Starting /dee2/code/volunteer_pipeline.sh SRR12690148 current disk space = 3057275727872 free memory = 1273384600 SRR12690148 SRAfilesize eb8ad0809407265cd854740d9297e3e1 SRR12690148.sra SRR12690148.sra file validated SRR12690148 is paired end SRR12690148 is conventional basespace SRR12690148 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690148_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.662 37.0 37.0 37.0 37.0 37.0 2 36.401 37.0 37.0 37.0 37.0 37.0 3 36.655 37.0 37.0 37.0 37.0 37.0 4 36.613 37.0 37.0 37.0 37.0 37.0 5 36.6505 37.0 37.0 37.0 37.0 37.0 6 36.5935 37.0 37.0 37.0 37.0 37.0 7 36.575 37.0 37.0 37.0 37.0 37.0 8 36.581 37.0 37.0 37.0 37.0 37.0 9 36.632 37.0 37.0 37.0 37.0 37.0 10-14 36.6284 37.0 37.0 37.0 37.0 37.0 15-19 36.6104 37.0 37.0 37.0 37.0 37.0 20-24 36.5522 37.0 37.0 37.0 37.0 37.0 25-29 36.558899999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.4906 37.0 37.0 37.0 37.0 37.0 35-39 36.540099999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.4861 37.0 37.0 37.0 37.0 37.0 45-49 36.4914 37.0 37.0 37.0 37.0 37.0 50-54 36.48440000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.3918 37.0 37.0 37.0 37.0 37.0 60-64 36.410000000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.384100000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.37179999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.393699999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.294500000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.255300000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.221 37.0 37.0 37.0 37.0 37.0 95-99 36.2356 37.0 37.0 37.0 37.0 37.0 100-104 36.184200000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.1544 37.0 37.0 37.0 37.0 37.0 110-114 36.1614 37.0 37.0 37.0 37.0 37.0 115-119 36.1048 37.0 37.0 37.0 37.0 37.0 120-124 36.054899999999996 37.0 37.0 37.0 37.0 37.0 125-129 36.0148 37.0 37.0 37.0 37.0 37.0 130-134 35.988600000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.9893 37.0 37.0 37.0 37.0 37.0 140-144 35.7975 37.0 37.0 37.0 37.0 37.0 145-149 35.7282 37.0 37.0 37.0 37.0 37.0 150-151 35.541250000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 1.0 23 0.0 24 2.0 25 3.0 26 2.0 27 9.0 28 8.0 29 18.0 30 28.0 31 37.0 32 40.0 33 51.0 34 114.0 35 282.0 36 3022.0 37 381.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.0 12.525 7.5249999999999995 36.95 2 19.808949220713927 13.046757164404225 36.09854198089492 31.045751633986928 3 17.1 16.2 27.55 39.15 4 21.9 22.85 24.125 31.125000000000004 5 23.375 31.025000000000002 23.525 22.075 6 22.575 33.074999999999996 22.75 21.6 7 16.175 26.1 40.875 16.85 8 17.9 27.125 30.3 24.675 9 17.224999999999998 23.9 36.825 22.05 10-14 20.215 28.754999999999995 28.03 23.0 15-19 20.035 27.85 28.050000000000004 24.065 20-24 20.365 27.889999999999997 28.199999999999996 23.544999999999998 25-29 20.235 27.975 28.005000000000003 23.785 30-34 20.395 28.205000000000002 28.194999999999997 23.205000000000002 35-39 20.685000000000002 27.584999999999997 28.07 23.66 40-44 20.325 28.76 27.21 23.705000000000002 45-49 20.72 28.48 27.925 22.875 50-54 20.015 29.035 27.185 23.765 55-59 20.69 28.09 27.794999999999998 23.425 60-64 20.73 27.625 27.855 23.79 65-69 20.465 27.644999999999996 27.905 23.985 70-74 20.535 28.62 27.534999999999997 23.31 75-79 20.02 27.944999999999997 27.85 24.185000000000002 80-84 20.54 28.225 27.485 23.75 85-89 21.02 27.35 27.894999999999996 23.735 90-94 19.88 28.28 28.01 23.830000000000002 95-99 20.285 27.175 28.155 24.385 100-104 20.405 28.945 27.515 23.135 105-109 21.21 27.435 27.71 23.645 110-114 20.665 27.915 28.199999999999996 23.22 115-119 21.005 27.785 27.77 23.44 120-124 21.025 27.785 27.455000000000002 23.735 125-129 21.645 27.955000000000002 27.584999999999997 22.814999999999998 130-134 21.295 28.185 27.41 23.11 135-139 21.85 28.044999999999998 26.889999999999997 23.215 140-144 21.584999999999997 27.925 26.97 23.52 145-149 21.740000000000002 27.555000000000003 27.150000000000002 23.555 150-151 22.35 27.3375 27.437499999999996 22.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 2.0 24 3.5 25 2.5 26 3.5 27 3.5 28 4.0 29 9.5 30 18.0 31 23.5 32 31.5 33 39.5 34 45.0 35 66.5 36 85.0 37 94.5 38 129.0 39 160.5 40 187.5 41 216.5 42 232.0 43 246.5 44 260.5 45 278.0 46 261.0 47 230.0 48 225.5 49 211.5 50 191.5 51 163.0 52 113.5 53 92.5 54 91.0 55 80.5 56 59.0 57 36.0 58 28.0 59 20.5 60 13.0 61 9.5 62 8.0 63 5.5 64 3.5 65 2.0 66 2.0 67 3.0 68 2.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.5499999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.24729091414282 81.2 2 8.585718255070853 15.45 3 1.0002778549597109 2.7 4 0.11114198388441232 0.4 5 0.05557099194220616 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCTTTCAACCCACTGCAGCAAGCTGCAGGCACAGCCCCACCCTTCTGG 5 0.125 No Hit GTTCAGACATGGGTAGAGTGACATTGTCGTCATATCCATTGAAAAAAAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.7250000000000001 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 0.9625 0.0 0.0 0.0 0.0 100-101 1.0750000000000002 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.5625 0.0 0.0 0.0 0.0 106-107 1.825 0.0 0.0 0.0 0.0 108-109 2.15 0.0 0.0 0.0 0.0 110-111 2.5125 0.0 0.0 0.0 0.0 112-113 2.95 0.0 0.0 0.0 0.0 114-115 3.3125 0.0 0.0 0.0 0.0 116-117 3.5999999999999996 0.0 0.0 0.0 0.0 118-119 3.9625 0.0 0.0 0.0 0.0 120-121 4.525 0.0 0.0 0.0 0.0 122-123 4.775 0.0 0.0 0.0 0.0 124-125 5.237500000000001 0.0 0.0 0.0 0.0 126-127 5.5625 0.0 0.0 0.0 0.0 128-129 6.0375 0.0 0.0 0.0 0.0 130-131 6.612500000000001 0.0 0.0 0.0 0.0 132-133 7.35 0.0 0.0 0.0 0.0 134-135 7.85 0.0 0.0 0.0 0.0 136-137 8.2625 0.0 0.0 0.0 0.0 138-139 8.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAGGAT 10 0.006830828 145.0 1 >>END_MODULE SRR12690148 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690148_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1245 37.0 37.0 37.0 37.0 37.0 2 35.967 37.0 37.0 37.0 37.0 37.0 3 35.936 37.0 37.0 37.0 37.0 37.0 4 35.9895 37.0 37.0 37.0 37.0 37.0 5 36.195 37.0 37.0 37.0 37.0 37.0 6 36.0685 37.0 37.0 37.0 37.0 37.0 7 36.115 37.0 37.0 37.0 37.0 37.0 8 36.3115 37.0 37.0 37.0 37.0 37.0 9 36.195 37.0 37.0 37.0 37.0 37.0 10-14 36.163900000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.1291 37.0 37.0 37.0 37.0 37.0 20-24 36.1353 37.0 37.0 37.0 37.0 37.0 25-29 36.092 37.0 37.0 37.0 37.0 37.0 30-34 36.1023 37.0 37.0 37.0 37.0 37.0 35-39 36.01689999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.012100000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.9446 37.0 37.0 37.0 37.0 37.0 50-54 35.8763 37.0 37.0 37.0 37.0 37.0 55-59 35.8908 37.0 37.0 37.0 37.0 37.0 60-64 35.88 37.0 37.0 37.0 37.0 37.0 65-69 35.8849 37.0 37.0 37.0 37.0 37.0 70-74 35.756099999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.855599999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.85080000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.835 37.0 37.0 37.0 37.0 37.0 90-94 35.747 37.0 37.0 37.0 37.0 37.0 95-99 35.71810000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.678399999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.7202 37.0 37.0 37.0 37.0 37.0 110-114 35.6583 37.0 37.0 37.0 37.0 37.0 115-119 35.5693 37.0 37.0 37.0 37.0 37.0 120-124 35.443400000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.420300000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.3165 37.0 37.0 37.0 37.0 37.0 135-139 35.198 37.0 37.0 37.0 29.8 37.0 140-144 35.0803 37.0 37.0 37.0 25.0 37.0 145-149 34.955799999999996 37.0 37.0 37.0 25.0 37.0 150-151 34.51825 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 2.0 15 0.0 16 0.0 17 2.0 18 0.0 19 0.0 20 4.0 21 2.0 22 4.0 23 3.0 24 3.0 25 8.0 26 12.0 27 14.0 28 21.0 29 19.0 30 35.0 31 47.0 32 73.0 33 136.0 34 244.0 35 668.0 36 2504.0 37 196.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.925 24.8 11.0 26.275 2 28.725 26.924999999999997 28.249999999999996 16.1 3 20.375 28.875 30.925000000000004 19.825 4 22.875 35.225 24.5 17.4 5 25.474999999999998 35.6 21.25 17.675 6 19.650000000000002 38.574999999999996 22.85 18.925 7 19.775000000000002 22.650000000000002 38.625 18.95 8 20.8 26.650000000000002 27.525 25.025 9 21.075 25.85 29.125 23.95 10-14 22.66 29.220000000000002 26.855 21.265 15-19 22.365 28.535 27.544999999999998 21.555 20-24 22.605 27.83 28.59 20.974999999999998 25-29 23.205000000000002 28.325 27.18 21.29 30-34 21.935 28.415000000000003 28.389999999999997 21.26 35-39 23.064999999999998 27.975 28.07 20.89 40-44 22.645 28.625 27.395000000000003 21.335 45-49 22.37 28.42 28.07 21.14 50-54 22.564999999999998 28.134999999999998 28.115000000000002 21.185000000000002 55-59 22.595000000000002 28.560000000000002 27.355 21.490000000000002 60-64 22.68 27.61 28.055000000000003 21.654999999999998 65-69 22.63 27.994999999999997 27.725 21.65 70-74 22.82 28.084999999999997 27.834999999999997 21.26 75-79 22.57 27.77 27.92 21.740000000000002 80-84 23.200000000000003 27.855 27.525 21.42 85-89 22.82 27.189999999999998 28.134999999999998 21.855 90-94 22.535 28.555000000000003 27.015 21.895 95-99 23.544999999999998 27.935 27.515 21.005 100-104 23.885 27.689999999999998 27.575 20.849999999999998 105-109 23.78 27.950000000000003 27.67 20.599999999999998 110-114 24.404999999999998 27.755000000000003 26.919999999999998 20.919999999999998 115-119 24.09 28.025 26.82 21.065 120-124 24.4 28.525 26.22 20.855 125-129 24.7 27.339999999999996 27.375 20.585 130-134 25.4 27.61 26.740000000000002 20.25 135-139 25.03 27.925 26.625 20.419999999999998 140-144 25.924999999999997 27.584999999999997 26.314999999999998 20.175 145-149 27.295 27.22 25.785000000000004 19.7 150-151 27.675 26.8625 26.687499999999996 18.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 1.5 21 1.5 22 1.0 23 1.5 24 3.5 25 4.0 26 3.5 27 5.0 28 7.5 29 10.0 30 13.5 31 17.0 32 22.0 33 37.0 34 55.5 35 72.5 36 91.5 37 123.0 38 143.0 39 168.0 40 200.5 41 213.5 42 227.0 43 258.5 44 283.0 45 270.0 46 270.5 47 263.0 48 230.0 49 201.5 50 168.5 51 131.5 52 103.0 53 89.5 54 77.5 55 59.0 56 41.5 57 34.5 58 24.0 59 14.0 60 12.0 61 9.0 62 8.5 63 7.5 64 3.0 65 0.5 66 0.5 67 0.5 68 0.5 69 1.0 70 0.5 71 1.0 72 1.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.95 #Duplication Level Percentage of deduplicated Percentage of total 1 90.6058921623124 81.5 2 8.004446914952752 14.399999999999999 3 1.083935519733185 2.9250000000000003 4 0.22234574763757642 0.8 5 0.08337965536409116 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 5 0.125 No Hit GGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGT 5 0.125 No Hit GAATTTTTCTCTCACTGTGGTGCTATTGAGCATGTTGAAATCATCAGATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.7250000000000001 0.0 0.0 0.0 0.0 96-97 0.8374999999999999 0.0 0.0 0.0 0.0 98-99 0.9625 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.3 0.0 0.0 0.0 0.0 104-105 1.5875 0.0 0.0 0.0 0.0 106-107 1.85 0.0 0.0 0.0 0.0 108-109 2.175 0.0 0.0 0.0 0.0 110-111 2.5125 0.0 0.0 0.0 0.0 112-113 2.9625000000000004 0.0 0.0 0.0 0.0 114-115 3.3125 0.0 0.0 0.0 0.0 116-117 3.5999999999999996 0.0 0.0 0.0 0.0 118-119 3.9625 0.0 0.0 0.0 0.0 120-121 4.550000000000001 0.0 0.0 0.0 0.0 122-123 4.7875 0.0 0.0 0.0 0.0 124-125 5.237500000000001 0.0 0.0 0.0 0.0 126-127 5.5625 0.0 0.0 0.0 0.0 128-129 6.0375 0.0 0.0 0.0 0.0 130-131 6.6 0.0 0.0 0.0 0.0 132-133 7.4 0.0 0.0 0.0 0.0 134-135 7.925000000000001 0.0 0.0 0.0 0.0 136-137 8.3625 0.0 0.0 0.0 0.0 138-139 8.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1036345 spots for SRR12690148.sra Written 1036345 spots for SRR12690148.sra Read 1036345 spots for SRR12690148.sra Written 1036345 spots for SRR12690148.sra Read 1036345 spots for SRR12690148.sra Written 1036345 spots for SRR12690148.sra Read 1036345 spots for SRR12690148.sra Written 1036345 spots for SRR12690148.sra Read 1036345 spots for SRR12690148.sra Written 1036345 spots for SRR12690148.sra Read 1036345 spots for SRR12690148.sra Written 1036345 spots for SRR12690148.sra Read 1036345 spots for SRR12690148.sra Written 1036345 spots for SRR12690148.sra Read 1036345 spots for SRR12690148.sra Written 1036345 spots for SRR12690148.sra Read 1036345 spots for SRR12690148.sra Written 1036345 spots for SRR12690148.sra Read 1036345 spots for SRR12690148.sra Written 1036345 spots for SRR12690148.sra Read 1036345 spots for SRR12690148.sra Written 1036345 spots for SRR12690148.sra Read 1036345 spots for SRR12690148.sra Written 1036345 spots for SRR12690148.sra Read 1036345 spots for SRR12690148.sra Written 1036345 spots for SRR12690148.sra Read 1036345 spots for SRR12690148.sra Written 1036345 spots for SRR12690148.sra Read 1036345 spots for SRR12690148.sra Written 1036345 spots for SRR12690148.sra Read 1036345 spots for SRR12690148.sra Written 1036345 spots for SRR12690148.sra Read 1036362 spots for SRR12690148.sra Written 1036362 spots for SRR12690148.sra Read 1036345 spots for SRR12690148.sra Written 1036345 spots for SRR12690148.sra Read 1036345 spots for SRR12690148.sra Written 1036345 spots for SRR12690148.sra Read 1036345 spots for SRR12690148.sra Written 1036345 spots for SRR12690148.sra SRR ids: ['SRR12690148.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w2vq26ur SRR12690148.sra spots: 20726917 blocks: [[1, 1036345], [1036346, 2072690], [2072691, 3109035], [3109036, 4145380], [4145381, 5181725], [5181726, 6218070], [6218071, 7254415], [7254416, 8290760], [8290761, 9327105], [9327106, 10363450], [10363451, 11399795], [11399796, 12436140], [12436141, 13472485], [13472486, 14508830], [14508831, 15545175], [15545176, 16581520], [16581521, 17617865], [17617866, 18654210], [18654211, 19690555], [19690556, 20726917]] SRR12690148 file size 7022212 SRR12690148 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690148 SRR12690148_1.fastq SRR12690148_2.fastq Input file: SRR12690148_1.fastq Paired file: SRR12690148_2.fastq trimmed: SRR12690148-trimmed-pair1.fastq, SRR12690148-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:58:40 2025 >> started Mon Feb 10 18:59:02 2025 >> done (22.115s) 20726917 read pairs processed; of these: 49 ( 0.00%) short read pairs filtered out after trimming by size control 6063 ( 0.03%) empty read pairs filtered out after trimming by size control 20720805 (99.97%) read pairs available; of these: 2745367 (13.25%) trimmed read pairs available after processing 17975438 (86.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 6 0.00% 20 4 0.00% 21 10 0.00% 22 8 0.00% 23 10 0.00% 24 17 0.00% 25 16 0.00% 26 23 0.00% 27 19 0.00% 28 27 0.00% 29 20 0.00% 30 30 0.00% 31 18 0.00% 32 26 0.00% 33 22 0.00% 34 25 0.00% 35 22 0.00% 36 30 0.00% 37 25 0.00% 38 37 0.00% 39 38 0.00% 40 27 0.00% 41 38 0.00% 42 47 0.00% 43 36 0.00% 44 50 0.00% 45 66 0.00% 46 57 0.00% 47 60 0.00% 48 66 0.00% 49 86 0.00% 50 131 0.00% 51 115 0.00% 52 130 0.00% 53 125 0.00% 54 131 0.00% 55 149 0.00% 56 180 0.00% 57 213 0.00% 58 275 0.00% 59 324 0.00% 60 376 0.00% 61 396 0.00% 62 484 0.00% 63 531 0.00% 64 553 0.00% 65 625 0.00% 66 710 0.00% 67 851 0.00% 68 894 0.00% 69 1059 0.01% 70 1247 0.01% 71 1314 0.01% 72 1693 0.01% 73 1787 0.01% 74 2052 0.01% 75 2305 0.01% 76 2655 0.01% 77 2914 0.01% 78 3000 0.01% 79 3617 0.02% 80 3895 0.02% 81 4425 0.02% 82 5021 0.02% 83 5498 0.03% 84 6062 0.03% 85 6793 0.03% 86 6984 0.03% 87 7982 0.04% 88 8673 0.04% 89 9257 0.04% 90 10003 0.05% 91 10786 0.05% 92 11657 0.06% 93 12550 0.06% 94 13617 0.07% 95 14768 0.07% 96 15604 0.08% 97 16580 0.08% 98 17188 0.08% 99 18541 0.09% 100 19522 0.09% 101 20099 0.10% 102 21460 0.10% 103 22556 0.11% 104 23665 0.11% 105 25097 0.12% 106 26261 0.13% 107 27229 0.13% 108 27849 0.13% 109 29479 0.14% 110 30229 0.15% 111 31321 0.15% 112 33289 0.16% 113 33779 0.16% 114 35288 0.17% 115 36886 0.18% 116 38359 0.19% 117 39149 0.19% 118 40918 0.20% 119 41171 0.20% 120 43766 0.21% 121 44765 0.22% 122 45831 0.22% 123 47198 0.23% 124 48957 0.24% 125 49480 0.24% 126 51789 0.25% 127 52223 0.25% 128 53311 0.26% 129 54231 0.26% 130 56046 0.27% 131 56704 0.27% 132 57941 0.28% 133 59998 0.29% 134 60345 0.29% 135 61943 0.30% 136 62915 0.30% 137 63831 0.31% 138 64113 0.31% 139 67077 0.32% 140 66430 0.32% 141 68254 0.33% 142 70006 0.34% 143 70766 0.34% 144 72830 0.35% 145 73338 0.35% 146 74607 0.36% 147 74264 0.36% 148 76750 0.37% 149 76122 0.37% 150 78242 0.38% 151 17975438 86.75% 20720805 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=22 prefix-density=0.66 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=403.01 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=16.7 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=1.10 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=27 prefix-density=1.10 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=23.19 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.0 sequence=CTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTA SRR12690148 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:59:44 Started mapping on | Feb 10 18:59:44 Finished on | Feb 10 19:02:00 Mapping speed, Million of reads per hour | 548.49 Number of input reads | 20720805 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 19665514 Uniquely mapped reads % | 94.91% Average mapped length | 294.41 Number of splices: Total | 20346097 Number of splices: Annotated (sjdb) | 19929307 Number of splices: GT/AG | 19933400 Number of splices: GC/AG | 329088 Number of splices: AT/AC | 12654 Number of splices: Non-canonical | 70955 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 491976 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 81856 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.16% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 563315 563315 563315 N_multimapping 491976 491976 491976 N_noFeature 623499 19395239 697070 N_ambiguous 329616 886 132349 UnstrandedReadsAssigned:18712399 PositiveStrandReadsAssigned:269389 NegativeStrandReadsAssigned:18836095 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690148 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690148-trimmed-pair1.fastq SRR12690148-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,720,805 reads, 18,891,464 reads pseudoaligned [quant] estimated average fragment length: 245.556 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52401 SRR12690148.ke.tsv 34699 SRR12690148.se.tsv 87100 total ==> SRR12690148.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.44 563 14.6122 Potri.005G024800.1.v4.1 1035 790.444 252 14.6742 Potri.004G059700.1.v4.1 961 716.539 20 1.28474 Potri.007G009000.2.v4.1 1416 1171.44 0 0 Potri.003G141000.2.v4.1 2943 2698.44 677 11.5478 Potri.016G087400.1.v4.1 270 88.0898 673 351.654 Potri.015G069301.1.v4.1 564 330.926 0 0 Potri.010G195200.1.v4.1 1773 1528.44 32 0.963666 Potri.012G127500.1.v4.1 977 732.504 77 4.83845 ==> SRR12690148.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 368 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 294 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 15 SRR12690148 completed mapping pipeline successfully