Starting /dee2/code/volunteer_pipeline.sh SRR12690149 current disk space = 3056960692224 free memory = 1157812312 SRR12690149 SRAfilesize a02649dfed1564fb08f46fecd620981b SRR12690149.sra SRR12690149.sra file validated SRR12690149 is paired end SRR12690149 is conventional basespace SRR12690149 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690149_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5455 37.0 37.0 37.0 37.0 37.0 2 36.3325 37.0 37.0 37.0 37.0 37.0 3 36.648 37.0 37.0 37.0 37.0 37.0 4 36.628 37.0 37.0 37.0 37.0 37.0 5 36.6925 37.0 37.0 37.0 37.0 37.0 6 36.563 37.0 37.0 37.0 37.0 37.0 7 36.5135 37.0 37.0 37.0 37.0 37.0 8 36.5315 37.0 37.0 37.0 37.0 37.0 9 36.5925 37.0 37.0 37.0 37.0 37.0 10-14 36.593599999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.5828 37.0 37.0 37.0 37.0 37.0 20-24 36.5583 37.0 37.0 37.0 37.0 37.0 25-29 36.530199999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.4808 37.0 37.0 37.0 37.0 37.0 35-39 36.444799999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.4753 37.0 37.0 37.0 37.0 37.0 45-49 36.409299999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.414 37.0 37.0 37.0 37.0 37.0 55-59 36.3447 37.0 37.0 37.0 37.0 37.0 60-64 36.4092 37.0 37.0 37.0 37.0 37.0 65-69 36.3152 37.0 37.0 37.0 37.0 37.0 70-74 36.3211 37.0 37.0 37.0 37.0 37.0 75-79 36.340999999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.2645 37.0 37.0 37.0 37.0 37.0 85-89 36.277 37.0 37.0 37.0 37.0 37.0 90-94 36.245900000000006 37.0 37.0 37.0 37.0 37.0 95-99 36.2553 37.0 37.0 37.0 37.0 37.0 100-104 36.1657 37.0 37.0 37.0 37.0 37.0 105-109 36.176199999999994 37.0 37.0 37.0 37.0 37.0 110-114 36.1192 37.0 37.0 37.0 37.0 37.0 115-119 36.1032 37.0 37.0 37.0 37.0 37.0 120-124 36.0706 37.0 37.0 37.0 37.0 37.0 125-129 36.0932 37.0 37.0 37.0 37.0 37.0 130-134 36.0134 37.0 37.0 37.0 37.0 37.0 135-139 35.967200000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.8143 37.0 37.0 37.0 37.0 37.0 145-149 35.677200000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.51 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 1.0 26 3.0 27 4.0 28 10.0 29 13.0 30 32.0 31 31.0 32 50.0 33 68.0 34 124.0 35 310.0 36 3002.0 37 351.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.224999999999994 13.575000000000001 7.124999999999999 35.075 2 20.47165077772203 12.51881585549423 36.90416457601606 30.105368790767688 3 17.0 16.325 29.025000000000002 37.65 4 22.35 22.225 25.424999999999997 30.0 5 23.525 29.825000000000003 24.05 22.6 6 22.425 33.025 23.525 21.025 7 14.825 27.950000000000003 40.35 16.875 8 18.275 27.025 31.05 23.65 9 17.25 24.75 34.8 23.200000000000003 10-14 20.025000000000002 29.145 28.01 22.82 15-19 20.78 27.725 27.625 23.87 20-24 20.335 28.804999999999996 27.46 23.400000000000002 25-29 20.155 28.565 27.334999999999997 23.945 30-34 19.439999999999998 28.084999999999997 28.345 24.13 35-39 19.79 28.18 27.935 24.095 40-44 19.99 28.050000000000004 27.485 24.474999999999998 45-49 20.09 28.38 27.529999999999998 24.0 50-54 20.630000000000003 28.325 27.375 23.669999999999998 55-59 20.325 28.215 27.99 23.47 60-64 20.01 29.23 27.1 23.66 65-69 20.875 28.125 27.139999999999997 23.86 70-74 20.599999999999998 28.115000000000002 27.22 24.065 75-79 20.885 27.725 27.315 24.075 80-84 20.380000000000003 27.860000000000003 27.700000000000003 24.060000000000002 85-89 20.74 27.235 28.115000000000002 23.91 90-94 20.674999999999997 27.985 27.29 24.05 95-99 20.71 28.03 27.48 23.78 100-104 20.974999999999998 27.825 27.755000000000003 23.445 105-109 20.94 27.955000000000002 27.155 23.95 110-114 20.880000000000003 27.284999999999997 28.13 23.705000000000002 115-119 21.375 27.68 27.43 23.515 120-124 20.810000000000002 27.91 27.02 24.26 125-129 20.965 27.825 26.965 24.245 130-134 21.044999999999998 27.76 27.425 23.77 135-139 21.310000000000002 27.71 26.83 24.15 140-144 21.57 27.68 26.765 23.985 145-149 21.51 27.36 26.805 24.325 150-151 21.975 27.5875 25.9875 24.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.5 22 2.5 23 1.5 24 3.0 25 4.5 26 2.5 27 5.0 28 7.0 29 6.0 30 14.0 31 26.5 32 32.5 33 38.5 34 50.0 35 61.5 36 71.5 37 81.5 38 101.0 39 146.0 40 185.5 41 212.0 42 235.5 43 263.5 44 276.5 45 270.5 46 258.5 47 254.0 48 249.0 49 216.0 50 191.5 51 155.5 52 120.5 53 103.5 54 83.0 55 59.0 56 50.5 57 51.0 58 32.0 59 19.0 60 17.0 61 11.0 62 5.5 63 3.0 64 2.5 65 4.0 66 3.0 67 1.5 68 2.0 69 1.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.55 #Duplication Level Percentage of deduplicated Percentage of total 1 93.11183144246354 86.175 2 5.915721231766613 10.95 3 0.8103727714748784 2.25 4 0.1350621285791464 0.5 5 0.02701242571582928 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTAACAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.23750000000000002 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.6499999999999999 0.0 0.0 0.0 0.0 96-97 0.8500000000000001 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.2374999999999998 0.0 0.0 0.0 0.0 102-103 1.4875 0.0 0.0 0.0 0.0 104-105 1.6625 0.0 0.0 0.0 0.0 106-107 1.85 0.0 0.0 0.0 0.0 108-109 2.0875 0.0 0.0 0.0 0.0 110-111 2.3625 0.0 0.0 0.0 0.0 112-113 2.5875 0.0 0.0 0.0 0.0 114-115 2.925 0.0 0.0 0.0 0.0 116-117 3.3125 0.0 0.0 0.0 0.0 118-119 3.6500000000000004 0.0 0.0 0.0 0.0 120-121 4.0625 0.0 0.0 0.0 0.0 122-123 4.5625 0.0 0.0 0.0 0.0 124-125 5.075 0.0 0.0 0.0 0.0 126-127 5.45 0.0 0.0 0.0 0.0 128-129 5.862500000000001 0.0 0.0 0.0 0.0 130-131 6.300000000000001 0.0 0.0 0.0 0.0 132-133 6.862500000000001 0.0 0.0 0.0 0.0 134-135 7.425 0.0 0.0 0.0 0.0 136-137 8.125 0.0 0.0 0.0 0.0 138-139 8.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCTCT 10 0.006830828 145.0 3 >>END_MODULE SRR12690149 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12690149_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2365 37.0 37.0 37.0 37.0 37.0 2 35.853 37.0 37.0 37.0 37.0 37.0 3 36.1495 37.0 37.0 37.0 37.0 37.0 4 36.022 37.0 37.0 37.0 37.0 37.0 5 36.201 37.0 37.0 37.0 37.0 37.0 6 36.183 37.0 37.0 37.0 37.0 37.0 7 36.1935 37.0 37.0 37.0 37.0 37.0 8 36.269 37.0 37.0 37.0 37.0 37.0 9 36.2225 37.0 37.0 37.0 37.0 37.0 10-14 36.155800000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.1434 37.0 37.0 37.0 37.0 37.0 20-24 36.13340000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.04 37.0 37.0 37.0 37.0 37.0 30-34 36.0625 37.0 37.0 37.0 37.0 37.0 35-39 36.0458 37.0 37.0 37.0 37.0 37.0 40-44 35.987399999999994 37.0 37.0 37.0 37.0 37.0 45-49 35.9831 37.0 37.0 37.0 37.0 37.0 50-54 35.9707 37.0 37.0 37.0 37.0 37.0 55-59 35.9813 37.0 37.0 37.0 37.0 37.0 60-64 35.8716 37.0 37.0 37.0 37.0 37.0 65-69 35.8368 37.0 37.0 37.0 37.0 37.0 70-74 35.834399999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.736000000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.784499999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.768 37.0 37.0 37.0 37.0 37.0 90-94 35.6738 37.0 37.0 37.0 37.0 37.0 95-99 35.74059999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.797799999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.728300000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.60940000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.5678 37.0 37.0 37.0 37.0 37.0 120-124 35.4923 37.0 37.0 37.0 37.0 37.0 125-129 35.483900000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.3763 37.0 37.0 37.0 37.0 37.0 135-139 35.3023 37.0 37.0 37.0 32.2 37.0 140-144 35.2114 37.0 37.0 37.0 27.4 37.0 145-149 35.13099999999999 37.0 37.0 37.0 29.8 37.0 150-151 34.536500000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 7.0 14 1.0 15 2.0 16 3.0 17 3.0 18 0.0 19 1.0 20 1.0 21 1.0 22 7.0 23 6.0 24 6.0 25 7.0 26 9.0 27 16.0 28 20.0 29 23.0 30 19.0 31 45.0 32 64.0 33 107.0 34 209.0 35 623.0 36 2609.0 37 208.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.775 24.875 10.75 23.599999999999998 2 28.050000000000004 27.35 27.474999999999998 17.125 3 21.375 28.375 30.625000000000004 19.625 4 24.275 33.074999999999996 24.15 18.5 5 25.924999999999997 36.4 21.85 15.825 6 22.15 39.125 20.8 17.925 7 20.875 22.525000000000002 36.775000000000006 19.825 8 21.775 25.95 28.275 24.0 9 23.674999999999997 25.0 28.299999999999997 23.025000000000002 10-14 23.39 29.625 26.08 20.905 15-19 23.685000000000002 27.93 27.515 20.87 20-24 23.36 28.599999999999998 26.974999999999998 21.065 25-29 23.65 28.125 27.22 21.005 30-34 23.23 28.67 27.47 20.630000000000003 35-39 22.925 27.97 27.845 21.26 40-44 22.82 28.355000000000004 27.529999999999998 21.295 45-49 23.41 27.76 27.865000000000002 20.965 50-54 22.955000000000002 28.17 27.375 21.5 55-59 23.23 27.589999999999996 27.805000000000003 21.375 60-64 23.385 27.51 27.61 21.495 65-69 23.615 27.96 27.375 21.05 70-74 24.095 27.894999999999996 26.97 21.04 75-79 23.905 28.51 26.525 21.060000000000002 80-84 23.585 28.060000000000002 27.555000000000003 20.8 85-89 23.669999999999998 28.299999999999997 26.369999999999997 21.66 90-94 23.985 27.465 27.325 21.224999999999998 95-99 23.635 28.04 26.85 21.475 100-104 23.724999999999998 27.665 27.38 21.23 105-109 23.56 27.495000000000005 27.950000000000003 20.995 110-114 24.41 28.189999999999998 26.939999999999998 20.46 115-119 24.335 27.855 26.775 21.035 120-124 24.285 27.71 27.445000000000004 20.560000000000002 125-129 25.095 27.845 26.82 20.24 130-134 25.145 27.85 26.229999999999997 20.775 135-139 25.235000000000003 27.955000000000002 26.584999999999997 20.225 140-144 25.180000000000003 27.825 26.495 20.5 145-149 26.415 27.634999999999998 25.82 20.13 150-151 24.9875 28.3375 26.25 20.424999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 1.0 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.5 14 1.0 15 1.5 16 1.5 17 1.0 18 0.5 19 0.0 20 0.5 21 1.0 22 1.5 23 1.0 24 0.5 25 0.5 26 3.5 27 4.5 28 5.5 29 9.0 30 15.0 31 21.0 32 24.5 33 38.0 34 55.0 35 59.0 36 74.5 37 110.5 38 141.0 39 160.0 40 165.5 41 195.0 42 230.5 43 261.0 44 274.0 45 259.0 46 261.0 47 257.5 48 241.5 49 216.5 50 185.5 51 147.5 52 117.0 53 101.5 54 87.5 55 65.0 56 44.0 57 30.5 58 21.5 59 22.0 60 17.0 61 14.0 62 12.0 63 5.5 64 2.0 65 1.5 66 1.0 67 1.5 68 1.0 69 0.0 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.5 98 1.5 99 2.5 100 6.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.325 #Duplication Level Percentage of deduplicated Percentage of total 1 93.28459247224478 86.125 2 5.686433793663688 10.5 3 0.8394259409694016 2.325 4 0.13539128080151638 0.5 5 0.0 0.0 6 0.0 0.0 7 0.027078256160303276 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.027078256160303276 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 15 0.375 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.23750000000000002 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.6499999999999999 0.0 0.0 0.0 0.0 96-97 0.8500000000000001 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.4625 0.0 0.0 0.0 0.0 104-105 1.6375000000000002 0.0 0.0 0.0 0.0 106-107 1.825 0.0 0.0 0.0 0.0 108-109 2.0625 0.0 0.0 0.0 0.0 110-111 2.3375 0.0 0.0 0.0 0.0 112-113 2.5625 0.0 0.0 0.0 0.0 114-115 2.925 0.0 0.0 0.0 0.0 116-117 3.325 0.0 0.0 0.0 0.0 118-119 3.675 0.0 0.0 0.0 0.0 120-121 4.1125 0.0 0.0 0.0 0.0 122-123 4.6375 0.0 0.0 0.0 0.0 124-125 5.15 0.0 0.0 0.0 0.0 126-127 5.525 0.0 0.0 0.0 0.0 128-129 5.925 0.0 0.0 0.0 0.0 130-131 6.35 0.0 0.0 0.0 0.0 132-133 6.887499999999999 0.0 0.0 0.0 0.0 134-135 7.45 0.0 0.0 0.0 0.0 136-137 8.1875 0.0 0.0 0.0 0.0 138-139 8.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTATCA 10 0.006830828 145.0 4 >>END_MODULE Read 932840 spots for SRR12690149.sra Written 932840 spots for SRR12690149.sra Read 932840 spots for SRR12690149.sra Written 932840 spots for SRR12690149.sra Read 932840 spots for SRR12690149.sra Written 932840 spots for SRR12690149.sra Read 932840 spots for SRR12690149.sra Written 932840 spots for SRR12690149.sra Read 932840 spots for SRR12690149.sra Written 932840 spots for SRR12690149.sra Read 932840 spots for SRR12690149.sra Written 932840 spots for SRR12690149.sra Read 932840 spots for SRR12690149.sra Written 932840 spots for SRR12690149.sra Read 932840 spots for SRR12690149.sra Written 932840 spots for SRR12690149.sra Read 932846 spots for SRR12690149.sra Written 932846 spots for SRR12690149.sra Read 932840 spots for SRR12690149.sra Written 932840 spots for SRR12690149.sra Read 932840 spots for SRR12690149.sra Written 932840 spots for SRR12690149.sra Read 932840 spots for SRR12690149.sra Written 932840 spots for SRR12690149.sra Read 932840 spots for SRR12690149.sra Written 932840 spots for SRR12690149.sra Read 932840 spots for SRR12690149.sra Written 932840 spots for SRR12690149.sra Read 932840 spots for SRR12690149.sra Written 932840 spots for SRR12690149.sra Read 932840 spots for SRR12690149.sra Written 932840 spots for SRR12690149.sra Read 932840 spots for SRR12690149.sra Written 932840 spots for SRR12690149.sra Read 932840 spots for SRR12690149.sra Written 932840 spots for SRR12690149.sra Read 932840 spots for SRR12690149.sra Written 932840 spots for SRR12690149.sra Read 932840 spots for SRR12690149.sra Written 932840 spots for SRR12690149.sra SRR ids: ['SRR12690149.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_goctky48 SRR12690149.sra spots: 18656806 blocks: [[1, 932840], [932841, 1865680], [1865681, 2798520], [2798521, 3731360], [3731361, 4664200], [4664201, 5597040], [5597041, 6529880], [6529881, 7462720], [7462721, 8395560], [8395561, 9328400], [9328401, 10261240], [10261241, 11194080], [11194081, 12126920], [12126921, 13059760], [13059761, 13992600], [13992601, 14925440], [14925441, 15858280], [15858281, 16791120], [16791121, 17723960], [17723961, 18656806]] SRR12690149 file size 6318698 SRR12690149 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12690149 SRR12690149_1.fastq SRR12690149_2.fastq Input file: SRR12690149_1.fastq Paired file: SRR12690149_2.fastq trimmed: SRR12690149-trimmed-pair1.fastq, SRR12690149-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:13:09 2025 >> started Mon Feb 10 19:13:37 2025 >> done (28.467s) 18656806 read pairs processed; of these: 69 ( 0.00%) short read pairs filtered out after trimming by size control 9960 ( 0.05%) empty read pairs filtered out after trimming by size control 18646777 (99.95%) read pairs available; of these: 2488230 (13.34%) trimmed read pairs available after processing 16158547 (86.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 3 0.00% 21 7 0.00% 22 13 0.00% 23 8 0.00% 24 16 0.00% 25 12 0.00% 26 13 0.00% 27 18 0.00% 28 22 0.00% 29 25 0.00% 30 18 0.00% 31 30 0.00% 32 27 0.00% 33 31 0.00% 34 22 0.00% 35 25 0.00% 36 31 0.00% 37 32 0.00% 38 34 0.00% 39 29 0.00% 40 45 0.00% 41 44 0.00% 42 44 0.00% 43 49 0.00% 44 40 0.00% 45 54 0.00% 46 53 0.00% 47 54 0.00% 48 68 0.00% 49 74 0.00% 50 90 0.00% 51 116 0.00% 52 115 0.00% 53 138 0.00% 54 134 0.00% 55 174 0.00% 56 167 0.00% 57 186 0.00% 58 215 0.00% 59 296 0.00% 60 283 0.00% 61 396 0.00% 62 398 0.00% 63 442 0.00% 64 513 0.00% 65 590 0.00% 66 631 0.00% 67 756 0.00% 68 843 0.00% 69 893 0.00% 70 1135 0.01% 71 1290 0.01% 72 1440 0.01% 73 1684 0.01% 74 1805 0.01% 75 2016 0.01% 76 2211 0.01% 77 2511 0.01% 78 2785 0.01% 79 3249 0.02% 80 3544 0.02% 81 4096 0.02% 82 4573 0.02% 83 4955 0.03% 84 5543 0.03% 85 6141 0.03% 86 6663 0.04% 87 7207 0.04% 88 7654 0.04% 89 8434 0.05% 90 9239 0.05% 91 9875 0.05% 92 10774 0.06% 93 11681 0.06% 94 12590 0.07% 95 13658 0.07% 96 14123 0.08% 97 15214 0.08% 98 16289 0.09% 99 16762 0.09% 100 17921 0.10% 101 18739 0.10% 102 19896 0.11% 103 21362 0.11% 104 21874 0.12% 105 22985 0.12% 106 24524 0.13% 107 25293 0.14% 108 25840 0.14% 109 26694 0.14% 110 28033 0.15% 111 29059 0.16% 112 30121 0.16% 113 31269 0.17% 114 32169 0.17% 115 33629 0.18% 116 35119 0.19% 117 35803 0.19% 118 36502 0.20% 119 38099 0.20% 120 39445 0.21% 121 40273 0.22% 122 41609 0.22% 123 43067 0.23% 124 44202 0.24% 125 45553 0.24% 126 46526 0.25% 127 47507 0.25% 128 48580 0.26% 129 49652 0.27% 130 50364 0.27% 131 51194 0.27% 132 51964 0.28% 133 54069 0.29% 134 55056 0.30% 135 55758 0.30% 136 57031 0.31% 137 57150 0.31% 138 58018 0.31% 139 60177 0.32% 140 60282 0.32% 141 61422 0.33% 142 62949 0.34% 143 63758 0.34% 144 65348 0.35% 145 65991 0.35% 146 66263 0.36% 147 66777 0.36% 148 67941 0.36% 149 68681 0.37% 150 69225 0.37% 151 16158547 86.66% 18646777 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=19 prefix-density=0.75 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=62.70 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.0 sequence=AGCAGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGTTGGAAAA criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=3.25 fanout-score-rank=15 prefix-density=1.27 prefix-fanout=1.6 sequence=ATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=46.24 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.6 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAAT SRR12690149 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:14:26 Started mapping on | Feb 10 19:14:26 Finished on | Feb 10 19:16:15 Mapping speed, Million of reads per hour | 615.86 Number of input reads | 18646777 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 17592350 Uniquely mapped reads % | 94.35% Average mapped length | 294.31 Number of splices: Total | 17694690 Number of splices: Annotated (sjdb) | 17331265 Number of splices: GT/AG | 17323741 Number of splices: GC/AG | 308527 Number of splices: AT/AC | 13727 Number of splices: Non-canonical | 48695 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 456663 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 97196 % of reads mapped to too many loci | 0.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.48% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 597764 597764 597764 N_multimapping 456663 456663 456663 N_noFeature 551621 17379774 616326 N_ambiguous 265854 1023 117270 UnstrandedReadsAssigned:16774875 PositiveStrandReadsAssigned:211553 NegativeStrandReadsAssigned:16858754 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12690149 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12690149-trimmed-pair1.fastq SRR12690149-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,646,777 reads, 16,971,934 reads pseudoaligned [quant] estimated average fragment length: 243.568 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,198 rounds 52401 SRR12690149.ke.tsv 34699 SRR12690149.se.tsv 87100 total ==> SRR12690149.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.43 375 11.1161 Potri.005G024800.1.v4.1 1035 792.432 197 13.0836 Potri.004G059700.1.v4.1 961 718.499 52 3.80891 Potri.007G009000.2.v4.1 1416 1173.43 0 0 Potri.003G141000.2.v4.1 2943 2700.43 553 10.7774 Potri.016G087400.1.v4.1 270 88.1242 904 539.88 Potri.015G069301.1.v4.1 564 331.328 0 0 Potri.010G195200.1.v4.1 1773 1530.43 0 0 Potri.012G127500.1.v4.1 977 734.457 645 46.2187 ==> SRR12690149.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 129 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 210 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 17 SRR12690149 completed mapping pipeline successfully