Starting /dee2/code/volunteer_pipeline.sh SRR12690146 current disk space = 3057282195456 free memory = 1418146320 SRR12690146 SRAfilesize dbdc2263e82acebf51b0a3c8adbc8aa2 SRR12690146.sra SRR12690146.sra file validated SRR12690146 is paired end SRR12690146 is conventional basespace SRR12690146 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690146_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6675 37.0 37.0 37.0 37.0 37.0 2 36.4 37.0 37.0 37.0 37.0 37.0 3 36.5495 37.0 37.0 37.0 37.0 37.0 4 36.6175 37.0 37.0 37.0 37.0 37.0 5 36.652 37.0 37.0 37.0 37.0 37.0 6 36.662 37.0 37.0 37.0 37.0 37.0 7 36.625 37.0 37.0 37.0 37.0 37.0 8 36.6365 37.0 37.0 37.0 37.0 37.0 9 36.5825 37.0 37.0 37.0 37.0 37.0 10-14 36.634699999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.614999999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.631299999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.5655 37.0 37.0 37.0 37.0 37.0 30-34 36.5441 37.0 37.0 37.0 37.0 37.0 35-39 36.525 37.0 37.0 37.0 37.0 37.0 40-44 36.508500000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.4709 37.0 37.0 37.0 37.0 37.0 50-54 36.480599999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.4434 37.0 37.0 37.0 37.0 37.0 60-64 36.4293 37.0 37.0 37.0 37.0 37.0 65-69 36.3829 37.0 37.0 37.0 37.0 37.0 70-74 36.3915 37.0 37.0 37.0 37.0 37.0 75-79 36.4175 37.0 37.0 37.0 37.0 37.0 80-84 36.299400000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.3557 37.0 37.0 37.0 37.0 37.0 90-94 36.3161 37.0 37.0 37.0 37.0 37.0 95-99 36.2619 37.0 37.0 37.0 37.0 37.0 100-104 36.2035 37.0 37.0 37.0 37.0 37.0 105-109 36.2107 37.0 37.0 37.0 37.0 37.0 110-114 36.2293 37.0 37.0 37.0 37.0 37.0 115-119 36.169399999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.139599999999994 37.0 37.0 37.0 37.0 37.0 125-129 36.099900000000005 37.0 37.0 37.0 37.0 37.0 130-134 36.062 37.0 37.0 37.0 37.0 37.0 135-139 36.0987 37.0 37.0 37.0 37.0 37.0 140-144 35.871900000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.866 37.0 37.0 37.0 37.0 37.0 150-151 35.646 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 1.0 25 4.0 26 5.0 27 3.0 28 7.0 29 12.0 30 16.0 31 29.0 32 51.0 33 61.0 34 89.0 35 280.0 36 3077.0 37 364.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.25 11.625 7.000000000000001 38.125 2 19.68405215646941 12.38716148445336 35.63189568706118 32.29689067201605 3 17.675 14.85 28.050000000000004 39.425 4 22.05 22.7 24.099999999999998 31.15 5 22.925 29.9 24.15 23.025000000000002 6 21.775 33.375 23.925 20.925 7 18.025 26.424999999999997 38.525 17.025000000000002 8 19.05 27.6 30.25 23.1 9 17.224999999999998 25.724999999999998 33.4 23.65 10-14 20.36 29.865000000000002 27.37 22.405 15-19 20.4 27.655 27.375 24.57 20-24 20.64 27.965 27.855 23.54 25-29 20.4 28.96 27.38 23.26 30-34 20.225 28.65 27.07 24.055 35-39 20.44 28.15 27.060000000000002 24.349999999999998 40-44 20.53 28.499999999999996 27.27 23.7 45-49 20.765 28.110000000000003 27.32 23.805 50-54 20.724999999999998 27.715 27.43 24.13 55-59 20.580000000000002 27.42 27.925 24.075 60-64 20.825 27.73 27.155 24.29 65-69 21.015 27.445000000000004 27.644999999999996 23.895 70-74 21.15 28.005000000000003 26.97 23.875 75-79 20.705000000000002 27.985 27.389999999999997 23.919999999999998 80-84 21.055 27.595 27.71 23.64 85-89 21.529999999999998 28.244999999999997 26.415 23.810000000000002 90-94 20.485 27.865000000000002 27.465 24.185000000000002 95-99 20.7 28.444999999999997 27.08 23.775 100-104 21.505 27.415 26.924999999999997 24.154999999999998 105-109 21.560000000000002 27.810000000000002 26.97 23.66 110-114 20.985 27.325 27.88 23.810000000000002 115-119 21.29 27.68 27.35 23.68 120-124 21.265 27.794999999999998 26.834999999999997 24.104999999999997 125-129 21.13 27.685 27.275 23.91 130-134 21.695 27.855 26.83 23.62 135-139 21.205 27.115000000000002 27.250000000000004 24.43 140-144 21.335 27.229999999999997 26.810000000000002 24.625 145-149 21.65 27.589999999999996 26.534999999999997 24.224999999999998 150-151 21.349999999999998 28.8375 25.75 24.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 6.0 27 8.5 28 7.5 29 9.0 30 11.0 31 16.0 32 22.0 33 34.5 34 41.0 35 57.0 36 76.5 37 86.5 38 105.5 39 135.5 40 168.0 41 194.5 42 210.0 43 230.0 44 269.0 45 272.5 46 261.0 47 283.5 48 263.0 49 224.5 50 210.5 51 170.0 52 127.0 53 112.0 54 97.0 55 71.5 56 57.0 57 48.0 58 34.0 59 24.5 60 24.0 61 12.5 62 4.0 63 2.5 64 0.5 65 2.5 66 2.0 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.85 #Duplication Level Percentage of deduplicated Percentage of total 1 91.99782253674469 84.5 2 7.2672836145890045 13.350000000000001 3 0.5988023952095809 1.6500000000000001 4 0.1360914534567229 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.9125000000000001 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.375 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.7125 0.0 0.0 0.0 0.0 110-111 1.925 0.0 0.0 0.0 0.0 112-113 2.1875 0.0 0.0 0.0 0.0 114-115 2.4 0.0 0.0 0.0 0.0 116-117 2.6 0.0 0.0 0.0 0.0 118-119 3.0125 0.0 0.0 0.0 0.0 120-121 3.3 0.0 0.0 0.0 0.0 122-123 3.625 0.0 0.0 0.0 0.0 124-125 4.175000000000001 0.0 0.0 0.0 0.0 126-127 4.5 0.0 0.0 0.0 0.0 128-129 4.9 0.0 0.0 0.0 0.0 130-131 5.2375 0.0 0.0 0.0 0.0 132-133 5.7 0.0 0.0 0.0 0.0 134-135 6.2875 0.0 0.0 0.0 0.0 136-137 6.6625 0.0 0.0 0.0 0.0 138-139 7.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTTGG 10 0.006830828 145.0 4 ATTTGGC 10 0.006830828 145.0 5 CATAACA 10 0.006830828 145.0 7 >>END_MODULE SRR12690146 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690146_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.528 37.0 37.0 37.0 37.0 37.0 2 36.306 37.0 37.0 37.0 37.0 37.0 3 36.2375 37.0 37.0 37.0 37.0 37.0 4 36.3595 37.0 37.0 37.0 37.0 37.0 5 36.44 37.0 37.0 37.0 37.0 37.0 6 36.364 37.0 37.0 37.0 37.0 37.0 7 36.5405 37.0 37.0 37.0 37.0 37.0 8 36.528 37.0 37.0 37.0 37.0 37.0 9 36.5235 37.0 37.0 37.0 37.0 37.0 10-14 36.502 37.0 37.0 37.0 37.0 37.0 15-19 36.4516 37.0 37.0 37.0 37.0 37.0 20-24 36.4566 37.0 37.0 37.0 37.0 37.0 25-29 36.3752 37.0 37.0 37.0 37.0 37.0 30-34 36.3535 37.0 37.0 37.0 37.0 37.0 35-39 36.3594 37.0 37.0 37.0 37.0 37.0 40-44 36.32809999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.34589999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.310900000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.3313 37.0 37.0 37.0 37.0 37.0 60-64 36.283500000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.257999999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.1717 37.0 37.0 37.0 37.0 37.0 75-79 36.2182 37.0 37.0 37.0 37.0 37.0 80-84 36.1887 37.0 37.0 37.0 37.0 37.0 85-89 36.128499999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.030199999999994 37.0 37.0 37.0 37.0 37.0 95-99 36.0963 37.0 37.0 37.0 37.0 37.0 100-104 36.138099999999994 37.0 37.0 37.0 37.0 37.0 105-109 36.12519999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.0578 37.0 37.0 37.0 37.0 37.0 115-119 36.006299999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.9418 37.0 37.0 37.0 37.0 37.0 125-129 35.9196 37.0 37.0 37.0 37.0 37.0 130-134 35.735699999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.7506 37.0 37.0 37.0 37.0 37.0 140-144 35.6631 37.0 37.0 37.0 37.0 37.0 145-149 35.5201 37.0 37.0 37.0 37.0 37.0 150-151 34.93275 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 3.0 15 0.0 16 0.0 17 1.0 18 1.0 19 1.0 20 3.0 21 1.0 22 2.0 23 4.0 24 2.0 25 0.0 26 4.0 27 9.0 28 9.0 29 12.0 30 16.0 31 27.0 32 48.0 33 83.0 34 157.0 35 412.0 36 2851.0 37 353.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.575 26.575 10.45 26.400000000000002 2 26.8 28.7 28.275 16.225 3 20.8 28.675 30.7 19.825 4 23.25 34.849999999999994 22.825 19.075 5 24.875 38.3 20.45 16.375 6 20.724999999999998 40.075 21.025 18.175 7 22.625 22.2 36.075 19.1 8 20.625 25.924999999999997 28.325 25.124999999999996 9 22.7 26.075 29.275000000000002 21.95 10-14 23.185 29.825000000000003 25.545 21.445 15-19 23.435 28.794999999999998 26.845000000000002 20.925 20-24 22.96 28.765 26.534999999999997 21.740000000000002 25-29 22.97 28.58 27.005000000000003 21.445 30-34 22.830000000000002 28.125 27.725 21.32 35-39 23.06 28.525 26.724999999999998 21.69 40-44 22.935 28.03 26.805 22.23 45-49 23.22 27.529999999999998 27.42 21.83 50-54 22.785 28.04 27.295 21.88 55-59 22.535 27.26 27.675 22.53 60-64 23.14 27.400000000000002 27.77 21.69 65-69 23.01 27.334999999999997 27.735 21.92 70-74 23.49 27.775 27.13 21.605 75-79 23.075000000000003 28.165000000000003 26.939999999999998 21.82 80-84 23.09 28.17 27.125 21.615000000000002 85-89 23.435 27.3 27.339999999999996 21.925 90-94 23.79 27.805000000000003 26.965 21.44 95-99 22.994999999999997 27.71 27.55 21.745 100-104 23.93 27.075 27.055 21.94 105-109 23.46 27.639999999999997 27.51 21.39 110-114 23.535 27.450000000000003 27.79 21.224999999999998 115-119 23.919999999999998 27.700000000000003 27.02 21.36 120-124 24.595 27.495000000000005 26.56 21.349999999999998 125-129 24.41 27.125 27.265 21.2 130-134 24.065 28.144999999999996 26.545 21.245 135-139 24.665 27.284999999999997 27.075 20.974999999999998 140-144 25.009999999999998 26.900000000000002 27.200000000000003 20.89 145-149 26.015 26.655 26.955000000000002 20.375 150-151 26.187500000000004 27.237499999999997 26.5875 19.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.0 21 1.0 22 1.5 23 1.0 24 1.0 25 2.0 26 5.5 27 7.0 28 5.0 29 4.5 30 10.5 31 17.5 32 19.5 33 25.0 34 35.5 35 57.0 36 75.0 37 95.5 38 111.0 39 139.0 40 185.0 41 201.0 42 236.0 43 274.0 44 274.5 45 277.0 46 279.5 47 264.5 48 237.5 49 218.5 50 198.5 51 165.0 52 124.0 53 93.0 54 81.0 55 71.5 56 53.0 57 38.0 58 31.5 59 26.0 60 17.5 61 10.0 62 8.5 63 5.0 64 2.5 65 1.5 66 1.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.70090386195562 83.7 2 7.258285401259928 13.25 3 0.8764721993974254 2.4 4 0.10955902492467817 0.4 5 0.054779512462339086 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCA 5 0.125 No Hit AGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.5375000000000001 0.0 0.0 0.0 0.0 94-95 0.6625000000000001 0.0 0.0 0.0 0.0 96-97 0.7875 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.0499999999999998 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.5625 0.0 0.0 0.0 0.0 108-109 1.7625 0.0 0.0 0.0 0.0 110-111 1.9749999999999999 0.0 0.0 0.0 0.0 112-113 2.2625 0.0 0.0 0.0 0.0 114-115 2.475 0.0 0.0 0.0 0.0 116-117 2.675 0.0 0.0 0.0 0.0 118-119 3.1125 0.0 0.0 0.0 0.0 120-121 3.4125 0.0 0.0 0.0 0.0 122-123 3.725 0.0 0.0 0.0 0.0 124-125 4.275 0.0 0.0 0.0 0.0 126-127 4.6 0.0 0.0 0.0 0.0 128-129 5.0 0.0 0.0 0.0 0.0 130-131 5.3375 0.0 0.0 0.0 0.0 132-133 5.8 0.0 0.0 0.0 0.0 134-135 6.3625 0.0 0.0 0.0 0.0 136-137 6.737500000000001 0.0 0.0 0.0 0.0 138-139 7.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCTCTC 10 0.006830828 145.0 4 >>END_MODULE Read 723103 spots for SRR12690146.sra Written 723103 spots for SRR12690146.sra Read 723103 spots for SRR12690146.sra Written 723103 spots for SRR12690146.sra Read 723103 spots for SRR12690146.sra Written 723103 spots for SRR12690146.sra Read 723103 spots for SRR12690146.sra Written 723103 spots for SRR12690146.sra Read 723103 spots for SRR12690146.sra Written 723103 spots for SRR12690146.sra Read 723103 spots for SRR12690146.sra Written 723103 spots for SRR12690146.sra Read 723103 spots for SRR12690146.sra Written 723103 spots for SRR12690146.sra Read 723103 spots for SRR12690146.sra Written 723103 spots for SRR12690146.sra Read 723103 spots for SRR12690146.sra Written 723103 spots for SRR12690146.sra Read 723103 spots for SRR12690146.sra Written 723103 spots for SRR12690146.sra Read 723103 spots for SRR12690146.sra Written 723103 spots for SRR12690146.sra Read 723103 spots for SRR12690146.sra Written 723103 spots for SRR12690146.sra Read 723103 spots for SRR12690146.sra Written 723103 spots for SRR12690146.sra Read 723103 spots for SRR12690146.sra Written 723103 spots for SRR12690146.sra Read 723103 spots for SRR12690146.sra Written 723103 spots for SRR12690146.sra Read 723103 spots for SRR12690146.sra Written 723103 spots for SRR12690146.sra Read 723103 spots for SRR12690146.sra Written 723103 spots for SRR12690146.sra Read 723119 spots for SRR12690146.sra Written 723119 spots for SRR12690146.sra Read 723103 spots for SRR12690146.sra Written 723103 spots for SRR12690146.sra Read 723103 spots for SRR12690146.sra Written 723103 spots for SRR12690146.sra SRR ids: ['SRR12690146.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6t8dhg_e SRR12690146.sra spots: 14462076 blocks: [[1, 723103], [723104, 1446206], [1446207, 2169309], [2169310, 2892412], [2892413, 3615515], [3615516, 4338618], [4338619, 5061721], [5061722, 5784824], [5784825, 6507927], [6507928, 7231030], [7231031, 7954133], [7954134, 8677236], [8677237, 9400339], [9400340, 10123442], [10123443, 10846545], [10846546, 11569648], [11569649, 12292751], [12292752, 13015854], [13015855, 13738957], [13738958, 14462076]] SRR12690146 file size 4893145 SRR12690146 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690146 SRR12690146_1.fastq SRR12690146_2.fastq Input file: SRR12690146_1.fastq Paired file: SRR12690146_2.fastq trimmed: SRR12690146-trimmed-pair1.fastq, SRR12690146-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:52:02 2025 >> started Mon Feb 10 18:52:19 2025 >> done (16.597s) 14462076 read pairs processed; of these: 21 ( 0.00%) short read pairs filtered out after trimming by size control 4836 ( 0.03%) empty read pairs filtered out after trimming by size control 14457219 (99.97%) read pairs available; of these: 1693878 (11.72%) trimmed read pairs available after processing 12763341 (88.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 4 0.00% 21 3 0.00% 22 6 0.00% 23 9 0.00% 24 19 0.00% 25 12 0.00% 26 18 0.00% 27 17 0.00% 28 9 0.00% 29 12 0.00% 30 13 0.00% 31 17 0.00% 32 18 0.00% 33 16 0.00% 34 32 0.00% 35 26 0.00% 36 21 0.00% 37 15 0.00% 38 19 0.00% 39 32 0.00% 40 25 0.00% 41 26 0.00% 42 20 0.00% 43 35 0.00% 44 34 0.00% 45 46 0.00% 46 39 0.00% 47 44 0.00% 48 57 0.00% 49 57 0.00% 50 64 0.00% 51 60 0.00% 52 79 0.00% 53 95 0.00% 54 86 0.00% 55 106 0.00% 56 105 0.00% 57 115 0.00% 58 141 0.00% 59 145 0.00% 60 187 0.00% 61 238 0.00% 62 218 0.00% 63 280 0.00% 64 320 0.00% 65 326 0.00% 66 378 0.00% 67 462 0.00% 68 486 0.00% 69 564 0.00% 70 618 0.00% 71 719 0.00% 72 886 0.01% 73 1005 0.01% 74 1064 0.01% 75 1252 0.01% 76 1368 0.01% 77 1537 0.01% 78 1685 0.01% 79 1853 0.01% 80 2131 0.01% 81 2442 0.02% 82 2697 0.02% 83 2812 0.02% 84 3297 0.02% 85 3589 0.02% 86 4021 0.03% 87 4318 0.03% 88 4642 0.03% 89 4926 0.03% 90 5579 0.04% 91 6027 0.04% 92 6485 0.04% 93 7060 0.05% 94 7628 0.05% 95 8317 0.06% 96 8899 0.06% 97 9404 0.07% 98 9795 0.07% 99 10418 0.07% 100 11486 0.08% 101 11789 0.08% 102 12272 0.08% 103 13363 0.09% 104 13767 0.10% 105 14365 0.10% 106 15012 0.10% 107 15879 0.11% 108 16413 0.11% 109 17539 0.12% 110 18095 0.13% 111 18586 0.13% 112 19535 0.14% 113 19886 0.14% 114 20835 0.14% 115 21726 0.15% 116 22637 0.16% 117 23586 0.16% 118 24155 0.17% 119 24970 0.17% 120 25926 0.18% 121 26794 0.19% 122 27224 0.19% 123 28487 0.20% 124 29662 0.21% 125 29907 0.21% 126 31129 0.22% 127 32072 0.22% 128 32909 0.23% 129 33964 0.23% 130 35024 0.24% 131 34884 0.24% 132 36375 0.25% 133 37651 0.26% 134 38472 0.27% 135 38946 0.27% 136 40366 0.28% 137 40289 0.28% 138 41340 0.29% 139 42713 0.30% 140 43233 0.30% 141 44290 0.31% 142 45663 0.32% 143 45940 0.32% 144 46853 0.32% 145 48016 0.33% 146 48851 0.34% 147 48522 0.34% 148 49716 0.34% 149 49925 0.35% 150 51202 0.35% 151 12763341 88.28% 14457219 reads passed initial QC criterion=sequence-density sequence-density=1.02 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=17 prefix-density=1.03 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.30 sequence-density-rank=17 fanout-score=7.85 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=3.0 sequence=GGGGTGCGGTTGACGGTGGCAACGGCTGCCGATGAGATCATAGAGGAGGAAGCCAT criterion=sequence-density sequence-density=1.43 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=19 prefix-density=1.45 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=40.66 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=1.9 sequence=GGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCAACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR12690146 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:53:03 Started mapping on | Feb 10 18:53:03 Finished on | Feb 10 18:54:23 Mapping speed, Million of reads per hour | 650.57 Number of input reads | 14457219 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13788399 Uniquely mapped reads % | 95.37% Average mapped length | 295.52 Number of splices: Total | 13742143 Number of splices: Annotated (sjdb) | 13486115 Number of splices: GT/AG | 13451005 Number of splices: GC/AG | 249605 Number of splices: AT/AC | 10813 Number of splices: Non-canonical | 30720 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 344304 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 69674 % of reads mapped to too many loci | 0.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.65% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 324516 324516 324516 N_multimapping 344304 344304 344304 N_noFeature 363813 13641339 404187 N_ambiguous 191933 619 84913 UnstrandedReadsAssigned:13232653 PositiveStrandReadsAssigned:146441 NegativeStrandReadsAssigned:13299299 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690146 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690146-trimmed-pair1.fastq SRR12690146-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,457,219 reads, 13,359,266 reads pseudoaligned [quant] estimated average fragment length: 245.484 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,074 rounds 52401 SRR12690146.ke.tsv 34699 SRR12690146.se.tsv 87100 total ==> SRR12690146.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.52 225 8.73904 Potri.005G024800.1.v4.1 1035 790.516 67 5.83822 Potri.004G059700.1.v4.1 961 716.645 23 2.21075 Potri.007G009000.2.v4.1 1416 1171.52 0 0 Potri.003G141000.2.v4.1 2943 2698.52 407.311 10.3972 Potri.016G087400.1.v4.1 270 84.9597 791 641.327 Potri.015G069301.1.v4.1 564 330.06 0 0 Potri.010G195200.1.v4.1 1773 1528.52 4 0.180263 Potri.012G127500.1.v4.1 977 732.568 582 54.7257 ==> SRR12690146.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 96 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 141 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 16 SRR12690146 completed mapping pipeline successfully