Starting /dee2/code/volunteer_pipeline.sh SRR12690147 current disk space = 3057246851072 free memory = 1119781448 SRR12690147 SRAfilesize aa821e957cb468d50efee583c23b78b9 SRR12690147.sra SRR12690147.sra file validated SRR12690147 is paired end SRR12690147 is conventional basespace SRR12690147 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690147_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6275 37.0 37.0 37.0 37.0 37.0 2 36.31025 37.0 37.0 37.0 37.0 37.0 3 36.607 37.0 37.0 37.0 37.0 37.0 4 36.596 37.0 37.0 37.0 37.0 37.0 5 36.6155 37.0 37.0 37.0 37.0 37.0 6 36.597 37.0 37.0 37.0 37.0 37.0 7 36.5695 37.0 37.0 37.0 37.0 37.0 8 36.621 37.0 37.0 37.0 37.0 37.0 9 36.699 37.0 37.0 37.0 37.0 37.0 10-14 36.606700000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.5937 37.0 37.0 37.0 37.0 37.0 20-24 36.560700000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.5042 37.0 37.0 37.0 37.0 37.0 30-34 36.54280000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.5044 37.0 37.0 37.0 37.0 37.0 40-44 36.529 37.0 37.0 37.0 37.0 37.0 45-49 36.4372 37.0 37.0 37.0 37.0 37.0 50-54 36.4615 37.0 37.0 37.0 37.0 37.0 55-59 36.41629999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.413199999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.347300000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.31529999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.369699999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.291700000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.2933 37.0 37.0 37.0 37.0 37.0 90-94 36.298199999999994 37.0 37.0 37.0 37.0 37.0 95-99 36.2698 37.0 37.0 37.0 37.0 37.0 100-104 36.268899999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.206 37.0 37.0 37.0 37.0 37.0 110-114 36.1808 37.0 37.0 37.0 37.0 37.0 115-119 36.127399999999994 37.0 37.0 37.0 37.0 37.0 120-124 36.054700000000004 37.0 37.0 37.0 37.0 37.0 125-129 36.0142 37.0 37.0 37.0 37.0 37.0 130-134 36.049099999999996 37.0 37.0 37.0 37.0 37.0 135-139 36.0312 37.0 37.0 37.0 37.0 37.0 140-144 35.8412 37.0 37.0 37.0 37.0 37.0 145-149 35.8137 37.0 37.0 37.0 37.0 37.0 150-151 35.65975 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 1.0 26 5.0 27 8.0 28 8.0 29 16.0 30 24.0 31 34.0 32 49.0 33 62.0 34 101.0 35 300.0 36 2971.0 37 420.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.6 12.9 7.725 40.775 2 20.834380497612464 12.239256094496104 36.08946971600905 30.836893691882384 3 16.425 16.6 29.299999999999997 37.675 4 21.224999999999998 22.7 24.75 31.324999999999996 5 23.425 29.4 25.1 22.075 6 22.275 33.225 22.95 21.55 7 18.25 26.8 38.425 16.525000000000002 8 19.0 26.6 32.175 22.225 9 18.5 23.150000000000002 34.4 23.95 10-14 19.975 28.79 27.79 23.445 15-19 20.544999999999998 27.46 27.41 24.585 20-24 20.565 28.53 27.57 23.335 25-29 20.96 28.22 27.279999999999998 23.54 30-34 20.57 27.605 27.1 24.725 35-39 21.279999999999998 28.17 26.779999999999998 23.77 40-44 20.59 28.244999999999997 27.265 23.9 45-49 20.84 27.96 27.075 24.125 50-54 20.369999999999997 27.815 27.525 24.29 55-59 20.65 28.28 26.939999999999998 24.13 60-64 20.25 27.79 27.27 24.69 65-69 20.59 27.99 27.075 24.345 70-74 21.83 27.315 26.8 24.055 75-79 21.0 27.145000000000003 27.185 24.67 80-84 20.830000000000002 27.345000000000002 27.18 24.645 85-89 21.45 27.384999999999998 27.12 24.044999999999998 90-94 22.035 27.02 26.86 24.085 95-99 21.775 26.735 27.215 24.275 100-104 21.795 27.72 26.39 24.095 105-109 21.39 26.700000000000003 27.41 24.5 110-114 21.345 27.21 26.935 24.51 115-119 21.709999999999997 27.750000000000004 26.900000000000002 23.64 120-124 21.82 26.685 26.155 25.34 125-129 22.105 27.305 26.595000000000002 23.995 130-134 21.82 27.35 26.96 23.87 135-139 21.884999999999998 26.369999999999997 27.38 24.365000000000002 140-144 21.68 27.08 26.595000000000002 24.645 145-149 22.17 27.26 26.14 24.43 150-151 22.3875 27.1125 25.837500000000002 24.6625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.5 24 2.0 25 1.5 26 1.0 27 2.5 28 4.0 29 5.5 30 12.0 31 21.0 32 27.5 33 33.0 34 37.0 35 46.5 36 69.5 37 87.0 38 101.0 39 116.0 40 147.0 41 187.5 42 210.5 43 228.5 44 238.0 45 250.0 46 269.5 47 276.0 48 274.0 49 264.5 50 216.5 51 172.5 52 145.5 53 116.0 54 97.0 55 77.5 56 68.0 57 50.5 58 33.5 59 36.0 60 28.5 61 13.0 62 7.0 63 4.5 64 3.0 65 3.5 66 3.5 67 2.5 68 1.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.525 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.725 #Duplication Level Percentage of deduplicated Percentage of total 1 90.96169743731055 82.525 2 8.073849545329292 14.649999999999999 3 0.7991182143841279 2.175 4 0.13777900248002206 0.5 5 0.0 0.0 6 0.027555800496004413 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCTTTGCCATTGCTGGCAAGCCAAGAACAGGTGAGCATGAGACTCCTA 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.45 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.6625 0.0 0.0 0.0 0.0 88-89 0.7124999999999999 0.0 0.0 0.0 0.0 90-91 0.8 0.0 0.0 0.0 0.0 92-93 0.8625 0.0 0.0 0.0 0.0 94-95 0.9875 0.0 0.0 0.0 0.0 96-97 1.15 0.0 0.0 0.0 0.0 98-99 1.3 0.0 0.0 0.0 0.0 100-101 1.4 0.0 0.0 0.0 0.0 102-103 1.75 0.0 0.0 0.0 0.0 104-105 1.9874999999999998 0.0 0.0 0.0 0.0 106-107 2.2125 0.0 0.0 0.0 0.0 108-109 2.575 0.0 0.0 0.0 0.0 110-111 3.0375 0.0 0.0 0.0 0.0 112-113 3.2249999999999996 0.0 0.0 0.0 0.0 114-115 3.5625 0.0 0.0 0.0 0.0 116-117 4.0 0.0 0.0 0.0 0.0 118-119 4.5875 0.0 0.0 0.0 0.0 120-121 5.225 0.0 0.0 0.0 0.0 122-123 5.699999999999999 0.0 0.0 0.0 0.0 124-125 6.112500000000001 0.0 0.0 0.0 0.0 126-127 6.625 0.0 0.0 0.0 0.0 128-129 7.2875 0.0 0.0 0.0 0.0 130-131 7.85 0.0 0.0 0.0 0.0 132-133 8.524999999999999 0.0 0.0 0.0 0.0 134-135 9.125 0.0 0.0 0.0 0.0 136-137 9.6375 0.0 0.0 0.0 0.0 138-139 10.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCTGG 10 0.006830828 145.0 145 GGCGACT 10 0.006830828 145.0 1 >>END_MODULE SRR12690147 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690147_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.436 37.0 37.0 37.0 37.0 37.0 2 36.1415 37.0 37.0 37.0 37.0 37.0 3 36.1205 37.0 37.0 37.0 37.0 37.0 4 36.211 37.0 37.0 37.0 37.0 37.0 5 36.383 37.0 37.0 37.0 37.0 37.0 6 36.2535 37.0 37.0 37.0 37.0 37.0 7 36.2905 37.0 37.0 37.0 37.0 37.0 8 36.4375 37.0 37.0 37.0 37.0 37.0 9 36.31 37.0 37.0 37.0 37.0 37.0 10-14 36.2798 37.0 37.0 37.0 37.0 37.0 15-19 36.2664 37.0 37.0 37.0 37.0 37.0 20-24 36.347699999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.2692 37.0 37.0 37.0 37.0 37.0 30-34 36.2158 37.0 37.0 37.0 37.0 37.0 35-39 36.193799999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.1546 37.0 37.0 37.0 37.0 37.0 45-49 36.1888 37.0 37.0 37.0 37.0 37.0 50-54 36.148399999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.1242 37.0 37.0 37.0 37.0 37.0 60-64 36.1001 37.0 37.0 37.0 37.0 37.0 65-69 36.0428 37.0 37.0 37.0 37.0 37.0 70-74 36.017 37.0 37.0 37.0 37.0 37.0 75-79 36.0462 37.0 37.0 37.0 37.0 37.0 80-84 36.017399999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.0187 37.0 37.0 37.0 37.0 37.0 90-94 35.9405 37.0 37.0 37.0 37.0 37.0 95-99 35.9803 37.0 37.0 37.0 37.0 37.0 100-104 36.0009 37.0 37.0 37.0 37.0 37.0 105-109 35.9587 37.0 37.0 37.0 37.0 37.0 110-114 35.862399999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.8329 37.0 37.0 37.0 37.0 37.0 120-124 35.707899999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.5671 37.0 37.0 37.0 37.0 37.0 130-134 35.4816 37.0 37.0 37.0 37.0 37.0 135-139 35.4173 37.0 37.0 37.0 37.0 37.0 140-144 35.246599999999994 37.0 37.0 37.0 32.2 37.0 145-149 35.09630000000001 37.0 37.0 37.0 29.8 37.0 150-151 34.548 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 0.0 15 3.0 16 1.0 17 0.0 18 2.0 19 1.0 20 1.0 21 3.0 22 5.0 23 6.0 24 8.0 25 5.0 26 9.0 27 11.0 28 9.0 29 17.0 30 26.0 31 31.0 32 65.0 33 101.0 34 164.0 35 513.0 36 2752.0 37 263.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.45 25.424999999999997 10.299999999999999 26.825 2 29.125 29.025000000000002 26.200000000000003 15.65 3 22.3 28.499999999999996 29.2 20.0 4 23.95 33.875 22.525000000000002 19.650000000000002 5 25.874999999999996 36.8 20.849999999999998 16.475 6 20.125 40.400000000000006 21.55 17.925 7 22.25 22.55 35.825 19.375 8 22.35 26.35 26.3 25.0 9 22.575 24.85 28.799999999999997 23.775 10-14 24.115000000000002 29.585 24.605 21.695 15-19 23.79 28.565 26.165 21.48 20-24 24.43 28.134999999999998 25.929999999999996 21.505 25-29 24.425 28.395 26.115 21.065 30-34 23.39 27.975 26.72 21.915000000000003 35-39 23.29 28.225 27.22 21.265 40-44 24.135 28.48 26.075 21.310000000000002 45-49 23.695 28.494999999999997 25.979999999999997 21.83 50-54 24.02 28.465 26.55 20.965 55-59 24.19 28.035 26.605 21.17 60-64 24.52 27.68 26.355 21.445 65-69 24.15 27.675 26.735 21.44 70-74 23.695 28.18 26.205000000000002 21.92 75-79 24.235 27.41 26.58 21.775 80-84 23.875 27.93 26.365 21.83 85-89 24.169999999999998 27.55 26.224999999999998 22.055 90-94 24.310000000000002 27.395000000000003 26.705000000000002 21.59 95-99 24.11 27.93 26.3 21.66 100-104 23.96 27.639999999999997 26.405 21.995 105-109 24.605 26.974999999999998 26.75 21.67 110-114 24.615000000000002 27.805000000000003 26.71 20.87 115-119 24.495 27.650000000000002 25.990000000000002 21.865000000000002 120-124 25.369999999999997 27.77 25.91 20.95 125-129 25.064999999999998 28.845 25.75 20.34 130-134 26.35 27.115000000000002 26.05 20.485 135-139 26.08 27.55 26.185000000000002 20.185 140-144 26.784999999999997 27.345000000000002 25.590000000000003 20.28 145-149 27.185 27.095000000000002 26.255 19.465 150-151 27.5125 26.687499999999996 26.474999999999998 19.325 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 1.0 8 1.0 9 1.0 10 0.5 11 0.0 12 1.0 13 1.0 14 0.5 15 1.0 16 0.5 17 0.0 18 1.0 19 1.0 20 0.0 21 1.5 22 1.5 23 0.0 24 0.5 25 1.5 26 3.0 27 3.0 28 2.5 29 4.0 30 7.0 31 9.5 32 11.5 33 15.0 34 23.5 35 34.5 36 50.5 37 66.0 38 100.0 39 146.0 40 164.0 41 189.0 42 239.0 43 267.5 44 264.5 45 271.0 46 276.0 47 271.5 48 266.5 49 254.0 50 220.0 51 158.5 52 116.0 53 110.0 54 101.5 55 76.5 56 62.5 57 55.5 58 42.5 59 31.5 60 22.5 61 15.0 62 9.5 63 4.0 64 2.5 65 2.0 66 0.0 67 0.0 68 0.5 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 1.0 83 1.5 84 1.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.5 92 0.5 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 90.93913522445607 82.55 2 8.096942990911595 14.7 3 0.8812999173781328 2.4 4 0.0550812448361333 0.2 5 0.0 0.0 6 0.02754062241806665 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCCTTTGTAGCAGTGCTCAGTCCTGACTCAAGCTTCTTCCAAATTGAAG 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.45 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.6625 0.0 0.0 0.0 0.0 88-89 0.7124999999999999 0.0 0.0 0.0 0.0 90-91 0.8125 0.0 0.0 0.0 0.0 92-93 0.8875 0.0 0.0 0.0 0.0 94-95 1.025 0.0 0.0 0.0 0.0 96-97 1.2 0.0 0.0 0.0 0.0 98-99 1.35 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.8250000000000002 0.0 0.0 0.0 0.0 104-105 2.0875 0.0 0.0 0.0 0.0 106-107 2.3125 0.0 0.0 0.0 0.0 108-109 2.675 0.0 0.0 0.0 0.0 110-111 3.1375 0.0 0.0 0.0 0.0 112-113 3.325 0.0 0.0 0.0 0.0 114-115 3.6875 0.0 0.0 0.0 0.0 116-117 4.0875 0.0 0.0 0.0 0.0 118-119 4.6625 0.0 0.0 0.0 0.0 120-121 5.300000000000001 0.0 0.0 0.0 0.0 122-123 5.775 0.0 0.0 0.0 0.0 124-125 6.1875 0.0 0.0 0.0 0.0 126-127 6.7125 0.0 0.0 0.0 0.0 128-129 7.3875 0.0 0.0 0.0 0.0 130-131 7.949999999999999 0.0 0.0 0.0 0.0 132-133 8.649999999999999 0.0 0.0 0.0 0.0 134-135 9.25 0.0 0.0 0.0 0.0 136-137 9.7625 0.0 0.0 0.0 0.0 138-139 10.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGATGG 10 0.006830828 145.0 1 >>END_MODULE Read 941716 spots for SRR12690147.sra Written 941716 spots for SRR12690147.sra Read 941716 spots for SRR12690147.sra Written 941716 spots for SRR12690147.sra Read 941716 spots for SRR12690147.sra Written 941716 spots for SRR12690147.sra Read 941716 spots for SRR12690147.sra Written 941716 spots for SRR12690147.sra Read 941716 spots for SRR12690147.sra Written 941716 spots for SRR12690147.sra Read 941716 spots for SRR12690147.sra Written 941716 spots for SRR12690147.sra Read 941716 spots for SRR12690147.sra Written 941716 spots for SRR12690147.sra Read 941716 spots for SRR12690147.sra Written 941716 spots for SRR12690147.sra Read 941716 spots for SRR12690147.sra Written 941716 spots for SRR12690147.sra Read 941716 spots for SRR12690147.sra Written 941716 spots for SRR12690147.sra Read 941716 spots for SRR12690147.sra Written 941716 spots for SRR12690147.sra Read 941716 spots for SRR12690147.sra Written 941716 spots for SRR12690147.sra Read 941716 spots for SRR12690147.sra Written 941716 spots for SRR12690147.sra Read 941716 spots for SRR12690147.sra Written 941716 spots for SRR12690147.sra Read 941716 spots for SRR12690147.sra Written 941716 spots for SRR12690147.sra Read 941716 spots for SRR12690147.sra Written 941716 spots for SRR12690147.sra Read 941716 spots for SRR12690147.sra Written 941716 spots for SRR12690147.sra Read 941716 spots for SRR12690147.sra Written 941716 spots for SRR12690147.sra Read 941716 spots for SRR12690147.sra Written 941716 spots for SRR12690147.sra Read 941728 spots for SRR12690147.sra Written 941728 spots for SRR12690147.sra SRR ids: ['SRR12690147.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4v9ci9o5 SRR12690147.sra spots: 18834332 blocks: [[1, 941716], [941717, 1883432], [1883433, 2825148], [2825149, 3766864], [3766865, 4708580], [4708581, 5650296], [5650297, 6592012], [6592013, 7533728], [7533729, 8475444], [8475445, 9417160], [9417161, 10358876], [10358877, 11300592], [11300593, 12242308], [12242309, 13184024], [13184025, 14125740], [14125741, 15067456], [15067457, 16009172], [16009173, 16950888], [16950889, 17892604], [17892605, 18834332]] SRR12690147 file size 6379029 SRR12690147 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690147 SRR12690147_1.fastq SRR12690147_2.fastq Input file: SRR12690147_1.fastq Paired file: SRR12690147_2.fastq trimmed: SRR12690147-trimmed-pair1.fastq, SRR12690147-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:59:32 2025 >> started Mon Feb 10 18:59:54 2025 >> done (22.456s) 18834332 read pairs processed; of these: 45 ( 0.00%) short read pairs filtered out after trimming by size control 14890 ( 0.08%) empty read pairs filtered out after trimming by size control 18819397 (99.92%) read pairs available; of these: 3046844 (16.19%) trimmed read pairs available after processing 15772553 (83.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 2 0.00% 20 6 0.00% 21 7 0.00% 22 6 0.00% 23 11 0.00% 24 13 0.00% 25 14 0.00% 26 17 0.00% 27 26 0.00% 28 20 0.00% 29 11 0.00% 30 23 0.00% 31 19 0.00% 32 25 0.00% 33 30 0.00% 34 25 0.00% 35 28 0.00% 36 33 0.00% 37 35 0.00% 38 36 0.00% 39 52 0.00% 40 49 0.00% 41 68 0.00% 42 60 0.00% 43 46 0.00% 44 64 0.00% 45 64 0.00% 46 94 0.00% 47 90 0.00% 48 111 0.00% 49 129 0.00% 50 144 0.00% 51 167 0.00% 52 206 0.00% 53 205 0.00% 54 233 0.00% 55 275 0.00% 56 271 0.00% 57 329 0.00% 58 349 0.00% 59 465 0.00% 60 573 0.00% 61 662 0.00% 62 718 0.00% 63 792 0.00% 64 876 0.00% 65 938 0.00% 66 1103 0.01% 67 1301 0.01% 68 1441 0.01% 69 1675 0.01% 70 1894 0.01% 71 2190 0.01% 72 2473 0.01% 73 2760 0.01% 74 3109 0.02% 75 3531 0.02% 76 4010 0.02% 77 4397 0.02% 78 4652 0.02% 79 5437 0.03% 80 5846 0.03% 81 6384 0.03% 82 7424 0.04% 83 7807 0.04% 84 8861 0.05% 85 9779 0.05% 86 10743 0.06% 87 11257 0.06% 88 12173 0.06% 89 12798 0.07% 90 13546 0.07% 91 14618 0.08% 92 15666 0.08% 93 16868 0.09% 94 18126 0.10% 95 19631 0.10% 96 20392 0.11% 97 21465 0.11% 98 22720 0.12% 99 23401 0.12% 100 24272 0.13% 101 25479 0.14% 102 26520 0.14% 103 28154 0.15% 104 28747 0.15% 105 30027 0.16% 106 31736 0.17% 107 32978 0.18% 108 33712 0.18% 109 35474 0.19% 110 36245 0.19% 111 36838 0.20% 112 38322 0.20% 113 39098 0.21% 114 40122 0.21% 115 41751 0.22% 116 43379 0.23% 117 44989 0.24% 118 46169 0.25% 119 46806 0.25% 120 48308 0.26% 121 49321 0.26% 122 50586 0.27% 123 50904 0.27% 124 53199 0.28% 125 52816 0.28% 126 55403 0.29% 127 56776 0.30% 128 57613 0.31% 129 59004 0.31% 130 60689 0.32% 131 60255 0.32% 132 61624 0.33% 133 64006 0.34% 134 64052 0.34% 135 64752 0.34% 136 66160 0.35% 137 67059 0.36% 138 68220 0.36% 139 69823 0.37% 140 70677 0.38% 141 71398 0.38% 142 72702 0.39% 143 73549 0.39% 144 75005 0.40% 145 75558 0.40% 146 76280 0.41% 147 76343 0.41% 148 78278 0.42% 149 77933 0.41% 150 79831 0.42% 151 15772553 83.81% 18819397 reads passed initial QC criterion=sequence-density sequence-density=0.90 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=22 prefix-density=0.91 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=36.47 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.3 sequence=TCACGAAGAACCAGAATATTAAATAAGCCAGGCAATATATAGTACAACACAGATTTTTTTAGATGCACATAATTAATGCCTACAATATCGTACTGTAAACACAAGCTCATAAGAAAGAAGAGACTGATCCAAGTCCGTCGACGGGAACTAGCTCAAACATGCTCGAGCACCCCTTTTATTCTAGCACTAGCTTATTATCATACTTCATAATCTGCTTCGATTCTTCACTTCACGCTTTTGCAATCTGTGGAAGGACTGATTTTGTAGGAGATGGATACACCACACTTTGAAGGGAGGCCAGCAGCCACGCCATAGTTGATGCCAGAGATCTTACCAGCCAAGGATTTCAAACAGTTGCAGACCCCTTGGCGGTCGGCGGTGGTCGTGGCTGCAGAATTAAGTCCTTTCAACCCACTGCAGCAAGCTGCAGGCACAGCCCCACCCTTCTGGAGGTAGGTTATACATTGTGCCAAGCTGCTTGACACCTGGCCACATGAGATGGCAGCTTCTG criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=21 prefix-density=0.77 prefix-fanout=2.1 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=64.89 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=2.9 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGT SRR12690147 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:00:48 Started mapping on | Feb 10 19:00:49 Finished on | Feb 10 19:02:31 Mapping speed, Million of reads per hour | 664.21 Number of input reads | 18819397 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 17782625 Uniquely mapped reads % | 94.49% Average mapped length | 292.69 Number of splices: Total | 17096744 Number of splices: Annotated (sjdb) | 16788345 Number of splices: GT/AG | 16724768 Number of splices: GC/AG | 325071 Number of splices: AT/AC | 12998 Number of splices: Non-canonical | 33907 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 449756 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 125109 % of reads mapped to too many loci | 0.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.31% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 587016 587016 587016 N_multimapping 449756 449756 449756 N_noFeature 408901 17543977 471404 N_ambiguous 291434 1095 114678 UnstrandedReadsAssigned:17082290 PositiveStrandReadsAssigned:237553 NegativeStrandReadsAssigned:17196543 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690147 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690147-trimmed-pair1.fastq SRR12690147-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,819,397 reads, 17,337,285 reads pseudoaligned [quant] estimated average fragment length: 228.207 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,120 rounds 52401 SRR12690147.ke.tsv 34699 SRR12690147.se.tsv 87100 total ==> SRR12690147.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.79 342 9.18082 Potri.005G024800.1.v4.1 1035 807.793 116 6.90333 Potri.004G059700.1.v4.1 961 733.85 57 3.73395 Potri.007G009000.2.v4.1 1416 1188.79 0 0 Potri.003G141000.2.v4.1 2943 2715.79 506 8.95684 Potri.016G087400.1.v4.1 270 91.6445 1135.48 595.625 Potri.015G069301.1.v4.1 564 343.559 0 0 Potri.010G195200.1.v4.1 1773 1545.79 10 0.310992 Potri.012G127500.1.v4.1 977 749.824 502 32.1844 ==> SRR12690147.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 434 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 253 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 17 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 12 SRR12690147 completed mapping pipeline successfully