84 20.369999999999997 28.63 27.38 23.62 85-89 21.535 28.000000000000004 27.405 23.06 90-94 20.54 27.73 28.235 23.494999999999997 95-99 21.044999999999998 27.950000000000003 27.35 23.655 100-104 21.01 28.084999999999997 27.55 23.355 105-109 21.015 27.98 27.224999999999998 23.78 110-114 20.580000000000002 28.58 27.529999999999998 23.31 115-119 21.15 28.205000000000002 27.500000000000004 23.145 120-124 20.945 28.615000000000002 27.115000000000002 23.325000000000003 125-129 20.915 27.775 27.834999999999997 23.474999999999998 130-134 20.560000000000002 27.79 27.43 24.22 135-139 21.66 28.43 26.755000000000003 23.155 140-144 21.325 28.025 26.645000000000003 24.005000000000003 145-149 21.54 28.515 26.565 23.380000000000003 150-151 20.9125 29.025000000000002 26.8 23.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 1.0 14 1.5 15 1.0 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.5 25 1.5 26 1.5 27 6.0 28 8.0 29 6.5 30 16.5 31 27.5 32 28.5 33 33.0 34 52.0 35 76.0 36 96.5 37 110.5 38 122.5 39 156.0 40 188.5 41 211.5 42 236.5 43 250.0 44 256.5 45 258.0 46 261.5 47 259.0 48 230.5 49 200.0 50 176.0 51 154.0 52 142.0 53 113.0 54 75.0 55 57.0 56 43.5 57 35.0 58 32.0 59 20.5 60 13.5 61 10.0 62 10.0 63 8.0 64 2.5 65 1.5 66 0.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 91.49286498353457 83.35000000000001 2 7.409440175631174 13.5 3 0.960482985729967 2.625 4 0.10976948408342481 0.4 5 0.027442371020856202 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCTTTCAACCCACTGCAGCAAGCTGCAGGCACAGCCCCACCCTTCTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.9 0.0 0.0 0.0 0.0 100-101 1.0499999999999998 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.4249999999999998 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 2.0 0.0 0.0 0.0 0.0 110-111 2.2625 0.0 0.0 0.0 0.0 112-113 2.45 0.0 0.0 0.0 0.0 114-115 2.6500000000000004 0.0 0.0 0.0 0.0 116-117 3.0875 0.0 0.0 0.0 0.0 118-119 3.3625 0.0 0.0 0.0 0.0 120-121 3.7125000000000004 0.0 0.0 0.0 0.0 122-123 3.9875 0.0 0.0 0.0 0.0 124-125 4.4125 0.0 0.0 0.0 0.0 126-127 4.9875 0.0 0.0 0.0 0.0 128-129 5.375 0.0 0.0 0.0 0.0 130-131 6.025 0.0 0.0 0.0 0.0 132-133 6.4375 0.0 0.0 0.0 0.0 134-135 6.825 0.0 0.0 0.0 0.0 136-137 7.3875 0.0 0.0 0.0 0.0 138-139 7.925000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGATT 10 0.006830828 145.0 145 CGACAAT 10 0.006830828 145.0 8 TCGACAA 10 0.006830828 145.0 7 TTCGACA 10 0.006830828 145.0 6 CTTTCGA 10 0.006830828 145.0 4 >>END_MODULE SRR12690145 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690145_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2395 37.0 37.0 37.0 37.0 37.0 2 36.009 37.0 37.0 37.0 37.0 37.0 3 36.1275 37.0 37.0 37.0 37.0 37.0 4 36.159 37.0 37.0 37.0 37.0 37.0 5 36.313 37.0 37.0 37.0 37.0 37.0 6 36.3255 37.0 37.0 37.0 37.0 37.0 7 36.296 37.0 37.0 37.0 37.0 37.0 8 36.3455 37.0 37.0 37.0 37.0 37.0 9 36.156 37.0 37.0 37.0 37.0 37.0 10-14 36.216 37.0 37.0 37.0 37.0 37.0 15-19 36.24400000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.222500000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.143899999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.1192 37.0 37.0 37.0 37.0 37.0 35-39 36.1079 37.0 37.0 37.0 37.0 37.0 40-44 36.022400000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.107000000000006 37.0 37.0 37.0 37.0 37.0 50-54 35.9524 37.0 37.0 37.0 37.0 37.0 55-59 36.0223 37.0 37.0 37.0 37.0 37.0 60-64 35.951 37.0 37.0 37.0 37.0 37.0 65-69 35.8817 37.0 37.0 37.0 37.0 37.0 70-74 35.821600000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.8557 37.0 37.0 37.0 37.0 37.0 80-84 35.868399999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.856399999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.7185 37.0 37.0 37.0 37.0 37.0 95-99 35.721199999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.7928 37.0 37.0 37.0 37.0 37.0 105-109 35.7975 37.0 37.0 37.0 37.0 37.0 110-114 35.7016 37.0 37.0 37.0 37.0 37.0 115-119 35.6056 37.0 37.0 37.0 37.0 37.0 120-124 35.5413 37.0 37.0 37.0 37.0 37.0 125-129 35.460300000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.451 37.0 37.0 37.0 37.0 37.0 135-139 35.3275 37.0 37.0 37.0 37.0 37.0 140-144 35.2965 37.0 37.0 37.0 32.2 37.0 145-149 35.14019999999999 37.0 37.0 37.0 29.8 37.0 150-151 34.56525 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 3.0 15 2.0 16 1.0 17 0.0 18 1.0 19 0.0 20 3.0 21 2.0 22 4.0 23 3.0 24 4.0 25 4.0 26 8.0 27 11.0 28 21.0 29 31.0 30 32.0 31 32.0 32 63.0 33 113.0 34 208.0 35 653.0 36 2562.0 37 235.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.4 23.400000000000002 13.0 30.2 2 26.325 27.900000000000002 29.799999999999997 15.975 3 20.075000000000003 28.675 30.65 20.599999999999998 4 23.200000000000003 32.925 24.8 19.075 5 24.975 36.35 23.1 15.575 6 21.15 37.85 22.125 18.875 7 21.075 22.3 37.824999999999996 18.8 8 21.175 26.400000000000002 28.825 23.599999999999998 9 21.349999999999998 24.65 30.45 23.549999999999997 10-14 22.165000000000003 29.25 26.450000000000003 22.134999999999998 15-19 22.905 28.599999999999998 27.46 21.035 20-24 22.735 28.98 27.415 20.87 25-29 22.720000000000002 28.810000000000002 27.644999999999996 20.825 30-34 22.650000000000002 27.82 28.110000000000003 21.42 35-39 22.575 27.985 27.935 21.505 40-44 22.900000000000002 27.88 28.384999999999998 20.835 45-49 22.725 27.005000000000003 28.685 21.584999999999997 50-54 22.3 27.88 28.494999999999997 21.325 55-59 23.150000000000002 27.83 27.650000000000002 21.37 60-64 22.925 28.1 27.76 21.215 65-69 23.025000000000002 27.515 27.97 21.490000000000002 70-74 22.855 26.775 28.83 21.54 75-79 22.42 27.725 28.18 21.675 80-84 23.525 28.075 27.55 20.849999999999998 85-89 23.085 28.115000000000002 27.650000000000002 21.15 90-94 23.16 27.865000000000002 27.71 21.265 95-99 23.599999999999998 28.38 27.77 20.25 100-104 23.425 28.425 27.05 21.099999999999998 105-109 23.465 27.6 28.005000000000003 20.93 110-114 23.955000000000002 28.63 27.025 20.39 115-119 24.115000000000002 27.93 27.389999999999997 20.565 120-124 24.474999999999998 27.24 27.565 20.72 125-129 24.66 27.525 27.015 20.8 130-134 24.795 27.935 26.784999999999997 20.485 135-139 24.4 27.884999999999998 26.71 21.005 140-144 24.855 27.965 26.47 20.71 145-149 25.419999999999998 28.175 26.02 20.385 150-151 24.775 27.6875 26.337500000000002 21.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 1.5 16 0.5 17 0.5 18 1.5 19 1.0 20 0.5 21 0.5 22 0.0 23 1.5 24 5.0 25 7.0 26 6.0 27 4.0 28 5.0 29 9.0 30 10.0 31 16.0 32 27.5 33 37.5 34 53.5 35 69.5 36 77.5 37 111.0 38 140.5 39 169.0 40 217.5 41 233.0 42 251.5 43 282.5 44 265.0 45 274.0 46 288.0 47 251.5 48 214.0 49 184.0 50 159.0 51 123.0 52 91.0 53 83.5 54 87.5 55 61.5 56 37.5 57 32.0 58 24.5 59 22.0 60 15.0 61 7.5 62 7.5 63 6.0 64 4.0 65 2.5 66 0.5 67 0.0 68 0.5 69 2.0 70 2.5 71 1.0 72 0.0 73 0.0 74 1.0 75 1.0 76 0.5 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.05 #Duplication Level Percentage of deduplicated Percentage of total 1 91.46073585941791 83.275 2 7.358594179022515 13.4 3 1.070840197693575 2.9250000000000003 4 0.10982976386600769 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.9 0.0 0.0 0.0 0.0 100-101 1.0499999999999998 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.4500000000000002 0.0 0.0 0.0 0.0 106-107 1.6749999999999998 0.0 0.0 0.0 0.0 108-109 2.025 0.0 0.0 0.0 0.0 110-111 2.2875 0.0 0.0 0.0 0.0 112-113 2.4625 0.0 0.0 0.0 0.0 114-115 2.675 0.0 0.0 0.0 0.0 116-117 3.1125 0.0 0.0 0.0 0.0 118-119 3.4375 0.0 0.0 0.0 0.0 120-121 3.7874999999999996 0.0 0.0 0.0 0.0 122-123 4.0375 0.0 0.0 0.0 0.0 124-125 4.475 0.0 0.0 0.0 0.0 126-127 5.0625 0.0 0.0 0.0 0.0 128-129 5.4375 0.0 0.0 0.0 0.0 130-131 6.074999999999999 0.0 0.0 0.0 0.0 132-133 6.4875 0.0 0.0 0.0 0.0 134-135 6.875 0.0 0.0 0.0 0.0 136-137 7.425 0.0 0.0 0.0 0.0 138-139 7.9624999999999995 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCACTA 10 0.006830828 145.0 9 ACAAAGT 10 0.006830828 145.0 145 GATTCAC 10 0.006830828 145.0 7 TAGGGAT 10 0.006830828 145.0 3 ATTCACT 10 0.006830828 145.0 8 GGGGGGG 95 5.161005E-4 12.210526 140-144 >>END_MODULE Read 1003209 spots for SRR12690145.sra Written 1003209 spots for SRR12690145.sra Read 1003209 spots for SRR12690145.sra Written 1003209 spots for SRR12690145.sra Read 1003209 spots for SRR12690145.sra Written 1003209 spots for SRR12690145.sra Read 1003209 spots for SRR12690145.sra Written 1003209 spots for SRR12690145.sra Read 1003209 spots for SRR12690145.sra Written 1003209 spots for SRR12690145.sra Read 1003209 spots for SRR12690145.sra Written 1003209 spots for SRR12690145.sra Read 1003209 spots for SRR12690145.sra Written 1003209 spots for SRR12690145.sra Read 1003209 spots for SRR12690145.sra Written 1003209 spots for SRR12690145.sra Read 1003209 spots for SRR12690145.sra Written 1003209 spots for SRR12690145.sra Read 1003209 spots for SRR12690145.sra Written 1003209 spots for SRR12690145.sra Read 1003209 spots for SRR12690145.sra Written 1003209 spots for SRR12690145.sra Read 1003209 spots for SRR12690145.sra Written 1003209 spots for SRR12690145.sra Read 1003209 spots for SRR12690145.sra Written 1003209 spots for SRR12690145.sra Read 1003221 spots for SRR12690145.sra Written 1003221 spots for SRR12690145.sra Read 1003209 spots for SRR12690145.sra Written 1003209 spots for SRR12690145.sra Read 1003209 spots for SRR12690145.sra Written 1003209 spots for SRR12690145.sra Read 1003209 spots for SRR12690145.sra Written 1003209 spots for SRR12690145.sra Read 1003209 spots for SRR12690145.sra Written 1003209 spots for SRR12690145.sra Read 1003209 spots for SRR12690145.sra Written 1003209 spots for SRR12690145.sra Read 1003209 spots for SRR12690145.sra Written 1003209 spots for SRR12690145.sra SRR ids: ['SRR12690145.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_damfyicq SRR12690145.sra spots: 20064192 blocks: [[1, 1003209], [1003210, 2006418], [2006419, 3009627], [3009628, 4012836], [4012837, 5016045], [5016046, 6019254], [6019255, 7022463], [7022464, 8025672], [8025673, 9028881], [9028882, 10032090], [10032091, 11035299], [11035300, 12038508], [12038509, 13041717], [13041718, 14044926], [14044927, 15048135], [15048136, 16051344], [16051345, 17054553], [17054554, 18057762], [18057763, 19060971], [19060972, 20064192]] SRR12690145 file size 6796989 SRR12690145 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690145 SRR12690145_1.fastq SRR12690145_2.fastq Input file: SRR12690145_1.fastq Paired file: SRR12690145_2.fastq trimmed: SRR12690145-trimmed-pair1.fastq, SRR12690145-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:36:45 2025 >> started Mon Feb 10 18:37:16 2025 >> done (31.265s) 20064192 read pairs processed; of these: 29 ( 0.00%) short read pairs filtered out after trimming by size control 3135 ( 0.02%) empty read pairs filtered out after trimming by size control 20061028 (99.98%) read pairs available; of these: 2616288 (13.04%) trimmed read pairs available after processing 17444740 (86.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 6 0.00% 21 4 0.00% 22 3 0.00% 23 12 0.00% 24 9 0.00% 25 10 0.00% 26 11 0.00% 27 15 0.00% 28 10 0.00% 29 17 0.00% 30 21 0.00% 31 16 0.00% 32 15 0.00% 33 26 0.00% 34 22 0.00% 35 30 0.00% 36 34 0.00% 37 32 0.00% 38 42 0.00% 39 43 0.00% 40 25 0.00% 41 38 0.00% 42 43 0.00% 43 56 0.00% 44 50 0.00% 45 55 0.00% 46 44 0.00% 47 79 0.00% 48 63 0.00% 49 86 0.00% 50 116 0.00% 51 117 0.00% 52 134 0.00% 53 151 0.00% 54 151 0.00% 55 184 0.00% 56 181 0.00% 57 200 0.00% 58 249 0.00% 59 244 0.00% 60 336 0.00% 61 339 0.00% 62 429 0.00% 63 479 0.00% 64 557 0.00% 65 586 0.00% 66 667 0.00% 67 738 0.00% 68 767 0.00% 69 955 0.00% 70 1032 0.01% 71 1217 0.01% 72 1354 0.01% 73 1545 0.01% 74 1831 0.01% 75 2077 0.01% 76 2305 0.01% 77 2409 0.01% 78 2744 0.01% 79 3150 0.02% 80 3538 0.02% 81 3889 0.02% 82 4385 0.02% 83 4807 0.02% 84 5329 0.03% 85 5895 0.03% 86 6492 0.03% 87 7278 0.04% 88 7822 0.04% 89 8305 0.04% 90 9066 0.05% 91 10216 0.05% 92 10664 0.05% 93 11783 0.06% 94 12768 0.06% 95 13675 0.07% 96 14912 0.07% 97 15602 0.08% 98 16643 0.08% 99 17355 0.09% 100 18237 0.09% 101 19436 0.10% 102 20503 0.10% 103 21529 0.11% 104 21820 0.11% 105 24062 0.12% 106 25069 0.12% 107 25697 0.13% 108 27131 0.14% 109 28724 0.14% 110 29418 0.15% 111 30077 0.15% 112 31928 0.16% 113 32375 0.16% 114 33757 0.17% 115 35299 0.18% 116 36463 0.18% 117 37868 0.19% 118 39017 0.19% 119 40037 0.20% 120 41624 0.21% 121 43261 0.22% 122 43924 0.22% 123 45340 0.23% 124 46129 0.23% 125 47368 0.24% 126 49146 0.24% 127 50264 0.25% 128 51259 0.26% 129 52066 0.26% 130 54172 0.27% 131 54087 0.27% 132 56137 0.28% 133 57275 0.29% 134 57209 0.29% 135 58411 0.29% 136 59875 0.30% 137 60839 0.30% 138 61557 0.31% 139 63679 0.32% 140 64180 0.32% 141 65760 0.33% 142 67087 0.33% 143 67742 0.34% 144 68732 0.34% 145 69998 0.35% 146 70727 0.35% 147 70848 0.35% 148 72784 0.36% 149 73276 0.37% 150 74497 0.37% 151 17444740 86.96% 20061028 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=9 prefix-density=0.55 prefix-fanout=2.3 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=25 fanout-score=13.08 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=3.8 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=23 prefix-density=0.70 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=24.78 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.1 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGT SRR12690145 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:38:00 Started mapping on | Feb 10 18:38:00 Finished on | Feb 10 18:40:17 Mapping speed, Million of reads per hour | 527.15 Number of input reads | 20061028 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 19077067 Uniquely mapped reads % | 95.10% Average mapped length | 294.69 Number of splices: Total | 18506475 Number of splices: Annotated (sjdb) | 18058825 Number of splices: GT/AG | 18119951 Number of splices: GC/AG | 319680 Number of splices: AT/AC | 16485 Number of splices: Non-canonical | 50359 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.96 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 502310 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 97938 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.77% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 481651 481651 481651 N_multimapping 502310 502310 502310 N_noFeature 718995 18863028 795489 N_ambiguous 245966 1114 107809 UnstrandedReadsAssigned:18112106 PositiveStrandReadsAssigned:212925 NegativeStrandReadsAssigned:18173769 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690145 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690145-trimmed-pair1.fastq SRR12690145-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,061,028 reads, 18,297,967 reads pseudoaligned [quant] estimated average fragment length: 243.087 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,022 rounds 52401 SRR12690145.ke.tsv 34699 SRR12690145.se.tsv 87100 total ==> SRR12690145.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.91 493 15.1352 Potri.005G024800.1.v4.1 1035 792.913 207 14.2333 Potri.004G059700.1.v4.1 961 719.078 95 7.20293 Potri.007G009000.2.v4.1 1416 1173.91 0 0 Potri.003G141000.2.v4.1 2943 2700.91 666 13.4439 Potri.016G087400.1.v4.1 270 86.8689 1180 740.593 Potri.015G069301.1.v4.1 564 333.295 0 0 Potri.010G195200.1.v4.1 1773 1530.91 13 0.462972 Potri.012G127500.1.v4.1 977 734.98 967 71.732 ==> SRR12690145.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 133 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 265 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 38 SRR12690145 completed mapping pipeline successfully